CN102250899A - MiRNA-GramiRn22 from cotton and applications thereof - Google Patents
MiRNA-GramiRn22 from cotton and applications thereof Download PDFInfo
- Publication number
- CN102250899A CN102250899A CN2011101702722A CN201110170272A CN102250899A CN 102250899 A CN102250899 A CN 102250899A CN 2011101702722 A CN2011101702722 A CN 2011101702722A CN 201110170272 A CN201110170272 A CN 201110170272A CN 102250899 A CN102250899 A CN 102250899A
- Authority
- CN
- China
- Prior art keywords
- mirna
- sequence
- gramirn22
- cotton
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses miRNA-GramiRn22 from cotton and applications thereof. The miRNA-GramiRn22 protected by the invention is RNA represented by SEQ ID NO:1 in a sequence table, and a precursor of the miRNA-GramiRn22 (pre-gramiRn22) is RNA represented by SEQ ID NO:2 in the sequence table. Applications of the RNA represented by SEQ ID NO:1 and/or SEQ ID NO:2 in inhibiting pre-mRNA splicing factor gene expression and/or promoting mRNA degradation of the pre-mRNA splicing factor gene are protected, the pre-mRNA splicing factor is represented by a SEQ ID NO:3 in the sequence table, and the pre-mRNA splicing factor gene is represented by SEQ ID NO:4 in the sequence table. Plants with important phenotypes in aspects of adversity stress tolerance and growing development may be obtained through adopting the miRNA-GramiRn22, so the miRNA-GramiRn22 has important biological significances and latent application values, provides precious gene resources for cotton quality breeding (stress resistant cotton cultivation for example), brings certain research values and social benefits, and finally can be used in practical production.
Description
Technical field
The present invention relates to a kind of miRNA-GramiRn22 and application thereof that derives from cotton.
Background technology
MiRNA (microRNA, Microrna) is the non-coding small molecule RNA of endogenous strand that a class length is about 20-24nt, extensively exists in organism.Studies show that in a large number that in recent years miRNA can regulate and control many expression of gene in the organism, grow in adjusting, cell proliferation, apoptosis, resist all many-sides such as environment-stress and play a significant role.Mirnas of plant is mainly by cutting target gene mRNA, or suppresses the said target mrna translation, and regulate and control plant individual and grow and influence its physiological process, be a kind of new gene regulating pattern, have important Research Significance.
Cotton is one of most important cash crop in the world, and cotton fiber also is the good model of the unicellular elongation of research simultaneously.With Arabidopis thaliana, paddy rice isotype biophase ratio, the cotton miRNA quantity that has been found that at present is very few, therefore pass through high throughput sequencing technologies, be expected to excavate more cotton miRNA, this forming process, constructional feature and functional mechanism for overall understanding cotton and even whole plants miRNA has realistic meaning.In addition, miRNA may be at many physiological processs (as the initial of fiber and elongation etc.) performance critical function in the cotton, but the biological function research about miRNA in the cotton is very few, therefore, by paying close attention to the miRNA in specific developmental stage, the particular organization, be expected to illustrate the physiological process that cotton miRNA participates in, and the effect of concrete performance in this process.
China is main in the world Cotton Production and country of consumption, and cotton has critical role for China.Both at home and abroad except utilizing the conventional breeding means, progressively using genetic engineering technique that cotton quality (output, pest-resistant etc.) is carried out genetic improvement has become a kind of trend.Because miRNA has regulating and controlling effect widely to plant, become one of primary study gene of genetic modification of plants probably, therefore press for by the large scale sequencing method and fully excavate and develop the new miRNA gene that belongs to national intellecture property, thereby be that later stage orderly improvement and the cotton variety of cultivating the high-quality proterties lay the foundation.
Summary of the invention
The purpose of this invention is to provide a kind of miRNA-GramiRn22 and application thereof that derives from cotton.
The sequence following (5 ' → 3 ') of the miRNA-GramiRn22 of the present invention's protection:
UAUGAAACUGUGAUUCCACGUCAU (sequence 1 of sequence table).
MiRNA-GramiRn22 precursor (pre-GramiRn22) sequence following (5 ' → 3 ') of the present invention's protection:
AAUGGACUUGUAUGAAACUGUGAUUCCACGUCAUUUUUAUCCCUUUCCUUUAGGAGAAUGACAAAUCAGAUUUUUCCTACU-78nt-AGGAACAACGUGGAAUCACAAUUUCAUACAAUCCUUU。(sequence 2 of sequence table).
The present invention also protects RNA shown in the sequence 2 of RNA shown in the sequence 1 of sequence table and/or sequence table suppressing the application of mRNA precursor splicing factor (TC255234) in expressing; Described mRNA precursor splicing factor is shown in the sequence 3 of sequence table. as described in mRNA precursor splicing factor gene specifically can be shown in the sequence 4 of sequence table or the sequence 4 of sequence table from shown in 5 ' terminal the 12nd to 590 Nucleotide.
The present invention also protects the application of RNA in the mRNA degraded that promotes mRNA precursor splicing factor gene (TC255234) shown in the sequence 2 of RNA shown in the sequence 1 of sequence table and/or sequence table; Described mRNA precursor splicing factor is shown in the sequence 3 of sequence table. as described in mRNA precursor splicing factor gene specifically can be shown in the sequence 4 of sequence table or the sequence 4 of sequence table from shown in 5 ' terminal the 12nd to 590 Nucleotide.
Solexa has overcome the shortcoming of conventional miRNA clone technology, has highly sensitive advantage, can detect a minimum small RNA molecular, and the accuracy height, and the small RNA molecular base error rate that detects is extremely low.This technology also has high-throughput, large-scale characteristics simultaneously, and the order-checking amount in two libraries is up to 5,000,000 more than the little RNA sequence.Based on this up-to-date order-checking means, will be expected to discern the new miRNA of specific developmental stage particular organization specifically expressing in the cotton.
The present invention adopts advanced in the world Solexa high throughput sequencing technologies in conjunction with various biological means such as bioinformatic analysis, Northern hybridization, 5 ' RACE, identify miRNA-GramiRn22 from genomic level first, and the target gene that confirms GramiRn22 is a mRNA precursor splicing factor gene, has participated in the regulation and control that cotton fiber is initial and ovule is grown.This all will provide valuable genetic resources for the quality breeding (as improving production of cotton fibers) of cotton, bring certain researching value and social benefit, and finally be used for actual production.MiRNA wide participation provided by the invention the adjusting of the multiple vital movement of cotton, have important biological significance and potential using value.
Description of drawings
Fig. 1 is for separating and identify the schema of new miRNA in the little RNA sequencing data.
Fig. 2 is the precursor secondary structure figure of miRNA-GramiRn22; Black line is partly indicated the position at ripe miRNA place.
Bloom for Northern hybridization the detects expression of preceding 3 days miRNA-GramiRn22 to bloom back 3 days wild-types and the mutant cotton ovule of Fig. 3.
Fig. 4 is target gene 5 ' the RACE checking of miRNA-GramiRn22; The arrow of sequence top is represented the site of cutting, and clone's number and the total ratio of clone of cutting takes place at numeric representation this place, point of contact.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is ordinary method.Used test materials among the following embodiment if no special instructions, is to buy from routine biochemistry reagent shop and obtains.Quantitative test in following examples all is provided with repeated experiments three times, results averaged.
Used cotton variety comprises upland cotton Xuzhou 142 (Gossypium hirsutum cv.Xuzhou 142 in following examples, below, abbreviate wild-type as) and do not have fiber mutant (being designated hereinafter simply as mutant), cotton seeds derives from National Cotton storehouse in mid-term, wherein the wild-type storehouse number is 110599, and mutant library number is 140142.
Cotton was planted in the field the last ten-days period in April, routine work, and petal bagging the day before yesterday of blooming prevents that pollen transmission from causing cross-pollination, removed bag the same day of blooming, and the mark of listing.Collect bloom preceding 3 days (3) respectively, the cotton boll of bloom preceding 1 day (1), bloom the same day (0), bloom back 1 day (1), bloom back 3 days (3), cut open and get ovule, frozen in liquid nitrogen rapidly, be stored in-80 ℃ standby.
The discovery of embodiment 2, miRNA-GramiRn22
1, RNA extracts
The cotton ovule sample that embodiment 1 is obtained grinds in liquid nitrogen, adds PVP (by 1/5 mass ratio) in the process of lapping and to prevent the phenols oxidation, uses PureLink
TMPlant RNA Reagent (Invitrogen) extracts total RNA, operation steps following (with the 0.1g material is example, and the corresponding reagent amount can be adjusted in proportion according to quantity of material):
1. the ovule powder that mill is good joins in the 1ml extraction damping fluid, adds 20 μ l beta-mercaptoethanols, and mixing was placed on room temperature 10-15 minute.Centrifugal 5 minutes of 12000 rev/mins of 4 degree go to new centrifuge tube with supernatant, add 100 μ l5M NaCl, add 300 μ l chloroforms behind the mixing, abundant mixing, and centrifugal 10 minutes of 12000 rev/mins of 4 degree go to new centrifuge tube with supernatant;
2. the solution that produces is used chloroform, phenol, phenol successively: chloroform (1: 1), chloroform extracting, supernatant liquor after four extractings changes new centrifuge tube over to, add 100 μ l polysaccharide removers (Beijing CHMC ocean bio tech ltd), add 200 μ l chloroforms behind the mixing, abundant mixing, 4 the degree 12000 rev/mins centrifugal 10 minutes, supernatant is gone to new centrifuge tube;
3. add isopyknic Virahol, mixing postposition-20 was spent more than 1 hour, and centrifugal 10 minutes of 12000 rev/mins of 4 degree are abandoned supernatant, and the centrifugal precipitation that obtains is dissolved in after drying in an amount of DEPC water with 75% washing with alcohol.
Use Ultrospec 3000 type ultraviolet spectrophotometers (Amersham Biosciences) to measure the RNA of extraction at 260nm (OD
260) and 280nm (OD
280) absorbance of wavelength to be to determine purity and the concentration of RNA.Up-to-standard RNA concentration should be more than 1 μ g/ μ l, OD
260/ OD
280Ratio between 1.8-2.0, and clear through the electrophoresis detection band, no obvious degradation and DNA pollute.
2, the structure in little RNA library
The total RNA of the cotton ovule that quality test is qualified is used to make up little RNA library.The RNA of the ovule sample extraction of 5 different times respectively gets 10 μ g balanced mix, and 50 μ g are used to make up little RNA library altogether.The structure in little RNA library carries out according to Illumina Sample Preparation Protocol library constructing method, Solexa high-flux sequence (Huada Gene Research Center, Beijing) is adopted in the library that builds, and obtains the little RNA sequence of high-quality 18-30nt.
3, the evaluation of new miRNA in the little RNA library
Foreign literature is to successful methods (the Jones-Rhoades M W of high-flux sequence data analysis before the reference, Bartel D P.Computational identification of plant miRNAs and their targets, including a stress-induced miRNA.Mol.Cell, 2004,14:787-799.), set up a cover computer analysis method and be used for finding and identify cotton miRNA (analysis process is as shown in Figure 1) in the sequencing data.Original series in two little RNA libraries that 1. will obtain removes 3 ' joint by computer approach, and filters out the sequence of sequence length below 18nt, obtains so-called " totally " sequence library; 2. the sequence of " totally " and the middle miRNA mature sequence of announcing of miRNA database miRBase (http://microrna.sanger.ac.uk/sequences/) of internal authority are carried out BLAST, thereby find which sequence comes from known miRNA, the sequence that known miRNA surpasses 2 mispairing enters next step analysis again; 4. will get rid of for the sequence of conservative miRNA again with known organelle gene database, and other non-coding RNA database, comprise Arabidopis thaliana Mitochondrial DNA (www.arabidopsis.org), rape Mitochondrial DNA (NCBI), upland cotton plastid DNA (NCBI), plant snRNA and snoRNA (NCBI), upland cotton and Arabidopis thaliana rRNA (NCBI), and tRNA (http://gtrnadb.ucsc.edu) mates, thereby find which sequence comes from organoid RNA and other non-coding RNA, filter out these sequences, may contain new miRNA in the remaining sequence, be called potential miRNA sequence library; 5. sequence in the potential miRNA sequence library and existing cotton database are carried out BLAST, database comprise cotton EST (
Http:// compbio.dfci.harvard.edu), the genome sequence of cotton GSS (NCBI) and existing part Lei Mengdeshi cotton (Gossypium raimondii).Sequence corresponding in the cotton database that finds is carried out next step analysis.6. use miRNA front body structure forecasting software mireap_0.2 (http://sourceforge.net/projects/mireap), to there being the sequence of little RNA correspondence to carry out secondary structure analysis in the cotton database that obtains, if the good loop-stem structure that can form similar miRNA precursor (pre-miRNA) then this sequence can think candidate's new miRNA; 7. the new miRNA to the candidate proceeds screening, the little RNA distribution characteristics of the loop-stem structure precursor at investigation candidate's new miRNA sequence place, if mainly be distributed in candidate's new miRNA zone and corresponding miRNA* zone, think that then this candidate's new miRNA sequence height is credible, be real miRNA sequence (Meyers B C, Axtell M J, Bartel B, Bartel D P, Baulcombe D, Bowman J L, Cao X, Carington J C, Chen X, Green P J, et al.Criteria for annotation of plant microRNAs.Plant Cell, 2008,20:3186-3190.).
Identify 1 new miRNA, called after miRNA-GramiRn22.
The sequence of miRNA-GramiRn22 following (5 ' → 3 '): UAUGAAACUGUGAUUCCACGUCAU.
Order-checking number of times (the Q in the little RNA of wild-type library
WT) be 43, the little RNA of mutant library (Q
MU) the order-checking number of times be 58.
The secondary loop-stem structure of miRNA precursor (pre-miRNA) sequence is one of outstanding feature of miRNA gene, also is all impassable important rule of all miRNA authentication methods.
GramiRn22 precursor (pre-gramiRn22) sequence following (5 ' → 3 '):
AAUGGACUUGUAUGAAACUGUGAUUCCACGUCAUUUUUAUCCCUUUCCUUUAGGAG AAUGACAAAUCAGAUUUUUCCTACU-78nt-AGGAACAACGUGGAAUCACAAUUUC AUACAAUCCUUU (sequence 2 of sequence table).
Pre-gramiRn22 can form good loop-stem structure, and sophisticated miRNA produces from the stem of miRNA precursor, meets the constitutional features (see figure 2) of miRNA precursor fully.
Bloom preceding 3 days to the back 3 days expression patterns in cotton ovule of blooming in order further to detect miRNA-GramiRn22, adopting miRNA Northern hybridization to detect its expression.
1, preparation probe
Detect the sequence of the probe (5 ' → 3 ') of miRNA-GramiRn22: ATGACGTGGAATCACAGTTTCATA.
Adopt T4 polynueleotide kinase (New England Biolabs) that above-mentioned sequence terminal phosphate group is carried out isotropic substance (γ-32P ATP) mark, obtain probe, with Microspin G-25 post (GE Healthcare) purifying probe, remove unlabelled isotropic substance, the probe behind the purifying is used for Northern hybridization.
2, miRNA Northern hybridization
In the Northern hybridization, each swimming lane applied sample amount is the total RNA of 30 μ g, and U6RNA detects on same film with miRNA as confidential reference items.The probe sequence of U6 gene is: TGTATCGTTCCAATTTTATCGGATGT.
(1) extracts total RNA of each ovule sample that embodiment 1 obtains respectively.
(2) miRNA Northern hybridization
1. get total RNA of 30 μ g amount, add isopyknic 2 * RNA sample-loading buffer (95% methane amide, 18mM EDTA, 0.1% tetrabromophenol sulfonphthalein and 0.1% dimethylbenzene green grass or young crops), mix back 95 ℃ of sex change 5min, obtain the RNA sample.
2. the RNA sample separates with 15% urea-denatured polyacrylamide gel electrophoresis, and electricity consumption transfer device (BIO-RAD) is transferred on the Hybond N+ nylon membrane (Amersham Biosciences) subsequently.
3. shift the RNA sample is arranged nylon membrane through the of short duration rinsing of 6 * SSC solution, UV-crosslinked (Stratagene) 5min, 80 ℃ of baking 2h are completely fixed on the nylon membrane RNA again.
4. the nylon membrane that will shift RNA is put into hybrid pipe, adds 5ml ULTRAhyb-Oligo hybridization solution (Ambion) 42 ℃ of prehybridization 2h in hybrid heater, adds probe then, mixing, and 42 ℃ of hybridization are spent the night.
5. after hybridization finishes, carefully pour out hybridization solution, add the 2 * SSC solution that contains 0.5%SDS, 42 ℃ are washed three times, each 10min.
6. after washing the film end, film is wrapped up smooth being pressed under the X-ray sheet, additional intensifying screen ,-70 ℃ of 2 weeks of exposure with preservative film.
7. behind the end exposure, towards X-ray sheet developing, carrying out densitometric scan, is 1 with the hybridization signal of control group, calculates the relative intensity of each treatment group hybridization signal.
The Northern results of hybridization is seen Fig. 3.In the wild-type (WT), miRNA-GramiRn22 is being bloomed preceding 3 days to blooming back 3 days, and expression amount presents ascendant trend substantially.And in mutant (MU), the expression amount of miRNA-GramiRn22 is on a declining curve, has hinted that GramiRn22 may play an important role in the cotton fiber initiating process.
Target gene prediction and the checking of embodiment 4, miRNA
Because Mirnas of plant and target gene mRNA are close to complementary fully, therefore can predict the target gene of miRNA-GramiRn22 by bioinformatics method.Adopt online software psRNATarget (http://plantgrn.noble.org/psRNATarget/) in cotton est database CGI10, to search out and to be close to complete complementary cDNA or gene with the miRNA sequence, be the target of miRNA; Parameter is set to: the psRNATarget program parameter is a default setting, and the function of target is by NCBI (http://www.ncbi.nlm.nih.gov/) homology search, and the known function gene the highest with homology carries out note.
Predict the outcome and see Table 1.
Target gene and the function of table 1miRNA-GramiRn22
The target gene of miRNA-GramiRn22 is that mRNA precursor splicing factor (pre-mRNA splicing factor) gene TC255234 (sees the sequence 4 of sequence table, its encoded protein matter is seen the sequence 3 of sequence table), participate in the processing of a series of important gene mRNA precursors.In Arabidopis thaliana, this gene (atSRp30) is a kind of mRNA precursor splicing factor, the transfer-gen plant of this gene of overexpression is compared with the wild-type plant, there were significant differences for its blade trichome development, the growth that this gene pairs blade table fur is described has important regulation (Sergiy Lopato, Maria Kalyna, Silke Dorner, Ryuji Kobayashi, Adrian R.Krainer, and Andrea Barta.atSRp30, one of two SF2/ASF-like proteins from Arabidopsis thaliana, regulates splicing of specific plant genes.Genes ﹠amp; Development, 1999,13:987-1001.).This gene is also brought into play important regulation in cotton fiber development.
Embodiment 5, miRNA are to the cutting of target gene mRNA
MiRNA-GramiRn22 verifies (Jones-Rhoades M W to the cutting of target gene TC255234 (seeing the sequence 4 of sequence table) mRNA with 5 ' RACE method, Bartel D P.Computational identification of plant miRNAs and their targets, including a stress-induced miRNA.Mol.Cell, 2004,14:787-799.).After target gene mRNA was cut by miRNA, its comparatively stable 3 ' cleaved products, 5 ' terminal nucleotide phosphate group exposed, and connected last 5 ' RACE special joint with the T4RNA ligase enzyme at this cleaved products 5 ' end; By the synthetic cDNA of reverse transcription reaction; By special nido outer primer of target gene and test kit with the nido outer primer carry out first round PCR, nido inner primer that target gene is special and test kit with the nido inner primer carry out second and take turns PCR; Check order after the PCR product that 5 ' RACE is obtained is connected to pMD 19-T carrier, just can know accurate target gene mRNA cleavage site.Primer in above-mentioned 5 ' the RACE method is at target gene TC255234 (seeing the sequence 4 of sequence table).
1, extracts total RNA of each ovule sample of embodiment 1 acquisition respectively.
2, the total RNA reverse transcription with step 1 is cDNA; Carry out 5 ' RACE by Firstchoice RLM-RACE test kit (Ambion) operation instructions, with cDNA be template pass through special nido outer primer of target gene (5 '-ATCCTCCCGATCTCCTTCCACAGT-3 ') and test kit with the nido outer primer carry out first round PCR, with first round PCR product be template pass through special nido inner primer of target gene (5 '-TTGCTGAACTCCAGGAAATGTGTCGG-3 ') and test kit with the nido inner primer carry out second and take turns PCR.
3, with second taking turns the PCR product and carry out agarose electrophoresis in the step 2, reclaim the specific band about 150bp.
4, the specific band that step 3 is reclaimed is received pMD 19-T carrier (TaKaRa), and transformed into escherichia coli DH5 α (available from American I nvitrogen company, catalog number is 18258-012).
5, choose the mono-clonal order-checking, determine the cleavage site of target gene mRNA according to sequencing result.
The cleavage site that sequencing result shows is seen Fig. 4.Cutting is taking place with its complementary zone in the target gene of miRNA-GramiRn22, and the strong TC255234 that proved of this result is the target gene of real regulation and control in the miRNA-GramiRn22 body really.
Claims (7)
1. the RNA shown in the sequence 1 of sequence table.
2. the RNA shown in the sequence 2 of sequence table.
3. the application of RNA shown in RNA shown in the sequence 1 and/or the sequence 2 in suppressing the genetic expression of mRNA precursor splicing factor; Described mRNA precursor splicing factor is shown in the sequence 3 of sequence table.
4. application as claimed in claim 3 is characterized in that: described mRNA precursor splicing factor gene shown in the sequence 4 of sequence table or the sequence 4 of sequence table from shown in 5 ' terminal the 12nd to 590 Nucleotide.
5. the application of RNA shown in RNA shown in the sequence 1 and/or the sequence 2 in the mRNA degraded that promotes mRNA precursor splicing factor gene; Described mRNA precursor splicing factor is shown in the sequence 3 of sequence table.
6. application as claimed in claim 5 is characterized in that: described mRNA precursor splicing factor gene shown in the sequence 4 of sequence table or the sequence 4 of sequence table from shown in 5 ' terminal the 12nd to 590 Nucleotide.
7. the application of the RNA shown in the sequence 2 of RNA shown in the sequence 1 of sequence table and/or sequence table in the cotton fiber quality improvement.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110170272.2A CN102250899B (en) | 2011-06-22 | 2011-06-22 | MiRNA-GramiRn22 from cotton and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110170272.2A CN102250899B (en) | 2011-06-22 | 2011-06-22 | MiRNA-GramiRn22 from cotton and applications thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102250899A true CN102250899A (en) | 2011-11-23 |
| CN102250899B CN102250899B (en) | 2014-05-14 |
Family
ID=44978468
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110170272.2A Expired - Fee Related CN102250899B (en) | 2011-06-22 | 2011-06-22 | MiRNA-GramiRn22 from cotton and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102250899B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925442A (en) * | 2012-10-19 | 2013-02-13 | 清华大学 | Cotton-derived miRNA (microribonucleic acid)-GhmiRnC and application thereof |
-
2011
- 2011-06-22 CN CN201110170272.2A patent/CN102250899B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| CESAR LIAVE 等: "Cleavage of Scarecrow-like mRNA Targets Directed by a Class of Arabidopsis miRNA", 《SCIENCE》 * |
| 何祥凤: "油菜中保守的和新的miRNA及其靶标基因的鉴定", 《中国科学院微生物研究所博士学位论文》 * |
| 金龙国 等: "植物MicroRNA", 《中国生物化学与分子生物学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925442A (en) * | 2012-10-19 | 2013-02-13 | 清华大学 | Cotton-derived miRNA (microribonucleic acid)-GhmiRnC and application thereof |
| CN102925442B (en) * | 2012-10-19 | 2014-06-04 | 清华大学 | Cotton-derived miRNA (microribonucleic acid)-GhmiRnC and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102250899B (en) | 2014-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Peláez et al. | Identification and characterization of microRNAs in Phaseolus vulgaris by high-throughput sequencing | |
| Liu et al. | Identification of miRNAs and their target genes in developing maize ears by combined small RNA and degradome sequencing | |
| Zhao et al. | LncRNAs in polyploid cotton interspecific hybrids are derived from transposon neofunctionalization | |
| Peng et al. | Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa) | |
| Zhang et al. | Genome-wide identification of conserved microRNA and their response to drought stress in Dongxiang wild rice (Oryza rufipogon Griff.) | |
| Xu et al. | Genome-wide survey and expression profiles of the AP2/ERF family in castor bean (Ricinus communis L.) | |
| Zhu et al. | Genome-wide transcriptomic and phylogenetic analyses reveal distinct aluminum-tolerance mechanisms in the aluminum-accumulating species buckwheat (Fagopyrum tataricum) | |
| Kim et al. | Identification and profiling of novel microRNAs in the Brassica rapa genome based on small RNA deep sequencing | |
| Liu et al. | Evolution and domestication footprints uncovered from the genomes of Coix | |
| CN102277357A (en) | miRNA (Micro Ribonucleic Acid)-GhmiR156 from cotton and application thereof | |
| Ortiz et al. | Small RNA-seq reveals novel regulatory components for apomixis in Paspalum notatum | |
| Ling et al. | Exploring the evolutionary differences of SBP-box genes targeted by miR156 and miR529 in plants | |
| Yan et al. | Autopolyploidization in switchgrass alters phenotype and flowering time via epigenetic and transcription regulation | |
| CN103361346A (en) | Method for cloning and analyzing populus diversifolia micro RNAs (ribonucleic acids) precursor | |
| Liu et al. | Transcript profiling of microRNAs during the early development of the maize brace root via Solexa sequencing | |
| CN101892232B (en) | miRNA-n3 derived from rice and application thereof | |
| Zhang et al. | Analysis of miRNA-mediated regulation of flowering induction in Lilium× formolongi | |
| CN102250899B (en) | MiRNA-GramiRn22 from cotton and applications thereof | |
| Wang et al. | High-throughput sequencing-based genome-wide identification of microRNAs expressed in developing cotton seeds | |
| CN102925442B (en) | Cotton-derived miRNA (microribonucleic acid)-GhmiRnC and application thereof | |
| Sun et al. | Genome-wide analysis of miRNAs in Carya cathayensis | |
| CN102286485B (en) | MiRNA-GhmiR171 from cotton and use thereof | |
| CN102899326B (en) | MiRNA-GhmiRnE coming from cotton and application thereof | |
| Lu et al. | Genome-wide analysis and identification of microRNAs in Medicago truncatula under aluminum stress | |
| Sierocka et al. | The identification of differentially expressed genes in male and female gametophytes of simple thalloid liverwort Pellia endiviifolia sp. B using an RNA-seq approach |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140514 Termination date: 20150622 |
|
| EXPY | Termination of patent right or utility model |