CN102234689A - Biological sensing chip and using device thereof - Google Patents

Abstract

The invention belongs to the field of biological chips, and particularly relates to a biological sensing chip which comprises a solid holder, a metal film and nucleic acid probes, wherein the metal film is plated on the surface of the solid holder, one or more nucleic acid probes can be provided, and the nucleic acid probes are selected from the following four probe groups: probe group 1: ACAGCAAGACCGTCTTTCACTTTTG and ATGCGTTAGCTGCAGCACTAAGGGGC; probe group 2: CCACTTTCTCCCTCAGGACGTATG and AGCTTCGCCACTAAGATCTCAAGGAT; probe group 3: GCTCCTTTGGTTGAATGATGATGCC, ATCTCATAGCGGATTGCTCCTTTGG and TAACTGCGGCACAGAAGGTTGGACC; and probe group 4: GCGAAACCTTAACTTTATGCGG, GCCCATCTCAAAGCAGATTACTC and TTAGCGGCGGCACGGAGGTGTTG. The invention also relates to a SPR (Surface Plasmon Resonance) instrument using the biological sensing chip, a kit for detecting multiple bacteria, and a method for detecting multiple bacteria.

Description

A kind of bio-sensing chip and using appts thereof

Technical field

The invention belongs to the biochip field, particularly, the present invention relates to a kind of bio-sensing chip, and the SPR instrument that uses this bio-sensing chip.The invention still further relates to a kind of test kit and a kind of method that detects multiple bacterium that detects multiple bacterium.

Background technology

Unmarked, high-throughout detection technique has remarkable advantages aspect gene test.(Surface Plasmon Resonance, SPR) technology just possesses the characteristics of unmarked, high-throughput and parallel real-time detection to surface plasma resonance, but also is not used for clinical detection and diagnosis at present.

The SPR technology is to utilize at metallic membrane/liquid level interface, and the physical optics phenomenon that is caused by the total reflection of light is come the technology of analyzing molecules interphase interaction.The SPR technology is widely used in detecting, the aspects such as interaction between analysing biomolecules.

The SPR technology has been utilized the surface plasma-wave that can excite generation on some metal (particularly gold and silver) interface.When incident light incides on the metal interface with the angle greater than critical angle, total reflection takes place, under suitable angle, when the parallel vectors of incident light and the frequency of surface plasma-wave are complementary, resonate, energy is transferred to the surface plasma-wave from incident light, and catoptrical reflectivity shows rapid decay (pairing input angle was called " resonance angle " when intensity of reflected light was minimum).Input angle when resonance takes place or wavelength height depend on the specific refractory power on nearly surface, metallic surface.The combination of lip-deep biomolecules can change specific refractory power herein, thereby causes the variation of the input angle that resonance takes place.

By the variation of monitoring resonance angle, can realize detecting in real time the interaction between the biomolecules on sensing chip surface.Traditional SPR instrument is measured the function of complete SPR curve as incident angle of light or wavelength, and this pattern is widely used, but flux is lower.And high-throughout SPR instrument can realize detecting simultaneously the interaction of thousands of biomolecules by imaging system.A typical SPR imaging device comprises a p polarized light source and a catoptrical detector that receives subsequently from the SPR bio-sensing chip.The CCD photoinstrumentation is collected intensity of reflected light with imaging mode.When the SPR imaging detected in the mode that is fixed into firing angle, intensity variation was with to be attached to the variations in refractive index that causes behind the surface by biomolecules proportional.The light darkness that causes thus is relevant with the amount of substance that is attached to detecting area.In addition, a factor that influences the sensitivity of SPR imaging system is the intensity of light source.From the strength of signal and the linear ratio of incident intensity of metallic surface,, preferentially select LASER Light Source therefore with respect to photodiode and halogen lamp.

For example based on the technology of fluorescence or ELISA, the SPR technology has following several advantage with respect to traditional technology: 1, because detection is specific refractory power, so amalyzing substances need not any mark (as radioactivity or fluorescent mark) and is directly used in detection; 2, detection can be carried out in real time, can allow the user collect dynamics data; 3, SPR is a current techique, can detect the amalyzing substances with different molecular weight and avidity of wide region.Therefore, the SPR technology is a kind of strong instrument of studying bio-molecular interaction.So far, in the field of study in, the SPR technology has been used to study that protein-peptide interacts, protein-dna interacts, DNA hybridization etc.But the SPR method also is not useful on the report of clinical detection and diagnosis at present.Inventor's first Application SPR technology is carried out clinical detection and Studies on Diagnosis.

The SPR instrument is a kind of optical pickocff, can be by detecting the combination that change of refractive detects the biomolecules of metallic surface.The SPR instrument is made of automatic sampling machine tool hand, high-resolution CCD photoinstrumentation and the sensing chip gold-plated or silver-plated slide of one or more streams pond (above be furnished with).In 200nm, this makes the SPR instrument become the interactional instrument of amalyzing substances in a kind of more satisfactory research fixed biomolecules and the solution to the SPR instrument to the investigation depth of metal-water termination.

Traditional method for cultivation of bacteria needs obtain at least 24 hours detected result, and experimental implementation is loaded down with trivial details, it is long to take, work is heavy, must detect in specialized laboratory, can't satisfy the field quick detection requirement.Anerobe (tetanus bacillus, Clostridium perfringens) is difficult to cultivate simultaneously, and detection is brought very big difficulty.

RRNA have the title of " molecular fossil " for survive necessary gene order and also be one of conservative sequence of all organisms.16S rRNA (16S rDNA) is more conservative than other gene during evolution, so the 16S rDNA of various bacteriums has very high homology.The conservative property of 16S rDNA makes to be used unified detection that single method carries out bacterium and becomes possibility, gene diagnosis highly sensitive, quick and precisely.Especially in the detection of severe bacteria and poky bacterial classification, has obvious advantages.The inventor has improved the detection technique of SPR bio-sensing chip, makes the multiple infectation of bacteria of clinical application SPR technology for detection become possibility.The present invention uses the multiple infectation of bacteria of SPR technology rapid detection.

The inventor utilizes the multiple infectation of bacteria of SPR technology for detection, designs the universal primer of specific probe and directed toward bacteria 16S rDNA, can special bacterial nucleic acid be detected.It is streptococcus aureus, Pseudomonas aeruginosa, dysentery bacterium, tetanus bacillus, clostridium perfringens that the inventor detects bacterial classification at present.

The advantage of SPR instrument of the present invention is: fast, multiple bacterium detects simultaneously in real time, can obtain detected result in several hours; Testing process is convenient and swift, and is highly sensitive; High-throughput, high-quality analytical data.This SPR instrument can be used as portable instrument and finishes field quick detection.

Summary of the invention

The technical problem that solves

Realize the rapid detection of bacterium, and multiple bacterium detects in real time simultaneously.

The technical scheme that is adopted

One aspect of the present invention relates to a kind of bio-sensing chip, comprise solid support, metallic membrane, nucleic acid probe, described metallic membrane is plated in the surface of solid support, it is characterized in that described nucleic acid probe is selected from one or more among the SEQ ID NO:1-SEQ ID NO:10 among the following probe groups 1-4:

Probe groups 1:

ACAGCAAGACCGTCTTTCACTTTTG (SEQ ID NO:1) and

ATGCGTTAGCTGCAGCACTAAGGGGC(SEQ?ID?NO：2)；

Probe groups 2:

CCACTTTCTCCCTCAGGACGTATG (SEQ ID NO:3) and

AGCTTCGCCACTAAGATCTCAAGGAT(SEQ?ID?NO：4)；

Probe groups 3:

GCTCCTTTGGTTGAATGATGATGCC(SEQ?ID?NO：5)、

ATCTCATAGCGGATTGCTCCTTTGG (SEQ ID NO:6) and

TAACTGCGGCACAGAAGGTTGGACC(SEQ?ID?NO：7)；

Probe groups 4:

GCGAAACCTTAACTTTATGCGG(SEQ?ID?NO：8)、

GCCCATCTCAAAGCAGATTACTC (SEQ ID NO:9) and

TTAGCGGCGGCACGGAGGTGTTG(SEQ?ID?NO：10)。

Wherein, described solid support includes but not limited to, for example: sheet glass, silicon chip, plastics, nylon membrane, polypropylene screen, nitrocellulose filter or the like, in one embodiment of the invention, described select for use make sheet glass.

Described metallic membrane can be the film of metals such as gold and silver, copper, aluminium.

In one embodiment of the invention, choose a nucleic acid probe in each probe groups at least.

In one embodiment of the invention, described nucleic acid probe is SEQ ID NO:1-SEQ IDNO:10.

In one embodiment of the invention, be coated with mercaptan-glucan-modified layer on the described metallic film surface.

In one embodiment of the invention, described nucleic acid probe is connected to the decorative layer surface by vitamin H-Streptavidin.

The preparation of the decorative layer of bio-sensing chip of the present invention can be adopted the method in the prior art (for example open CN101464456A of Chinese patent), for example adopts in the following method:

Self assembled monolayer (self-assembled monolayer, SAM) sulfydryl undecyl mercaptan (for example 11-sulfydryl undecyl alcohol) can be by the sulfydryl and the golden film reaction of an end in, thereby be fixed on the golden film, can combine with biomolecules by its suitable reactive group after the modified and activation of the other end.

Particularly, can adopt following method

1) with the sheet glass be the sensing chip innermost layer, glass sheet surface plates metallic membrane (can be copper film, silverskin, aluminium film or golden film) and forms naked gold plaque;

2) clean naked gold plaque with strong oxidizer or plasma etching method, use the ethanol clean surface of ultrapure water and degasification then, then the naked gold plaque with cleaning immerses in the ethanolic soln of sulfydryl hydrocarbon compound, forms single self assembled monolayer of planting composition or mixing element of sulfydryl hydro carbons on the gold surface of cleaning;

3) under appropriate condition, make the functional end-group that SAM surface exposes (OH ,-COOH) by glucan-modified.

Wherein, mixed monomolecular layer synthetic has 3 methods:

(1) mixes alkyl mercaptan (HS (CH ₂) _nR+HS (CH ₂) _nR ') co-adsorption from solution;

(2) asymmetric couple of alkyl disulphide (R (CH2) _mS-S (CH2) _nR ') absorption;

(3) asymmetric couple of alkyl sulfide (R (CH2) _mS (CH2) _nR ') absorption.

In top (1)-(3), n and m represent the number (n and m can be identical or different, are the integer of 8-16) of methylene unit.R represents the end group of hydrocarbon chain, includes but not limited to :-CH ₃,-OH ,-COOH, NH ₂Or the like.

Then with epoxy chloropropane as linking agent, handle with dextran (molecular weight ranges of used dextran need not limit, and is preferred 300,000-500,000), carry out the bromoacetic acid reaction then.Nucleic acid probe is fixed to the surface of decorative layer as fixing agent by vitamin H-Streptavidin system or sulfydryl.

Particularly, use the reaction of epoxy chloropropane and undecyl alcohol, generate epoxy compounds, with dextran and the sensing surface reaction of having fixed epoxy chloropropane, form glucan-modified surface then.For example, use～1molL ^-1Epoxy chloropropane and SAM reaction generate epoxy compounds, form glucan-modified surface with dextran solution and the sensing surface reaction of having fixed epoxy chloropropane then.

In one embodiment of the invention, for can be better and the part reaction, can be by making the chip modified previously and bromoacetic acid solution reaction with the surperficial carboxymethylation of dextran.The aqueous solution of NHS (N-hydroxy-succinamide) and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) is passed through glucan-modified sensing chip, the functional end-group on SAM surface is come out again, thereby chip surface is activated.For example, the chip of modifying is previously immersed 1molL ^-1Reaction makes dextran surface carboxymethylation in the bromoacetic acid solution.

In one embodiment of the invention, the mixed aqueous solution of NHS and EDC be expelled to carry out surface active on the glucan-modified sensing chip after, injection contains the sodium-acetate buffer of 1-200 μ g/ml Streptavidin (SA), react linking ligand SA with this, at last with the remaining avtive spot of weakly alkaline ethanolamine solutions sealing.

A SA molecule can be in conjunction with a plurality of biotin molecules, and the solution that like this 5 ' end is marked with nucleic acid (comprising DNA, RNA and the PNA) probe molecule of vitamin H passes through chip surface, and probe has arrived on the chip with regard to coated.(SH) probe of Xiu Shiing can directly form unimolecular layer to sulfydryl on golden film, finishes the bag quilt of probe.

In the present invention, different nucleic acid probes detects different bacteriums, shown in specific as follows the table 1.

Table 1: bacterial detection and corresponding specific dna probe (SEQ ID NO:1-SEQID NO:10).

Bacteria name	The sequence of specific dna probe
		Streptococcus aureus	ACAGCAAGACCGTCTTTCACTTTTG (SEQ ID NO:1) and ATGCGTTAGCTGCAGCACTAAGGGGC (SEQ ID NO:2)
Pseudomonas aeruginosa	CCACTTTCTCCCTCAGGACGTATG (SEQ ID NO:3) and AGCTTCGCCACTAAGATCTCAAGGAT (SEQ ID NO:4);
		Clostridium perfringens	GCTCCTTTGGTTGAATGATGATGCC (SEQ ID NO:5), ATCTCATAGCGGATTGCTCCTTTGG (SEQ ID NO:6) and TAACTGCGGCACAGAAGGTTGGACC (SEQ ID NO:7)
Clostridium tetani	GCGAAACCTTAACTTTATGCGG (SEQ ID NO:8), GCCCATCTCAAAGCAGATTACTC (SEQ ID NO:9) and TTAGCGGCGGCACGGAGGTGTTG (SEQ ID NO:10)

Another aspect of the present invention relates to a kind of SPR instrument, and it uses above-mentioned bio-sensing chip.

Also aspect of the present invention relates to a kind of test kit that detects multiple bacterium, and it comprises above-mentioned bio-sensing chip.

In one embodiment of the invention, described test kit also comprises 1%-10%SSPE solution and 0.5%-10% T 500 solution.

The prescription of described SSPE solution is as follows:

0.15M sodium-chlor, 0.010M sodium phosphate buffer, pH value 7.4,0.001M EDTA.

Also aspect of the present invention relates to a kind of method that detects multiple bacterium, comprises the steps:

1) from testing sample, extracts genomic dna;

2) genomic dna that extracts is carried out pcr amplification, obtain bacterial nucleic acid solution;

3) make step 2) in bacterial nucleic acid solution, the surface of the bio-sensing chip of the SPR instrument of flowing through above-mentioned is carried out qualitative detection and is judged bacterial species bacterial nucleic acid by the change that detects spr signal.

In one embodiment of the invention, described step 2) the described pcr amplification in comprises A and two steps of B:

A) use following primer amplification, obtain double-stranded PCR product:

CGGCGTGCCTAATACATG (SEQ ID NO:11) and

GTAGGAGTCTGGACCGTGTC(SEQ?ID?NO：12)；

B) use following primer to increase then, obtain strand PCR product;

AACGCTGGCGGCGTGCCTAATACATG(SEQ?ID?NO：13)

Wherein, the ratio of the amount of the primer SEQ ID NO:12 is 1: 1 to 20: 1 amount and the steps A of the primer SEQ ID NO:13 step B)).

Testing sample includes but not limited to nucleic acid samples, and protein sample also comprises the hybridization buffer composition.

Nucleic acid samples comprises the nucleic acid of direct extraction and the nucleic acid product of process PCR reaction or alternate manner amplification.

The pcr amplification nucleic acid product can be double-stranded PCR product, also can be strand PCR product, the perhaps mixture of the two.

Described hybridization buffer is the hybridization buffer of having optimized, and wherein contains but is not limited to 1%-10%SSPE solution and 0.5%-10% T 500 solution.

Described testing sample when being used for surface plasmon resonance biosensor hybridization detection, adopts static or mobile hybridization, and sample flow rate is 5-50 μ l/min when flowing hybridization.

Described hybridization, temperature of reaction carry out between 35 ℃-60 ℃ greater than room temperature.

The multiple infectation of bacteria of rapid detection mainly may further comprise the steps:

1) comprises that from clinical sample phlegm, wound exudate and various body fluid extract testing gene group DNA, utilize bacterium universal primer amplification 16S rRNA (16S rDNA) fragment.With hybridization solution the PCR product is mixed with sample solution feeding surface plasmon resonance biosensor and hybridizes detection.

2) write down a SPR baseline value before the sample introduction product, write down a SPR response value again after hybridization finishes.Difference before and after the reaction is the signal value of certain bacterial nucleic acid.All results are the value behind the deduction negative control detection signal.

Described baseline value obtain can reference instrument specification sheets, for example adopt following method: after whole SPR instrument system is stable, be that temperature reaches the temperature that test is set, chip is through after a while flushing, the chip surface cleaning, reach balance, scan under specific flow velocity, the curve that scans this time approaches straight line, have only small fluctuation (in the 5 milli degree), the curve of this moment is baseline.Obtaining of baseline value is by software or manually choose and can obtain.

Analyte flows through bag by the surface plasmon resonance biosensor chip surface of special oligonucleotide probe after hybridization solution is handled.Hybridization is carried out on the SPR instrument, and the liquid of analyte comprises analyte and hybridization solution.Analyte comprises the DNA extraction thing, or the PCR product, or protein extract, their hybridization solutions are mixed according to different ratios, and heat denatured or unchangeability, the sensing chip reaction of sample introduction and probe bag quilt, hybridization temperature is answered more than 30 ℃.Hybridize available static hybridization and the hybridization dual mode that flows carries out, static hybridization is about to sample solution lead on the chip after, sample solution is static not to flow.Mobile hybridization is that sample solution flows through chip surface with the flow velocity that is not higher than 50 μ l/min and finishes hybridization.The washings washing chip surface of hybridization back injectable certain volume is removed non-specific combination, also can not wash.The hybridization signal is a unit with resonance angle milli degree (m °), with the value behind the deduction negative control detection signal as a result of.

The inventor has also optimized the composition of nucleic acid hybridization liquid, contains 1%-10%S SPE solution and 0.5%-10% T 500 solution in the hybridization solution, greatly improves hybridization signal, has improved hybridization speed.Generally speaking, write down a spr signal value before the hybridization, write down a spr signal value after the hybridization again.

Nucleic acid samples to be analyzed comprises the nucleic acid of direct nucleic acid that extracts and process pcr amplification from clinical sample such as phlegm, purulent secretion, blood and various body fluid.The nucleic acid of pcr amplification can be double-stranded DNA, also can be single stranded DNA.The pcr amplification of single stranded DNA uses the primer that has improved, and, the irrelevant sequence of certain-length is connected to 5 ' end of a primer that is, improves annealing temperature.The method of asymmetric PCR is used in the amplification of single stranded DNA, i.e. the certain cycle number of amplification under lower annealing temperature earlier amplifies the strand of some amount, the certain cycle number of amplification under higher annealing temperature again, and a large amount of strands increases.

Employed nucleic acid probe comprises dna probe on the chip, rna probe, PNA probe.Dna probe length is generally 20-60nt.Dna probe 5 ' end can connect with the incoherent nucleotide sequence in zone to be detected to improve hybridization signal, incoherent nucleotide sequence comprises complicated sequence, as the sequence that generates at random, can be simple repeated sequence also, as polyA, polyT, polyC, polyG can not connect yet.For the dna probe bag is arrived sensor chip surface, an end of probe (comprising 5 ' end and 3 ' end) need carry out mark, and marker includes but not limited to sulfydryl, vitamin H, amino etc.Can wrap by multiple probe on each chip, can be used in and detect a kind of or several karyomit(e)s.

Beneficial effect of the present invention

The present invention has realized using the detection of SPR technology to infectation of bacteria.The specific probe of tested bacterium is coated on the spr sensor chip, amplified production flows through bag by a kind of surface plasmon resonance biosensor chip surface of special oligonucleotide probe after hybridization solution is handled, intermolecular generation specificity in conjunction with the time can cause the change of vane surface refractive index, cause the change of spr signal, by detecting the spr signal change and bacterial infection being carried out qualitative detection.The present invention can fast and effeciently detect multiple bacterium, for example streptococcus aureus, Pseudomonas aeruginosa, aerogenesis folder film clostridium, clostridium tetani.

Description of drawings

Fig. 1: clostridium perfringens detects sensing figure.

Fig. 2: streptococcus aureus detects figure.

Fig. 3: Pseudomonas aeruginosa detects figure.

Fig. 4: clostridium tetani detects figure.

Embodiment

Below in conjunction with embodiment embodiment of the present invention are described in detail, but it will be understood to those of skill in the art that the following example only is used to illustrate the present invention, and should not be considered as limiting scope of the present invention.Unreceipted actual conditions person among the embodiment carries out according to the condition of normal condition or manufacturers's suggestion.The unreceipted person of production firm of agents useful for same or instrument, being can be by the conventional products of commercial acquisition.

Embodiment 1: the preparation of bio-sensing chip

1. sensing chip is glucan-modified

A) cleaning of naked gold plaque

At first use strong oxidizer (H ₂SO ₄: H ₂O ₂) or the plasma etching method clean naked gold plaque, use the ethanol clean surface of ultrapure water and degasification then, dry up with the purity nitrogen air-flow afterwards.

B) preparation of self assembled monolayer (SAM)

Form single SAM that plants composition or mixing element of sulfydryl hydro carbons (for example mercaptan, thioether or disulfide and their derivative) on the gold surface of cleaning, this mode has been widely used in the modification of chemistry or bio-sensing chip.

The process for preparing SAM in gold surface is: the naked gold plaque immersion of cleaning is contained in the ethanolic soln of 1-10mM sulfydryl hydrocarbon compound, hatch 12-18h under the room temperature.

Mixed monomolecular layer synthetic has 3 short-cut methods:

(1) mixes alkyl mercaptan (HS (CH ₂) _nR+HS (CH ₂) _nR ') co-adsorption from solution;

(2) asymmetric couple of alkyl disulphide (R (CH2) _mS-S (CH2) _nR ') absorption;

(3) asymmetric couple of alkyl sulfide (R (CH2) _mS (CH2) _nR ') absorption, n and m represent the number of methylene unit here, and R represents the end (CH of hydrocarbon chain ₃,-OH ,-COOH, NH ₂Deng).

C) SAM's is glucan-modified

Modifying method after self assembled monolayer forms is extremely important, whether can effectively introduce complicated aglucon and the macromole with biological significance because this is related to the surface.Under proper reaction conditions, the functional end-group that the SAM surface exposes (OH ,-COOH), first coupled reaction intermediate dextran, and then be connected on the ligand molecular.

Among the present invention, connect dextran with the epoxy activation method.Specifically, use～1molL ^-1Epoxy chloropropane and undecyl alcohol reaction 4h generate epoxy compounds, down react 20h with the sensing surface of having fixed epoxy chloropropane at 25 ℃ with the dextran of 300mg/ml then, form glucan-modified surface.For can be better and the part reaction, the dextran surface needs carboxymethylation: the chip of modifying is previously immersed 1molL ^-1Reaction 16h gets final product in the bromoacetic acid solution.

2. Streptavidin (SA) wraps quilt

Carrying out the fixing of SA on the glucan-modified sensing chip: after the aqueous solution that 70 μ l is contained 50mMNHS and 200mM EDC is expelled to and carries out surface active on the glucan-modified sensing chip, injection contains the acetate buffer solution (10mM of 200 μ g/ml SA again, pH4.5), react with this and to connect part SA, at last with the remaining avtive spot of 70 μ l 1M ethanolamine solutions (pH 8.6) sealing.

3. biotin labeled probe connects

Carry out the flow velocity 5 μ l/min of sample introduction on the reaction SPR instrument.Inject 300 μ l and be dissolved in damping fluid (0.01M HEPES, 0.15M NaCl, 10mM MgCl ₂, pH7.4) biotinylated probe in (50nM) reacts with the Streptavidin of sensing chip pan coating, and biotin labeled like this probe just has been connected on the chip, can carry out next step hybridization and detect on the SPR instrument.

(2) preparation of marking sulfhydryl probe sensing chip

At 30%H ₂O ₂, 30%NH ₃With milliQ water with in 1: 1: 5 blended solution, naked gold plaque washing 10min, thoroughly clean then with the milliQ washing.Washed naked gold plaque is immersed in the stationary liquid (KH that 1ml contains 1 μ M sulfydryl probe ₂PO ₄1M, pH3.8) in, hatch 2h under the room temperature.After the cleaning of milliQ water, the sulfydryl encapsulant sulfydryl hexanol (MCH) that adds 1ml (1mM) is again hatched 1h under the room temperature dark.Washing is dried or nitrogen dries up.Be positioned on the plastic stent, import in the SPR instrument, prepare to be used for hybridization.

Embodiment 2: the pattern detection process

1. response sample preparation

1.1 sample DNA extracts

From clinical sample such as phlegm, purulent secretion, blood and various body fluid, extract bacterial genomes DNA, get a certain amount of dna profiling and be used for next step quantitative amplification reaction.

1.2PCR amplification

In order to obtain enough detection signals, need bacterial nucleic acid sequence to be measured be increased.To obtain single stranded product, the PCR reaction system comprises 10mM Tris-HCL (pH8.3), 50mM KCL, 1.0-5.0mM MgCl to the present invention's usefulness asymmetric PCR method to sample amplification ₂, 100-500 μ M dNTP, 0.5-4u/ μ l DNA polymerase, 0.01-5.0 μ M primers, dna profiling 1 μ l and other neccessary composition.Concrete steps are as follows:

At first use general primer SEQ ID NO:11 and SEQ ID NO:12, preliminary amplification gene group produces a certain amount of two strands.5 ' the terminal irrelevant sequence modification (for example SEQ ID NO:13) of next step one of them primer SEQ ID NO:11 with one section 10-30nt, to improve 10-20 ℃ of its annealing temperature, feasible amplification enters the annealing temperature circulation time of high-gradient, have only this primer in work, thereby obtain strand PCR product.The primer of irrelevant sequence modification and the ratio of another primer at 20: 1 to-1: between 1.The sequence of the primer is shown in following table 2.

The used primer sequence of table 2:PCR amplification.

The general primer numbering	Primer sequence	TM(50MM?NA+)
			SEQ?ID?NO：11	CGG?CGT?GCC?TAA?TAC?ATG	57.3
SEQ?ID?NO：12	GTA?GGA?GTC?TGG?ACC?GTG?TC	61.9
			SEQ?ID?NO：13	AAC?GCT?GGC?GGC?GTG?CCT?AAT ACA?TG	66.72

Particularly, each reaction system adds the sample of 100ng-1000ng genomic dna as reaction template, and the reaction heat cycling program is as follows:

94℃，5min。Carry out 18-24 circulation earlier, each round-robin condition is: 94 ℃ of 30sec, 49 ℃ of 40sec, 72 ℃ of for 40sec.Carry out 45 circulations again, each round-robin condition is: 94 ℃ of 30sec, 68 ℃ of 40sec, 72 ℃ of 40sec.Last 72 ℃ of 10min.

Reaction product is used for hybridization at once or-20 degree are frozen.

2. on the SPR instrument, hybridize detection

Hybridization is carried out on the SPR instrument, flow velocity 10 μ l/min, 37 ℃ of temperature.With above PCR product and hybridization solution (0.1 * TE (pH8.0) 0.5%SDS) mixes according to different ratios for 3 * SSPE, 5 * Denhardt ' s, 95 ℃ of heat denatured 3-5min, getting wherein, the sensing chip of 180 μ l left and right sides sample introductions and dressing probe reacts.Inject the washings (do not contain the salts solution or the water of sample, this step is alternative) of certain volume then, the washing after hybridizing.The hybridization signal is a unit with resonance angle milli degree (m °), with the value behind the deduction negative control detection signal as a result of.

3. interpretation as a result

Under preparation of standardized sample and testing process condition, generally speaking, when sample and certain detection probe signal value above baseline value and when having significant difference, it is positive to be judged to this sample.

Particularly, as follows:

1) when negative probe stream pond signal value greater than 0, the ratio that the signal value in specific probe stream pond and negative probe flow the pond signal value was more than or equal to 2 o'clock, both the decidable sample was positive.

2) when negative probe stream pond signal value less than 0, specific probe stream pond signal is more than or equal to 50 milli degree, the decidable sample is positive.

Above embodiment 1-2 an embodiment of the testing process of the preparation of bio-sensing chip of the present invention and sample has been described.Below by embodiment 3-6 concrete bacterium is detected, to verify effect of the present invention.

Embodiment 3: aerogenesis folder film clostridial detects

Use the chip of embodiment 1 preparation, other steps are with embodiment 2, and sample is patient's wound swab.As shown in Figure 1, contrast stream pond (stream pond 7) signal difference is 46.9, and stream pond 6 signal differences are 113, and signal to noise ratio is greater than 2, so this sample perfringens is positive.

Embodiment 4: the detection of streptococcus aureus

Use the chip of embodiment 1 preparation, other steps are with embodiment 2, and sample is patient's wound swab.Detected result as shown in Figure 2, negative control stream pond (stream pond 7) signal difference is 1.8, stream pond 3 signal differences are 83, signal to noise ratio then contains streptococcus aureus in this sample greater than 2.

Embodiment 5: the detection of Pseudomonas aeruginosa

Use the chip of embodiment 1 preparation, other steps are with embodiment 2, and sample is patient's wound swab.Detected result as shown in Figure 3, negative control stream pond (stream pond 7) signal difference be-27.2, stream pond 4 signal differences are 149.2, contrast stream pond signal is a negative value, still flows pond 4 signals greater than 50, then Pseudomonas aeruginosa is positive in this sample.

Embodiment 6: the detection of clostridium tetani

Use the chip of embodiment 1 preparation, other steps are with embodiment 2, and sample is patient's wound swab.Detected result as shown in Figure 4, negative control stream pond (stream pond 7) signal difference is 19.4, stream pond 5 signal differences are 98.1, signal to noise ratio then contains clostridium tetani in this sample greater than 2.

Although the specific embodiment of the present invention has obtained detailed description, it will be understood to those of skill in the art that.According to disclosed all instructions, can carry out various modifications and replacement to those details, these change all within protection scope of the present invention.Four corner of the present invention is provided by claims and any equivalent thereof.

Sequence table

＜110〉Beijing JinPuJia Medical Treatment Science Co., Ltd

 

＜120〉a kind of bio-sensing chip and using appts thereof

<130>IDC100014

<160>13

<170>PatentIn?version?3.2

 

<210>1

<211>25

<212>DNA

＜213〉artificial sequence

<400>1

acagcaagac?cgtctttcac?ttttg 25

 

<210>2

<211>26

<212>DNA

＜213〉artificial sequence

<400>2

atgcgttagc?tgcagcacta?aggggc 26

 

<210>3

<211>24

<212>DNA

＜213〉artificial sequence

<400>3

ccactttctc?cctcaggacg?tatg 24

 

<210>4

<211>26

<212>DNA

＜213〉artificial sequence

<400>4

agcttcgcca?ctaagatctc?aaggat 26

 

<210>5

<211>25

<212>DNA

＜213〉artificial sequence

<400>5

gctcctttgg?ttgaatgatg?atgcc 25

 

<210>6

<211>25

<212>DNA

＜213〉artificial sequence

<400>6

atctcatagc?ggattgctcc?tttgg 25

 

<210>7

<211>25

<212>DNA

＜213〉artificial sequence

<400>7

taactgcggc?acagaaggtt?ggacc 25

 

<210>8

<211>22

<212>DNA

＜213〉artificial sequence

<400>8

gcgaaacctt?aactttatgc?gg 22

 

<210>9

<211>23

<212>DNA

＜213〉artificial sequence

<400>9

gcccatctca?aagcagatta?ctc 23

 

<210>10

<211>23

<212>DNA

＜213〉artificial sequence

<400>10

ttagcggcgg?cacggaggtg?ttg 23

 

<210>11

<211>18

<212>DNA

＜213〉artificial sequence

<400>11

cggcgtgcct?aatacatg 18

 

<210>12

<211>20

<212>DNA

＜213〉artificial sequence

<400>12

gtaggagtct?ggaccgtgtc 20

 

<210>13

<211>26

<212>DNA

＜213〉artificial sequence

<400>13

aacgctggcg?gcgtgcctaa?tacatg 26

Claims (10)

1. bio-sensing chip, comprise solid support, metallic membrane, nucleic acid probe, described metallic membrane is plated in the surface of solid support, it is characterized in that, described nucleic acid probe is selected from one or more among the SEQ ID NO:1-SEQ ID NO:10 among the following probe groups 1-4:

Probe groups 1:

ACAGCAAGACCGTCTTTCACTTTTG (SEQ ID NO:1) and

ATGCGTTAGCTGCAGCACTAAGGGGC(SEQ?ID?NO：2)；

Probe groups 2:

CCACTTTCTCCCTCAGGACGTATG (SEQ ID NO:3) and

AGCTTCGCCACTAAGATCTCAAGGAT(SEQ?ID?NO：4)；

Probe groups 3:

GCTCCTTTGGTTGAATGATGATGCC(SEQ?ID?NO：5)、

ATCTCATAGCGGATTGCTCCTTTGG (SEQ ID NO:6) and

TAACTGCGGCACAGAAGGTTGGACC(SEQ?ID?NO：7)；

Probe groups 4:

GCGAAACCTTAACTTTATGCGG(SEQ?ID?NO：8)、

GCCCATCTCAAAGCAGATTACTC (SEQ ID NO:9) and

TTAGCGGCGGCACGGAGGTGTTG(SEQ?ID?NO：10)。

2. bio-sensing chip according to claim 1 is characterized in that, chooses a nucleic acid probe in each probe groups at least.

3. bio-sensing chip according to claim 1 is characterized in that, described nucleic acid probe is SEQ ID NO:1-SEQ ID NO:10.

4. bio-sensing chip according to claim 1 is characterized in that, is coated with mercaptan-glucan-modified layer on the described metallic film surface.

5. bio-sensing chip according to claim 4 is characterized in that described nucleic acid probe is connected to the decorative layer surface by vitamin H-Streptavidin.

6. SPR instrument, it uses each described bio-sensing chip among claim 1-5.

7. test kit that detects multiple bacterium, it comprises each described bio-sensing chip of claim 1-5.

8. test kit according to claim 7, it also comprises 1%-10%SSPE solution and 0.5%-10% T 500 solution.

9. a method that detects multiple bacterium comprises the steps:

1) from testing sample, extracts genomic dna;

2) genomic dna that extracts is carried out pcr amplification, obtain bacterial nucleic acid solution;

3) make step 2) in bacterial nucleic acid solution, the surface of the bio-sensing chip of the described SPR instrument of the claim 6 of flowing through is carried out qualitative detection and is judged bacterial species bacterial nucleic acid by the change that detects spr signal.

10. the described pcr amplification method according to claim 9, wherein, described step 2) comprises A and two steps of B:

A) use following primer amplification, obtain double-stranded PCR product:

CGGCGTGCCTAATACATG (SEQ ID NO:11) and

GTAGGAGTCTGGACCGTGTC(SEQ?ID?NO：12)；

B) use following primer to increase then, obtain strand PCR product;

AACGCTGGCGGCGTGCCTAATACATG(SEQ?ID?NO：13)

Wherein, the ratio of the amount of the primer GTAGGAGTCTGGACCGTGTC (SEQ IDNO:12) is 1: 1 to 20: 1 amount and the steps A of the primer AACGCTGGCGGCGTGCCTAATACATG (SEQ IDNO:13) step B)).

Images