CN102241751B - Novel fungal immunomodulatory protein FIP-NHA with antineoplastic activity and gene thereof - Google Patents
Novel fungal immunomodulatory protein FIP-NHA with antineoplastic activity and gene thereof Download PDFInfo
- Publication number
- CN102241751B CN102241751B CN 201110098564 CN201110098564A CN102241751B CN 102241751 B CN102241751 B CN 102241751B CN 201110098564 CN201110098564 CN 201110098564 CN 201110098564 A CN201110098564 A CN 201110098564A CN 102241751 B CN102241751 B CN 102241751B
- Authority
- CN
- China
- Prior art keywords
- nha
- fip
- immunomodulatory protein
- fungal immunomodulatory
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention relates to the field of genetic engineering, in particular to a novel fungal immunomodulatory protein FIP-NHA with antineoplastic activity and a gene thereof. The fungal immunomodulatory protein FIP-NHA according to the invention has an amino acid sequence as shown in SEQ ID NO. 1, and the gene fip-nha for coding the fungal immunomodulatory protein has a nucleotide sequence as shown in SEQ ID NO. 2. The fungal immunomodulatory protein FIP-NHA provided by the invention has the effects on promoting splenic lymphocyte division, increasing synthesis of interleukin 2, and obviously inhibiting proliferation of three tumor cells including hepatoma cell HepG2, gastric cancer cell MGC823 and leukemia cell HL60, therefore, the fungal immunomodulatory protein FIP-NHA as a novel antineoplastic biological agent can be widely used in the fields of health products and biological medicines.
Description
Technical field
The present invention relates to the genetically engineered field, particularly, relate to a kind of novel fungitype immune modulator FIP-NHA and gene thereof with anti-tumor activity.
Background technology
Fungal immunomodulatory protein (FIPs) is to extract in recent years the small molecule protein that obtains from some Higher basidiomycetes (mushroom class) sporophore, have immunomodulatory, antitumor, antiviral, antimycotic, reduce cholesterol and suppress the various biological such as human body autoimmunity active, thereby FIPs has important health care, medical science, pharmacy value.It is similar to traditional immune modulator phytohemagglutinin, but has himself obvious characteristics and advantages, and be embodied in the following aspects: 1) the lectin molecular weight is generally larger, is 20-100kD, and the FIPs molecular weight is the 13kD left and right; 2) fermentation liquor does not weaken haemagglutination and the immunoregulatory activity of FIPs, and typical lectin can be subject to the inhibition of monose or disaccharides; 3) 10 amino acid whose α spirals of FIPs N end are very important for the induction of immunity activity, and this structure does not exist in some lectins.
Reported in the world at present from red ganoderma (Ganoderma lucidum), Ganoderma sinense Zhao, Xu et Zhang (Ganodermajaponcium), Ganoderma tsugae (Ganoderma tsugae), little spore glossy ganoderma (Ganoderma microsporum), needle mushroom (Flammulina velutipes) and straw mushroom (Volvariella volvacea) separation and purification 6 kinds of FIPs albumen, respectively called after LZ-8, Gja, Gts, Gmi, Fve, Vvo and Vvl.6 kinds of FIPs albumen are comprised of 110～114 amino acid, there is no His, Cys and Met, but are rich in Asp and Val.The amino acid of its N end is the acetylize blocked amino acid, and molecular weight is about 12～13kD.The conservative part of the immunoglobulin heavy chain variable region of this proteinoid and the mankind and muroid has higher homology.Have higher homology between different FIPs, be about 57%～100%.The homodimer that natural fungal immunomodulatory protein all is comprised of two identical subunits.About 13 the amino acids formed α spirals of N end are to the formation of fungal immunomodulatory protein dimerization and effectively to exercise its immunoloregulation function very necessary.In recent years, along with the discovery of fungal immunomodulatory protein function and the people enhancing to health demand, research and utilization to immune modulator are had higher requirement, and fungal immunomodulatory protein is regulated albumen as a class Novel immune, has very large potential using value.Based on known FIPs albumen again seldom, people have keen interest to its biological characteristics, immunoloregulation function and molecular biology research, especially developing rapidly along with molecular biology and biotechnology, utilize the cultivation of engineering strain to obtain a large amount of recombinant immunes and regulate albumen and carry out the research of structure, function and the high efficient expression of engineering bacteria to fungal immunomodulatory protein in a deep going way and be of great significance and value, the exploitation of fungal immunomodulatory protein have bright prospects.
Clinical all have certain dosage requirement with medical applications, find in experimentation that there is dosage effect in different FIP family members in inspiring immunoreaction process, such as in activating the human peripheral lymphocyte proliferation experiment, the effective concentration of FIP-fve is 100 μ g/ml, the effective concentration of FIP-vvo is only 5 μ g/ml, and LZ-8 promotes that the optimum concn of mice spleen cell propagation is 3.13 μ g/ml.This similar drug of development and application, must obtain a considerable amount of protein sterlings, yet mushroom contains a large amount of polysaccharide and other complicated ingredient, extract natural FIPs difficulty from mushroom and measure greatly again less, can only extract a milligram level albumen from every kilogram of mushroom, so mushroom extraction albumen cost is high, consuming time, effort, high consumption, amount is few.The FIP-vvo that purify from 3kg straw mushroom sporophore such as HSU in 1997 are through the final protein that obtains of different purification steps 94mg only.Therefore the recombinant expressed FIPs albumen that obtains high and stable yields is determined to win.
The present invention chooses new thinking, utilize bioinformatics method to obtain a kind of new fungal immunomodulatory protein, and utilize engineered method to obtain sterling FIP-NPA albumen, it is carried out that a series of immunologic functions are identified and the immunologic competence analysis such as antitumor.The FIPs albumen of report only has six kinds in the world at present, and all obtains from mushroom, and the present invention had both enriched the kind of FIPs family like this, had avoided the many disadvantages of mushroom protein extraction, had satisfied again the demand of clinical study and the needs of industrialization.
Summary of the invention
The purpose of this invention is to provide and derive from bacterial strain Nectria haematococca mpVI 77-13-4 (its ATCC preserving number is: fungal immunomodulatory protein FIP-NHA MYA-4622).
A further object of the present invention is to provide the gene of above-mentioned fungal immunomodulatory protein FIP-NHA.
A further object of the present invention is to provide the recombinant vectors that comprises above-mentioned fungal immunomodulatory protein FIP-NHA.
A further object of the present invention is to provide the recombinant bacterial strain that comprises above-mentioned fungal immunomodulatory protein FIP-NHA.
A further object of the present invention is to provide a kind of method for preparing fungal immunomodulatory protein FIP-NHA.
A further object of the present invention is to provide the above-mentioned antitumor drug that contains above-mentioned fungal immunomodulatory protein FIP-NHA.
The present invention's technical problem at first to be solved is to overcome the deficiencies in the prior art, provides a kind of fast and convenient obtaining to be suitable for the novel fungitype immune modulator FIP-NHA that uses in healthcare products and medicine.The inventor screens the immune modulator FIP-NHA of a kind of fungi of originating by bioinformatics method, it is suitable for using in healthcare products and medicine.
Obtained a kind of fungal immunomodulatory protein FIP-NHA from above-mentioned bacterial strains, its aminoacid sequence such as SEQ ID NO.1:
MATTNDSAVL?FYIVASQKKL?SFDYTPNWGR?GSPNSYIDNL?TFPRVLTNKP
YKYRVVKAGQ?DLGVRDSYSV?QSDGSQKVNF?LEYNAGRGIA?DTQTIQVYVV
DPDNGNQYLV?AQWK
114 amino acid of this fungal immunomodulatory protein FIP-NHA total length, theoretical molecular is 12.837kDa
The present invention also provides and has synthesized the gene of the above-mentioned fungal immunomodulatory protein FIP-NHA that encodes.
This complete genome sequence is as shown in SEQ ID NO.2:
GCTACTACCAACGATTCCGCCGTCTTGTTCTACATTGTCGCATCTCAGAAAAAATTGTCCTTTGACTATACT
CCTAACTGGGGAAGAGGTTCACCAAACAGTTACATTGATAATTTGACCTTTCCAAGAGTTCTTACTAACAAG
CCTTACAAATATAGAGTTGTCAAGGCTGGTCAAGATTTGGGAGTTAGAGACTCTTACTCCGTCCAATCTGAT
GGATCCCAGAAAGTCAACTTCCTTGAATATAATGCTGGTAGAGGAATTGCCGACACTCAGACAATCCAAGTC
TATGTTGTTGACCCAGATAACGGAAACCAATACCTTGTCGCCCAATGGAAGTAA
The present invention by pair of primers FIP-nha-F (EcoRI 5 '-
GAA TTCGCT ACT ACC AAC G-3 ') and FIP-nha-R (XhoI 5 '-
CTC GAGTTA CTT CCA TTG GGC GAC-3 '), cloned this fungal immunomodulatory protein FIP-NHA with the method that gene is synthetic, DNA complete sequence analysis result shows, FIP-NHA total length 342bp, and its cDNA sequence is as shown in SEQ ID NO.2.
This albumen belongs to a kind of novel fungal immunomodulatory protein.Its cDNA sequence and the aminoacid sequence derived are carried out the BLAST comparison in GenBank find, this gene is up to 67% with the sequence identity that derives from little spore glossy ganoderma (Ganodermamicrosporum) fungal immunomodulatory protein GMI, is 66% with deriving from red ganoderma (Ganoderma lucidum) LZ-8; Ganoderma tsugae (Ganoderma tsugae) homology is 66%; Ganoderma sinense Zhao, Xu et Zhang (Ganoderma japoncium) FIP-gja 64%, straw mushroom (Volvariellavolvacea) FIP-vvo63%; Needle mushroom (Flammulina velutipes) FIP-fve is 59%.Illustrate that FIP-NHA is a kind of new novel fungal immunomodulatory protein.And the genetic modification of this albumen of for this reason encoding and in various heterologous gene expression systems high efficient expression good genetic material is provided.
The present invention also provides the recombinant vectors that comprises above-mentioned novel fungal immunomodulatory protein FIP-NHA gene, is preferably pGEX-4T-1.Fungal immunomodulatory protein FIP-NHA gene of the present invention is inserted between the suitable restriction enzyme site of expression vector, makes that its nucleotide sequence is exercisable to be connected with expression regulation sequence.As the most preferred embodiment of the present invention, be preferably fungal immunomodulatory protein FIP-NHA gene is inserted between EcoRI and XhoI restriction enzyme site on pGEX-4T-1, large intestine expression plasmid pGEX-FIP-nha obtains recombinating.
The present invention also provides the recombinant bacterial strain that comprises above-mentioned fungal immunomodulatory protein FIP-NHA gene, is preferably recombinant bacterial strain ROS/GST-FIP-NHA.
The present invention also provides a kind of method for preparing fungal immunomodulatory protein FIP-NHA, comprises the following steps:
1) above-mentioned recombinant vectors transformed host cell, get recombinant bacterial strain;
2) cultivate recombinant bacterial strain, the expression of inducing recombinant fungus immune modulator FIP-NHA; And
3) reclaim the also expressed fungal immunomodulatory protein FIP-NHA of purifying.
Wherein, preferred described host cell is intestinal bacteria Rosetta cell, preferably recombinant expression plasmid is transformed Bacillus coli cells Rosetta, obtains recombinant bacterial strain ROS/GST-FIP-NHA.Use genetic engineering means to come industrialization to produce fungal immunomodulatory protein FIP-NHA product and yet there are no report.The present invention provides the immune modulator FIP-NHA of a new originated from fungus first, this albumen has to splenic lymphocyte the splitting action of urging, increase the synthetic of cytokine 2, three kinds of tumour cells are comprised that liver cancer cell HepG2, stomach cancer cell MGC823 and HL-60 cells all have obvious inhibition proliferation function, can be applied to the industry such as healthcare products and medicine.Just can realize utilizing genetic engineering means to produce fungal immunomodulatory protein FIP-NHA according to technical scheme of the present invention.
Description of drawings
Fig. 1 fungal immunomodulatory protein FIP-NHA of the present invention analyzes at the SDS-PAGE of expression in escherichia coli, and 1, the FIP-NHA 2 of purifying, GST-FIP-NHA 3, and GST-FIP-NHA 4, molecular weight standard.
The Mass Spectrometric Identification result of Fig. 2 fungal immunomodulatory protein FIP-NHA of the present invention.
Fig. 3 fungal immunomodulatory protein FIP-NHA of the present invention promotes the spleen lymphocyte proliferation experiment.
Fig. 4 fungal immunomodulatory protein FIP-NHA of the present invention promotes the cytokine 2 compound experiment.
Fig. 5 fungal immunomodulatory protein FIP-NHA of the present invention anti-tumor experiment result.
Fig. 6 fungal immunomodulatory protein FIP-NHA of the present invention anti-tumor experiment result.
Embodiment
Test materials and reagent
1, cell strain: human red cell (A, B, AB or O type blood); The rabbit erythrocyte; Human leukemia cell line HL60; Human liver cancer cell HepG2; Gastric carcinoma cells MGC823; 4-6 week is without the BalB/C mouse that grows under the sensitization environment.
2, test kit, enzyme, biochemical reagents and instrument:
Test kit: the Annexin-V-EGFP cell apoptosis detection kit is purchased; ECL luminescence reagent box is that Beijing Ward is given birth to company's product; Mouse interleukin I L-2 quantitative ELISA detection kit and Tissue Culture Plate are purchased from Beijing ancient cooking vessel state biotech firm.96 hole blood-coagulation-boards, cell counting count board.
The PCR primer is synthetic to be completed by Shanghai living work biotech firm with gene sequencing.
Enzyme: restriction endonuclease is available from TaKaRa company, and ligase enzyme is available from Invitrogen company.
Instrument: whizzer; The vibration shaking table; Microscope; Microplate reader; Flow cytometer
Biochemical reagents: penbritin, penicillin (sodium salt), Vetstrep, bromjophenol blue, concanavalin A (ConA), lipopolysaccharides (LPS), Thiazolyl blue (MTT), calf serum (BSA), phytohemagglutinin (PHA); Dimethyl sulfoxide (DMSO) (DMSO) is the Sigma product.
3, substratum
RPM11640 substratum (pH7.2): add 10%BSA, 100U/ml penicillin, 100 μ g/ml Streptomycin sulphates, the 0.22 rear 4 ℃ of preservations of μ n membrane filtration sterilization.The DMEM in high glucose nutrient solution.
Illustrate: make the experimental methods of molecular biology illustrate in following examples, all carry out with reference to listed concrete grammar in " molecular cloning experiment guide " (third edition) J. Pehanorm Brooker one book, perhaps carry out according to test kit and product description.
Screening and the clone of embodiment 1 fungal immunomodulatory protein FIP-NHA enzyme coding gene fip-nha
Screen fungal gene according to the fungal immunomodulatory protein conserved sequence of having delivered from NCBI fungal gene group database.Designed pair of primers FIP-nha-F (EcoRI 5 '-
GAA TTCGCT ACT ACC AAC G-3 ') and FIP-nha-R (XhoI 5 '-
CTC GAGTTA CTT CCA TTG GGC GAC-3 '), cloned with the method that gene is synthetic the fungal immunomodulatory protein FIP-NHA gene that derives from fungi Nectria haematococca, DNA complete sequence analysis result shows, FIP-NHA total length 342bp, its cDNA sequence is as shown in SEQ ID NO.2.
The preparation of embodiment 2 recombinant fungus immune modulator FIP-NHA.
Expression vector pGEX-4T-1 is carried out double digestion (EcoRI and XhoI), the basic double digestion (EcoRI and XhoI) of the coding fungal immunomodulatory protein FIP-NHA that will synthesize simultaneously, the gene fragment that cuts out encoding mature fungal immunomodulatory protein FIP-NHA is connected with expression vector pGEX-4T-1, acquisition contains the recombinant plasmid pGEX-FIP-nha of fungi Nectriahaematococca fungal immunomodulatory protein FIP-NHA gene and transforms intestinal bacteria Rosetta, obtains recombinant bacterial strain ROS/GST-FIP-NHA.
Get the Ros/GST-FIP-NHA bacterial strain that contains recombinant plasmid, be inoculated in 200mL and contain in 0.1mM IPTG and 50 μ g/ml ammonia benzyl LB nutrient solutions, after 25 ℃ of 250rpm inducing culture 6h, centrifugal collection thalline.Then in using ultrasonication, and centrifugal collection supernatant.Excise the GST labels with 100U/ml thrombin at 30 ℃ of effect 24h after crossing the GST purifying.Result of study shows that the expression amount of recombinant fungus immune modulator FIP-NHA is 20mg/L.The SDS-PAGE result shows, recombinant fungus immune modulator FIP-NHA has obtained expression in intestinal bacteria.Expressed fungal immunomodulatory protein FIP-NHA is through after purifying, and the content of its protein reaches electrophoresis pure (Fig. 1).Express correct (Fig. 2) through Mass Spectrometric Identification.
The hemagglutination activity of embodiment 3 recombinant fungus immune modulators is measured
(1) from Healthy People cell (A, B, AB or O type) and rabbit hemocyte 2mL, 2000rpm, centrifugal 5 minutes of room temperature.
(2) erythrocyte bottom careful sucking-off blood plasma supernatant, collection centrifuge tube, with the abundant resuspension hemocyte of the careful washing of pH 7.2 10mM PBS, 2000rpm, centrifugal 5 minutes of room temperature is washed 5 times altogether.
(3) hemocyte is suspended in 1.5% (V/V) PBS.
(4) the gelatin PBS solution of preparation 0.2%.
(5) accurate weighing recombinant Ganoderma lucidum immunoregulation protein 1mg, be dissolved in 1mL PBS, and it is 1,2,4,8 and 16 μ g/mL that the adjusting sample concentration makes its whole working concentration.
(6) hemagglutination reaction liquid is by 25 μ l hemocyte suspension, and 25 μ L recombinant protein liquid and 50 μ L gelatin (0.2%) mix, and add to 96 hole blood-coagulation-boards, vibrates gently 30 seconds on the vibration shaking table, puts into moistening pallet, is placed in 37 ℃ of incubators and cultivates.Naked eyes and microscopically are observed the hemagglutination result after 1.5 and 24 hours.
Result of study is presented under the concentration of 1.275 μ g/mL has agglutination to the rabbit hemocyte, under the concentration of 100 μ g/mL, the human blood cell is had agglutination.
The short lymphoproliferation activit of embodiment 4 recombinant fungus immune modulators is measured
Adopt mtt assay to measure the recombinant fungus immune modulator to the splitting action of urging of mouse spleen lymphocyte.Microbiotic used, recombinant protein sample, ConA, LPS and MTT use 0.22 μ m ultrafiltration membrance filter ,-20 ℃ of preservations.
(1) get 4-6 week without the BalB/C mouse that grows under the sensitization environment, disconnected neck is put to death mouse, and 75% alcohol-pickled 3 minutes, aseptic condition was got spleen in Bechtop.
(2) adopt polishing (4-6 layer sterile gauze) to separate splenic lymphocyte.
(3) with 3mL RPM11640 nutrient solution (not containing BSA and two anti-) suspension splenocyte, 2000rpm is centrifugal, 2 minutes.
(4) carefully draw supernatant, repeating step (3) 3-5 time.
(5) splenocyte is suspended in the RPM11640 nutrient solution (containing 10%BSA, 100U/mL penicillin, 100 μ g/mL Streptomycin sulphates) that 1mL prepares, weaker concn is to 1x10
6Cell/mL.
(6) every hole adds 100 μ L splenic lymphocyte suspension on 96 well culture plates, add recombinant immune to regulate albumen PBS solution ( final concentration 1,2,4,8,16 and 32 μ g/mL), add simultaneously pH7.210mM PBS, ConA (final concentration 5 μ g/mL) and LPS (final concentration 2 μ g/mL) respectively as negative contrast and positive control.In addition, in order to observe the synergy of recombinant protein, add respectively the mixed solution of recombinant protein and ConA and LPS.Each specimen is done 3 parallel holes.
(7) with the culture plate sealing, be positioned over 5%CO2, cultivated 48-72 hour in 37 ℃ of incubators, examine under a microscope the cell proliferation effect.
(8) carefully add the PBS liquid of 20 μ l MTT along cultivation plate hole inwall, the 30 seconds mixings that vibrate gently continue to cultivate 4-5 hour.
(9) carefully draw supernatant, blot cell culture fluid as far as possible, add 100 μ L dimethyl sulfoxide (DMSO) (DMSO), after vibrating gently 10 minutes, (Model 680, Bio-Rad), measure light absorption value in 570nm, record reading to put into microplate reader.Make reaction-histogram.
When result of study was presented at very low concentration (2 μ g/mL), the recombinant fungus immune modulator was urged splitting action the strongest (Fig. 3) to mouse spleen lymphocyte.
The short cytokine interleukin element IL-2 secretion activity of embodiment 5 recombinant fungus immune modulators is measured
Detect recombinant immune by the ELISA method and regulate the effect that albumen promotes Secreted by Mouse Splenic interleukin (IL-2), to measure its immunoregulatory activity.
(1) BaIB/C mouse spleen lymphocyte suspension prepares the samely, finally is diluted in the RPM11640 nutrient solution (containing 10%BSA, 100U/mL penicillin, 100 μ g/mL Streptomycin sulphates) for preparing, and weaker concn is to 1x10
7Cell/mL.
(2) add 100 μ L cell suspending liquids at 96 well culture plates, the whole working concentration of 100 μ L recombinant protein liquid is 1,2,4,8,16 and 32 μ g/mL, add simultaneously 100 μ L ConA (5 μ g/mL) and pH7.2 10mM PBS and do positive and negative contrast, each sample is done 2 parallel holes.After good seal, the light shaking mixing is put in 5%CO
2, cultivated 48 hours in 37 ℃ of incubators.
(3) sucking-off cell culture fluid, centrifugal 5 minutes of 2000rpm room temperature is collected supernatant.Following steps operate with mouse IL-2 quantitative ELISA test kit.
(4) add 100 μ L sample supernatants, get simultaneously standard substance mouse IL-2, being diluted to respectively final concentration is that 15.6,31.2,62.5,125,250,500 and 1000 μ g/mL are as positive control and production standard, do negative contrast with PBS, add 100 μ L standard substance and PBS, each sample is done 2 parallel holes.
(5) slightly shake mixing after, be put in 37 ℃ of incubators and cultivated 2 hours, careful sucking-off supernatant liquor with washings every hole 200 μ L washing 5 times, is inverted the empty dry liquids of trying one's best on filter paper, pats dry for the last time.
(6) every hole adds primary antibodie 50 μ L, is put in 37 ℃ of incubators to cultivate 1 hour.It is the same that washings is washed plate.
(7) add two anti-(HRP traget antibody) 100 μ L, be put in 37 ℃ of incubators and cultivated 1 hour, wash plate the same.
(8) every hole adds substrate working fluid 100 μ L, is put in 37 ℃ of incubators dark reaction 10 minutes.Every hole adds 50 μ L termination reaction liquid.
(9) culture plate is put into microplate reader, measure light absorption value in 492nm, record reading.Preparation standard curve and calculation sample IL-2 content.
Result of study shows at 2 μ g/mL, cytokine-2 resultant quantity maximum, and in conjunction with top proliferation experiment result as can be known, this albumen activates the specific cytokine-2 of Th1 synthetic (Fig. 4) by stimulating the Th1 cell.
Embodiment 6 flow cytometries (FACS) are measured the recombinant fungus immune modulator
Adopt the further Accurate Determining recombinant immune of FACS method to regulate the anti-tumor activity of albumen.
(1) at 5%CO
2, cultivate the NB-4 cell with the DMEM in high glucose nutrient solution in 37 ℃ of incubators, making it grow to concentration is 1x10
6Cell/mL.
(2) every hole adds the 0.8mL tumor cell suspension in 12 well culture plates, and adding the 0.2mL final concentration is the recombinant fungus immune modulator of 8,16 and 32 μ g/ml, does negative contrast with the NB-4 cell of normal growth, and each sample concentration is done 2 parallel holes.At 5%CO
2, cultivated 24 hours in 37 ℃ of incubators.
(3) 3000rpm, centrifugal 5 minutes of room temperature is collected tumour cell.The apoptosis rate of inducing tumor cell is measured with the Annexin-V-EGFP cell apoptosis detection kit.
(4) with pH7.2 10mM PBS washing NB-4 cell, 3000rpm, centrifugal 5 minutes of room temperature, totally 2 times.Guarantee that final collecting cell number is 1.5 * 10
5
(5) add binding buffer liquid 500 μ L in test kit, mixing; Add again 2 μ L Annexin-V-EGFP, mixing; Add at last 5 μ L propidium iodides (PI), fully mixing.
(6) reaction of room temperature lucifuge dark place is 10-15 minute, delivered to flow cytometer and test in 1 hour.
(7) FACS adopts 488nm excitation wavelength, 530nm emission wavelength; The green fluorescence of Annexin-V-EGFP is by FITC passage (FLl); The PI red fluorescence is by PI passage (FL3).
(8) do pure negative control with the NB-4 cell without the normal growth of PI and EGFP dyeing, the basic voltage and the yield value that are used for drawing a circle to approve cell mass and adjust 2 kinds of fluorescent optical filters, record all by fluorescently-labeled tumour cell with cross door method, calculate simultaneously the cell death inducing rate.
It is 32 μ g/mL that result of study is presented at FIP-NHA concentration, and the treatment time all has obvious inhibition proliferation function to three kinds of tumour cells (liver cancer cell HepG2, stomach cancer cell MGC823, HL-60 cells) when being 24 hours.Along with the increase of concentration, restraining effect strengthens, and wherein the lethal effect to liver cancer cell is the strongest, and the cell survival ratio only accounts for 13.31%; Cancer of the stomach is taken second place, and is 31.34%; Relatively low to leukemic effect, be 43.67% (Fig. 5).Further extend and process the leukemia HL60 cell time, detect this albumen to its killing action, result shows along with the prolongation of time and the increase of concentration, kills function of tumor and strengthens, when processing in concentration 32 μ g/mL70 hours, viable cell survival ratio is 30% (Fig. 6).
Claims (1)
1. fungal immunomodulatory protein FIP-NHA is for the preparation of the application of antitumor drug,
The aminoacid sequence of described fungal immunomodulatory protein FIP-NHA as shown in SEQ ID NO.1,
Described antitumor drug be Hepatoma therapy medicine, the treatment cancer of the stomach medicine or treat leukemic medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110098564 CN102241751B (en) | 2011-04-20 | 2011-04-20 | Novel fungal immunomodulatory protein FIP-NHA with antineoplastic activity and gene thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110098564 CN102241751B (en) | 2011-04-20 | 2011-04-20 | Novel fungal immunomodulatory protein FIP-NHA with antineoplastic activity and gene thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102241751A CN102241751A (en) | 2011-11-16 |
| CN102241751B true CN102241751B (en) | 2013-06-26 |
Family
ID=44960016
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110098564 Active CN102241751B (en) | 2011-04-20 | 2011-04-20 | Novel fungal immunomodulatory protein FIP-NHA with antineoplastic activity and gene thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102241751B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI608846B (en) * | 2014-03-13 | 2017-12-21 | 益生生技開發股份有限公司 | Combination therapy for ameliorating adverse side effects caused by chemotherapy |
| CN106046128B (en) * | 2016-07-18 | 2019-06-28 | 中国农业科学院农产品加工研究所 | Fungal immunomodulatory protein FIP-sch3 with anti-tumor activity |
| CN106188254B (en) * | 2016-07-18 | 2019-11-01 | 中国农业科学院农产品加工研究所 | A kind of immune modulator and its application |
| CN108546287A (en) * | 2018-04-16 | 2018-09-18 | 上海市农业科学院 | A kind of antitumor fungal immunomodulatory protein Fip-bbo and its application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1863912A (en) * | 2003-09-17 | 2006-11-15 | 益生生技开发股份有限公司 | A fungal immuromodulatory protein produced by microorganisme and uses there of |
| CN1939532A (en) * | 2005-09-23 | 2007-04-04 | 益生生技开发股份有限公司 | Use of fungal immunomodulatory protein |
| CN101509001A (en) * | 2009-03-19 | 2009-08-19 | 上海交通大学 | Gene sequence of encoding fungal immunomodulatory protein of straw mushroom |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100009915A1 (en) * | 2005-09-23 | 2010-01-14 | Yeastern Biotech Co., Ltd. | Compositions comprising fungal immunomodulatory protein and use thereof |
-
2011
- 2011-04-20 CN CN 201110098564 patent/CN102241751B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1863912A (en) * | 2003-09-17 | 2006-11-15 | 益生生技开发股份有限公司 | A fungal immuromodulatory protein produced by microorganisme and uses there of |
| CN1939532A (en) * | 2005-09-23 | 2007-04-04 | 益生生技开发股份有限公司 | Use of fungal immunomodulatory protein |
| CN101509001A (en) * | 2009-03-19 | 2009-08-19 | 上海交通大学 | Gene sequence of encoding fungal immunomodulatory protein of straw mushroom |
Non-Patent Citations (2)
| Title |
|---|
| Kuo.A et al.XP_003043654.《GenBank》.2010, |
| XP_003043654;Kuo.A et al;《GenBank》;20100814;1-2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102241751A (en) | 2011-11-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103980354B (en) | Fungal immunomodulatory protein FIP-ppl and gene thereof | |
| Liu et al. | Effect of selenylation modification on immune-enhancing activity of Atractylodes macrocephala polysaccharide | |
| CN105296433A (en) | CTLA4 antibody, pharmaceutical composition thereof and application of pharmaceutical composition | |
| CN102241751B (en) | Novel fungal immunomodulatory protein FIP-NHA with antineoplastic activity and gene thereof | |
| CN109207544B (en) | Preparation method of chlorella antioxidant polypeptide | |
| CN105924533A (en) | ROR1 specific chimeric antigen receptor and application thereof | |
| CN104817637B (en) | A kind of straw mushroom immune modulator FIP-vvo78 and preparation method thereof | |
| CN104892735B (en) | A kind of straw mushroom immune modulator FIP-vvo82 and preparation method thereof | |
| CN106222141A (en) | NK cell culture fluid and cell culture processes | |
| CN104817634B (en) | A kind of straw mushroom immune modulator FIP-vvo98 and preparation method thereof | |
| Uribe-Echeverry et al. | Fungal immunomodulatory proteins in the context of biomedicine | |
| CN101487020B (en) | Preparation and use of recombinant gold needle mushroom immunomodulatory protein | |
| CN106046128B (en) | Fungal immunomodulatory protein FIP-sch3 with anti-tumor activity | |
| CN110028575A (en) | A kind of preparation method of micromolecular collagen | |
| CN101906423A (en) | Preparation method of recombined human nerve growth factor based on insect baculovirus expression system | |
| CN104817635B (en) | A kind of straw mushroom immune modulator FIP-vvo80 and preparation method thereof | |
| CN102978214B (en) | Chicken-gamma-interferon gene sequence, recombinant engineering bacteria and application thereof | |
| CN104817636B (en) | A kind of straw mushroom immune modulator FIP-vvo79 and preparation method thereof | |
| CN101966335B (en) | Novel HER2/neu gene-modified dendritic cell vaccine | |
| CN106432442B (en) | A kind of Lentinus tigrinus immune modulator Fip-lti1 and its preparation method and application | |
| CN106496311B (en) | A kind of funnel macropore bacterial immunity regulatory protein Fip-par1 and its preparation method and application | |
| CN107881178A (en) | Lamprey buccal gland CystatinF, preparation method and application | |
| CN103923178B (en) | A kind of purposes of small peptide, its synthetic method and its enhancing domestic animal immunity | |
| CN110041423A (en) | A kind of renaturation and purification process of recombinant human granulocyte colony stimulating factor | |
| CN102319240A (en) | Application of deacetylmycoepoxydiene serving as Hsp90 inhibitor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200831 Address after: 100193 Beijing Old Summer Palace West Road, Haidian District, No. 2 Patentee after: Beijing Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences Address before: 100081 Beijing, Zhongguancun, South Street, No. 12, No. Patentee before: FEED Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES |
|
| TR01 | Transfer of patent right |