CN102234656A - Method and system for performing site-specific recombination in mammalian cells - Google Patents

Method and system for performing site-specific recombination in mammalian cells Download PDF

Info

Publication number
CN102234656A
CN102234656A CN 201010159522 CN201010159522A CN102234656A CN 102234656 A CN102234656 A CN 102234656A CN 201010159522 CN201010159522 CN 201010159522 CN 201010159522 A CN201010159522 A CN 201010159522A CN 102234656 A CN102234656 A CN 102234656A
Authority
CN
China
Prior art keywords
cell
gene
sequence
dna
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 201010159522
Other languages
Chinese (zh)
Inventor
杨淑伟
刘恺
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Institutes for Biological Sciences SIBS of CAS
Original Assignee
Shanghai Institutes for Biological Sciences SIBS of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Institutes for Biological Sciences SIBS of CAS filed Critical Shanghai Institutes for Biological Sciences SIBS of CAS
Priority to CN 201010159522 priority Critical patent/CN102234656A/en
Publication of CN102234656A publication Critical patent/CN102234656A/en
Pending legal-status Critical Current

Links

Images

Abstract

The invention provides a method and system for performing site-specific recombination in mammalian cells. Particularly, the invention provides an integrase gene which can be expressed in mammals and mediates site-specific recombination, an integrase expressed by the integrase gene or conservative variation polypeptides or active fragments or active derivatives of the integrase, and a method for performing site-specific recombination in mammalian cells by adopting the integrase gene or the integrase. The site-specific recombination mediated by the integrase or the integrase gene provided by the invention in mammalian cells has the advantages of simplicity, convenience, stability and the like, thereby providing efficient research and development tools for the field.

Description

In mammalian cell, carry out the method and system of locus specificity reorganization
Technical field
The present invention relates to biotechnology and field of genetic engineering.More specifically, the present invention relates to the new intergrase (Intergrase) that in mammalian cell, to express and the mammalian cell locus specificity recombination method that adopts this intergrase.
Background technology
Locus specificity reorganization (site-specific recombination), be to occur in two reorganization on the DNA chain specific site, it (is the specificity site that the generation of this reorganization needs one section homologous sequence, claim attachment point attachment site again, att) participate in catalysis with site-specific protein factor (being recombinase).The reorganization of recombinase between can only catalysis specificity site, can not other any two homologies of catalysis or non-homogeneous sequence between reorganization, thereby reorganization has specificity and high conservative.In view of the above, the locus specificity reorganization claims conservative reorganization (conservation recombination) again, and this regrouping process does not need RecA albumen to participate in.
In mouse and mouse ES cells genetic manipulation, use at present more have Cre/loxP, FLP/FRT and PB transposon system. wherein Cre, FLP and PBase are the specificity recombinase, belong to recombinase intergrase family, their catalytic reaction types, target site and recombination mechanism are quite similar, loxP, FRT and RS are the specificity site, and similar structure is also arranged [1]In addition, based on studying to such an extent that the λ that is perfectly clear has a liking for the thalline site-specific recombination system (Gateway of attB * attP → attL * attR) TMTechnology also is widely used in the art.
The Cre/loxP recombination system
Cre/loxp recombination system strategy is the new way of carrying out the genome rite-directed mutagenesis [2]This system after being introduced into the eighties, by success be applied to that yeast, plant, mammalian cell are cultivated and mouse on one's body.The Cre/loxp recombination system comprises two parts of Cre recombinase and loxp site, the Cre recombinase is by the Cre genes encoding of coliphage P1, the monomeric protein of forming by 343 amino acid, it not only has catalytic activity, and it is similar with restriction enzyme, discern special dna sequence dna, as: the Loxp site causes reorganization.The Loxp site is the specificity recombination site of Cre recombinase effect, is made up of 34bp, comprises the foldback sequence of two 13bp and the interval region of 8bp.The Cre recombinase has 70% recombination efficiency, not by any cofactor, acts on the DNA substrate of multiple structure, as linear, ring-type, even superhelix (being become linear structure by the uncoiling of Cre recombinase) [2,3]
The DNA of any sequence, when its between two loxP sites the time, under the effect of Cre recombinase or by disappearance (direction in two loxP sites is identical), or direction reverses (direction in two loxP sites is opposite), as shown in Figure 1.The Cre/loxP recombination system can be in cells of mamma animals and transgenic mouse produces the specificitys reorganization because of loxP site design different [4]Its use mainly comprise gene inactivation or knock out, gene activation, gene transversion, group translocation, can also utilize this system to carry out the structure of carrier.
Traditional relatively transgenation technology, the specificity that the Cre/Loxp system is expressed by the Cre recombinase, conditionality knocks out gene, greatly reduces mortality of mice [5]2006, Berton etc. [6]Utilize aforesaid method rat brain derived neurotrophic factor (brain.derivedneurotrophic factor, BDNF) local expression reduces, produce the similar antidepressant effect of taking thymoleptic for a long time, thereby proved that BDNF participates in the process of neural loop and behavioral plasticity.
Utilize the Cre/Loxp system not only can knock out, also can carry out specific activation, understand the forward effect of gene gene to gene.Hnasko etc. [7]Select the mouse of Dopamine HCL defective for use, added 1 Loxp-pgk-neo-Loxp in the front of expressing the endogenous Tyrosine Hydroxylase Gene, (pgk is the termination signal of tyrosine hydroxylase, neo is a selection markers), under the normal circumstances, mouse is expressed pgk, and the tyrosine hydroxylase of back is not expressed; Inject at the mouse caudatum under the situation of Cre recombinase, the Cre recombinase cuts away termination signal pgk and 1 Loxp site, and tyrosine hydroxylase is just expressed, and the caudatum position generates Dopamine HCL, thereby the research neurotransmitter dopamine is in the function at this position.
Adopt homologous recombination technique, artificial constructed two Loxp sites on genome, by two Loxp sites that make up, the foreign gene that two ends are had a Loxp site is recombinated on the genome, this kind reorganization is two-way, both can be the foreign gene N4 that recombinates, in the musculus cdna group, also can restructure mouse genome native gene, this is one of important means of site-directed integration.
Make up two opposite Loxp sites on same karyomit(e), under the effect of Cre recombinase, the target gene between the Loxp site reverses in the other direction.Make up 1 Loxp site on the coloured differently body respectively, under the effect of Cre recombinase, the gene of back, Loxp site is recombinated, and big fragment gene is intercoursed chromosome translocation on the coloured differently body.Testa etc. [8]Utilize this principle to carry out following operation, realized group translocation.
The Flp/FRT system
This system is identical with the Cre/loxP system, also is made up of a recombinase and one section special dna sequence dna.Consider that from the angle of evolving the Flp/FRT system is the homologous system of Cre/loxP system in eukaryotic cell.Wherein. recombinase Flp is a monomeric protein of being made up of 423 amino acid in the yeast cell.Similar to Cre, Flp plays a role also without any need for cofactor, has satisfactory stability simultaneously under different conditions.(Flp recognition target, FRT) closely similar with the loxP site, equally the core sequence that is 8bp by two length inverted repeats that is 13bp and length constitutes another composition Flp recognition site of this system.When this system played a role, the direction in FRT site had determined the segmental disappearance of purpose still to reverse.The Flp/FRT system with the obvious difference of Cre/loxP system is: the optimum temps that they play a role is different, and the optimum temps that the Flp recombinase plays a role is 30 ℃, and the Cre recombinase is 37 ℃.Therefore, Cre/loxP system optimum uses in animal body.The sequence in loxP and FRT site as shown in Figure 2.
PiggyBac transposon recombinant technology
PiggyBac transposon (PB transposon) is to separate to obtain in the autographa california nuclear polyhedrosis virus of infecting cabbage looper Trichoplusia ni TN-368 cell strain system (being called for short AcNPV) at first, and called after IFP2 [9], it belongs to the Eukaryotic second class transposon in classification, be one from main gene, long 2467bp wherein contains the readable code frame of 1 rna plymerase ii promotor, 1 polyadenylic acid signal and 1 594 amino acid transposase of encoding [10], end is the reverse terminal repeat (ITR) of long 13bp, (inverted sub-terminal repeats, ITR) (Fig. 3 draws from Handler the reverse inferior terminal repeat of the asymmetric 19bp that distributing in two ends [11]).The PB transposon can cut out in genome and swivel base, cuts out with swivel base and always occurs in distinctive TTAA tetranucleotide target site sequence, and the swivel base frequency is higher, and the piggBac transposon is subjected to the restricted less of organism kind.
The same with other most of DNA transposons, the PB transposon also is by " cut and paste " mechanism swivel base to take place under the catalysis of transposase.Because the integration of transposon occurs in the eukaryotic cells nuclear with cutting off, and the predictive molecule quality of PB transposase is 68kDa, therefore, need enter in the nuclear by nuclear pore complex by active transport under the proteic mediation of nuclear translocation.Sarkar etc. are positioned at the amino acid bunch of 551～571 at C end by the two-way nuclear localization signal of PSORT II analyses and prediction PB transposase [12]Subsequently, Keith etc. are positioned at C end 501～571 amino acids bunch by having studies have shown that the two-way nuclear localization signal of PB transposase, the electronegative amino acid of some of its upstream for the PB transposase to appraise and decide the position also very important [13]
The PB transposon all needs the effect of transposase of itself coding when cutting out and insert [14], and occur in distinctive sequence TTAA target site [15]The PB transposon cuts out from cutting out the site fully with a kind of specific pattern [16], a little always stay one section single tetranucleotide TTAA cutting out [15,17]In the time of in the PB transposon target approach genome, insert in the zone of being rich in A+T usually, the target site of one 5 ' TTAA3 ' tetranucleotide is arranged, and duplicate one section target sequence TTAA [18]The PB transposon cuts out and these features more than genomic swivel base has all showed from the plasmid to the baculovirus from the baculovirus in the cells infected is genomic.
The PB transposon cuts out with certain pattern [19], its model is: when the PB transposon cuts out, double-stranded separately produce blunt end, and reconnecting of DNA chain arranged cutting out the ditch place.When that is to say that containing double-stranded piggyBac transposon cuts out, broken some sequence on the TTAA target site of side, the breach that the transposon that is cut out stays is directly repaired by DNA end freely.Cut out residue or the padding sequence (" filler " sequence) that inverted terminal repeat sequence is not found in the site at PB.The swivel base of PB transposon is a simple shearing-connection procedure.The pattern of cutting out of PB transposon is unique, always stay in the place that cuts out and cut out vestige accurately, and other two classes transposon stays complete Nucleotide or terminal residue cutting out usually in the ditch, cause the inaccurate vestige that cuts out.
Mammals lacks activated natural transposable element.People had once manually been brought back to life the SB transposable element by comparison system generation method from the genome of fish, find that it can act in culturing cell and mouse [20]But the swivel base efficient of the SB factor is not high [21], and the same phenomenon that had expression inhibiting with other many transposable elements, i.e. swivel base efficient descended on the contrary when the transposase expression amount of catalysis swivel base reaction rose [22], brought serious obstruction for the trial that improves swivel base efficient.Simultaneously, the SB factor is carried the indifferent of foreign DNA.Primary SB factor length is less than 2kb, and whenever to carry its swivel base decrease in efficiency of foreign gene of lkb on this basis about 30% more, makes it can't carry complicated structural element and carry out transgenosis or insertion mutagenesis screening [23]The stylish insertion of SB factor swivel base site mainly concentrates on around the original site, and is especially remarkable when the sexual cell swivel base [24]The background sudden change of chromosome deletion and lethality takes place during multiple copied SB factor swivel base easily [25]These all hinder it to be used for inserting on a large scale mutagenesis screening.The TA that stays when at last, the SB factor cuts off repeats also to make the work with reverse mutation affirmation gene function to carry out [24]Owing to these reasons, the SB factor is invented over nearly 10 years and is not widely used.
The Xu Tian of Fudan University etc. [26]Successfully transform the PB factor that derives from moth and be applied to Mammals.Can be in people and mouse cell strain efficient quiding gene of PB and stably express, for somatic cell genetics research and genetic expression provide one efficiently, new system easily.PB also can be used for cultivating transgenic mice, and it is big to have the gene of a carrying capacity, advantage such as efficient easy and simple to handle.Compare with traditional method, transgenosis is integrated with the single copy form that is similar to native gene when utilizing PB to carry out transgenosis, transgene carrier can carry a plurality of genes simultaneously, the transgenosis integration efficiency is high also can steady in a long-termly be expressed, the transgenosis integration site is easy to determine, and the witness marking of available non-damage replaces traditional method economical and efficient ground tracking transgenosiss such as PCR.More infusive is that the characteristic that PB accurately cuts off also can be used for bringing back to life the gene that is inserted into.
The Gateway technology
Gateway TMTechnology is based on a kind of ex vivo technique that the λ that is perfectly clear that has studied has a liking for thalline site-specific recombination system (attB xattP → attL x attR), it has simplified the step of gene clone and subclone widely, and simultaneously typical cloning efficiency is up to 95% or higher; When gene during fast and convenient shuttling back and forth, can also guarantee correct direction and read frame between the purpose expression vector.Gateway TMAlso help expression with different number purifying and detection label.
Two reactions of BP and LR have just constituted Gateway TMTechnology (Fig. 4).BP reaction utilizes the recombining reaction between an attB dna fragmentation or cloning by expression and the attP donor carrier, creates one and crosses the threshold and clone (Fig. 5).LR reaction is cross the threshold a recombining reaction between clone and the attR purpose carrier of an attL.The LR reaction is used for shifting aim sequence to one or more purpose carrier (Fig. 6) in parallel reaction.
In the Gateway technology, mainly use three kinds of toolenzymes (table 1), lambda particles phage intergrase integrase (Int), the integration host factor (IHF) and XIS.
Three kinds of toolenzymes and function thereof in the table 1.Gateway technology
Toolenzyme Use the reaction of this enzyme Function
Int BP，LR Article four, the cut-out of DNA chain intersects and reconnects
IHF BP，LR Auxiliary integrating remark, the unwinding of dna double spiral
XIS LR Being reversed of BP reaction
Lambda particles phage coding lambda integrase (integrase, Int).This enzyme can instruct phage DNA to insert in the E.coli karyomit(e).This insertion effect is to recombinate by the specific site of two dna moleculars, and two ring-shaped DNA molecules are become a big ring.Promptly there is a large amount of intergrases to produce at the early stage of phage-infect, so integration all takes place nearly all infected cells.The available external model of this effect experimentizes.Mix the anabolic reaction system with four kinds of compositions: pure intergrase; From a kind of accessory protein of E.coli, be called the integration host factor (IHF, integration host factor); Magnesium ion; Dna fragmentation with the specific site (be called attP and attB, att is derived from attachment) that contains phage and DNA of bacteria generation reorganization intersection.Dna fragmentation hereto, a simple preparation method is exactly artificial constructed attP of containing and attB plasmid.When integrating remark takes place, at attP and attB place the intersection reorganization takes place promptly, produce two less cyclic DNAs.Integrating remark is by intergrase catalysis, and its step is a link coupled each other: four chains are simultaneously severed, intersect and reconnect, and do not find any stable intermediate products therebetween.The reaction of the topoisomerase II that this preamble is mentioned is very similar, and promptly the dna double chain is cut off simultaneously, and phosphodiester bond couples together again then, does not need the ATP supplying energy.So in fact intergrase can play topoisomerase, can make the superhelix that has att site (or similar sequence) lax.And the same with topoisomerase, intergrase also produces staggered fracture (staggered cut): the singly-bound tail end of seven Nucleotide is arranged, form so-called sticky end.
It is the very sophisticated prokaryotic organism recombination system of a cover that λ has a liking for thalline site-specific recombination system (attB x attP → attL x attR).This system has the recombination fraction height, and genetic expression is stable, the advantages such as direction row that the may command gene inserts.
The problem that the locus specificity recombinant technology faces
Though especially Cre/loxP system widespread use of locus specificity recombination system, but still there are some problem demanding prompt solutions: though 1. Tu Bian loxP has been used to produce more stable site-directed integration gene, but the degree that degree of stability is still expected not as good as people, and recombination fraction is not high; 2. Cre genetic expression instability in the Cre transgenic mice influences the generation of reorganization [27]3. induce Cre to express by chemical part and mediate recombining reaction, its recombination fraction remains further to be improved; Whether virus can produce serious side effects and remain to be confirmed when 4. virus induction Cre expressed; 5. detecting the vitro system of Cre recombinase active does not set up as yet; 6. tissue-specific promoter is still disputable, if any tissue-specific promoter think that previously activity is only arranged in particular organization, but actual and anticipation and inconsistent, the promotor that has is thought has activity in multiple tissue, and actual result only has activity in single organization; 7. use Cre/IoxP system producer gene engineering mouse, experimental period is long, costs dearly.
Compare the Cre/loxP system, though there is advantage in the PB transposon system, PB transposon specificity site distributes more in human body, must judge the recombination position with the test mode of PCR after each reorganization, operates cumbersome.And, because the PB recombining reaction can't reversiblely carry out, so just be difficult to reject reverse (Reverse) experiment of gene, make the research of target gene function lack globality.
Though the Gateway technology is the very sophisticated prokaryotic organism recombination system of a cover, but when being applied to the locus specificity reorganization, need mix the reactive system of forming by multiple composition, and be based on lambda particles phage locus specificity recombination system but not mammalian cell, its recombining reaction can't carry out in mammalian cell.Therefore, still there is inconvenience in the locus specificity reorganization in being used for mammalian cell of Gateway technology.
Therefore, at the problems referred to above that faced in the present locus specificity reorganization (especially carrying out the locus specificity reorganization in mammalian cell), this area presses for and makes up a kind of novel method of carrying out the locus specificity reorganization in mammalian cell.
Summary of the invention
One of main purpose of the present invention just provides a kind of novel method of carrying out the locus specificity reorganization in mammalian cell.
Another main purpose of the present invention provides a kind of new intergrase that can be used for carrying out in the mammalian cell locus specificity reorganization.
In a first aspect of the present invention, a kind of integrase gene that can express in Mammals is provided, it is selected from down group: (a) nucleotide sequence that is made of the sequence shown in the SEQ ID NO:1; (b) have the nucleotide sequence shown in the SEQ ID NO:1, and can in Mammals, express and mediate the nucleotide sequence of locus specificity reorganization; (c) under stringent condition with (a) or the nucleotide sequence hybridization that (b) is limited, and can in Mammals, express and mediate the nucleotide sequence that locus specificity is recombinated; Or (d) and the nucleotide sequence complementary nucleotide sequence that each limited (a)-(c).
In a preference, described Mammals is selected from: people, rat, mouse, dog, monkey, pig, horse, ox or sheep, more preferably described Mammals is people, rat or mouse.
In a specific embodiment of the present invention, described gene is the nucleotide sequence that is made of the sequence shown in the SEQ ID NO:1.
In a second aspect of the present invention, a kind of intergrase that can express in Mammals is provided, it is selected from down group: (i) by the coded aminoacid sequence of the above-mentioned integrase gene of the present invention; (ii) process replaces, lacks or adds one or several amino acid in the aminoacid sequence that (i) limits, and can mediate the aminoacid sequence of locus specificity reorganization in Mammals; (iii) (i) or (ii) described in conservative property variation polypeptide or its active fragments or its reactive derivative of aminoacid sequence.
In a specific embodiment of the present invention, described intergrase is made of the aminoacid sequence shown in the SEQ ID NO:2.
In a third aspect of the present invention, a kind of carrier is provided, described carrier comprises the above-mentioned gene of the present invention.
In a fourth aspect of the present invention, a kind of genetically engineered host cell is provided, it contains the above-mentioned carrier of the present invention.
In a fifth aspect of the present invention, a kind of method of carrying out the locus specificity reorganization in mammalian cell is provided, described method comprises: (A) integrase gene of the present invention is changed in the mammalian cell, or intergrase of the present invention is imported in the mammalian cell; (B) under the condition that is fit to the locus specificity reorganization, cultivate described mammalian cell.Those of ordinary skills can select above-mentioned condition according to the general knowledge in this area.
In a specific embodiment of the present invention, described integrase gene has the nucleotide sequence shown in the SEQ ID NO:1.In another embodiment of the present invention, described intergrase has the aminoacid sequence shown in the SEQ ID NO:2.In another embodiment of the present invention, described Mammals is selected from: people, rat, mouse, dog, monkey, pig, horse, ox or sheep.In a preference, described Mammals is people, rat or mouse.In another embodiment of the present invention, described mammalian cell is the cell through genetically engineered operation.
Others of the present invention will be apparent to those skilled in the art owing to the disclosure of this paper.
Description of drawings
Fig. 1: the mechanism of action of Cre/loxP system.
Fig. 2: loxP and FRT site sequence are relatively.
Fig. 3: PiggyBac transposon structural representation.
Fig. 4: Gateway TMKnow-why.
Fig. 5: BP reaction principle.
Fig. 6: LR reaction principle.
Fig. 7: design the method that primer adopts for making up the pIBP mutant that to express EGFP.
Fig. 8: oInt synthetic design of primers synoptic diagram.
Fig. 9: the oInt fragment PCR is synthesized the result.Fig. 9 A: six fragments of B1～B6 of coming out with four primer PCRs; Fig. 9 B: with six fragments of B1～B6 is template, and P1 and P16 are the two ends primer, and PCR goes out final oInt fragment.
Figure 10: oInt expression of results, transfection 293T cell utilize Western to detect after 24 hours.
Figure 11: oInt is in intracellular location.Figure 11 A:oInt immunofluorescence result.Cotransfection GFP and oInt are in the Hela cell, and 24 as a child observed the location of oInt and EGFP with the method for immunofluorescence dyeing.Figure 11 B:oInt caryoplasm separating experiment result.Swimming lane 1～3Whole cell refers to not have the cracked cell.Swimming lane 4～6 refers to the albumen in the lysing cell nuclear.The albumen that obtains after swimming lane 7～9 finger lysing cell matter.OInt-1 and oInt-2 are the parallel controls of transfection simultaneously.Laz is a negative control.
Figure 12: pIBP detects the structure of carrier and detects principle.
Figure 13: utilize PCR method to detect the principle schematic of BP recombining reaction.
Figure 14: the external BP reaction of pIBP carrier PCR detected result.In the reorganization system of external 20ul, add the pIBP plasmid of 200ng.Swimming lane 1 adds the mixed enzyme that contains Int and IHF.Swimming lane 2 does not add recombinase.
Figure 15: it is active in the intracellular reorganization of 293T to utilize pIBP to detect oInt.Y-axis is the GFP fluorescence intensity.The every hole transfection of pIBP plasmid 50ng.Swimming lane 1 negative contrast, cotransfection pIBP and Laz (200ng), swimming lane 2～6 transfection oInt (10/50/100/150/200ng).Utilized FL600 to record the GFP fluorescence intensity in 48 hours after the transfection.
Figure 16 A: the fluorescence intensity (FL600) that pIBP (125ng) and oInt (125ng) cotransfection 293T cell is detected GFP after .48 hour.Swimming lane 1 transfection Laz is as negative control, and this experiment repeats 3 times.
Figure 16 B: the cell of swimming lane 1,2 is collected the back extract genomic dna, and detect with preceding method PCR, can PCR in the cell of discovery swimming lane 2 go out the fragment about 300bp, the cell of swimming lane 1 does not then have.
Figure 17:, cultivate and carry out formaldehyde fixed after 24 hours with oInt and pIBP ratio cotransfection Hela cell with 1: 1.Utilize the Confocal picked at random visual field to take at last.The Hela of oInt and the independent transfection of pIBP is as negative control.
The recombination efficiency of Figure 18: BP reaction.Ordinate zou accounts for total cell count (blueness, per-cent DAPI) for the cell count (green) of expressing EGFP.X-coordinate is three groups of corresponding among Figure 19 experiments.
Figure 19: the burnt colored graph of copolymerization.PIP carrier: after pIBP detected carrier and reject attB1, only contain the carrier of attP1.OInt and pIBP be according to 1: 1 ratio cotransfection Hela cell, formaldehyde fixed after 24 hours and 48 hours, and take pictures in the burnt picked at random of the copolymerization visual field.
Figure 20: the cell of expressing EGFP accounts for the per-cent of total cell.
Embodiment
The inventor is by long-term and deep research, made up and in mammalian cell, to have expressed the intergrase (oInt) that and guides the locus specificity reorganization, the effect of this intergrase does not rely on the integration host factor (IHF) albumen, can successfully realize the locus specificity recombining reaction in the mammalian cell.The inventor also provides a kind of novel method that can be used for locus specificity reorganization in the mammalian cell on this basis, has adopted intergrase of the present invention in this method.On this basis, the inventor has finished the present invention.
Owing to do not have intergrase in the mammalian cell, even in the human genome in also not with the albumen of Int similar, the contriver by screening and relatively, finally just obtained can the optimization of successful expression in mammalian cell the oInt sequence.
Particularly, the contriver has optimized colibacillary intergrase sequence by engineered method, and utilizes overlap extension pcr to synthesize the oInt gene after the optimization.The contriver further adopts the oInt gene after the optimization to express in the 293T cell, and result's demonstration can be expressed in the 293T cell preferably through the oInt gene that screening obtains, and advantageously is positioned in the nucleus.
The contriver has further made up detection carrier pIBP that detects the BP reaction and the validity of having verified this carrier, adopts this detection carrier, by detecting the EGFP fluorescence intensity, has confirmed that oInt has higher recombination efficiency.In addition, the contriver has also further verified the verity and the high recombination efficiency of the recombining reaction of oInt mediation by PCR method and copolymerization Jiao method.
As used herein, term " oInt ", " Int of optimization " or " integrase gene of the present invention " are used interchangeably, all be meant the nucleotide sequence that can in mammalian cell, express and mediate locus specificity reorganization, comprise nucleotide sequence with SEQ ID NO:1, its series of variation, can with (a) or nucleotide sequence hybridization that (b) is limited or their complementary sequence.
The varient of polynucleotide involved in the present invention, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 70%, preferably at least 80%, the polynucleotide of at least 90% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding GaMYB2.
Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
As used herein, term " intergrase of the present invention (INT) ", " isolating intergrase " or " Mammals intergrase " are used interchangeably, all refer to exist, be expressed in or import in the mammalian cell, but and protein or its active fragments of locus specificity reorganization in the mediate mammalian cell.
The present invention includes fragment, derivative and the analogue of Mammals intergrase.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function or the active polypeptide of intergrase shown in the SEQ ID NO:2 of the present invention basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
Also comprise among the present invention and having and variant form intergrase identical function of the present invention, SEQ ID NO:2 sequence.These variant forms comprise (but being not limited to): one or more (it is individual to be generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.
The present invention comprises that also modification (the not changing primary structure usually) form of intergrase comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
Major advantage of the present invention is: (1) has successfully made up the intergrase sequence that does not originally have, do not exist even homologous sequence in mammalian cell, for locus specificity reorganization research in the mammalian cell provides strong instrument; (2) provide a kind of novel method of in mammalian cell, carrying out the locus specificity reorganization, had great research and development prospect; (3) adopt intergrase of the present invention, its encoding sequence or method in mammalian cell, to carry out the locus specificity reorganization and have easy, efficient, stable advantage, be suitable for applying.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, (for example, basic molecular biology operation is all with reference to " molecular cloning experiment guide " second edition, Science Press, 1992 according to normal condition usually; Elementary cell is learned operation all with reference to " cell culture experiments guide " first version, Science Press, 2001) described in condition, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
Experiment material and method
Bacterial classification, clone and carrier
Bacterial strain: E.coli DH5 α, E.coli BL21 (DE3); Cell strain: HEK293T (ATCC); Plasmid and DNA:pET30a (Clontech), pIRES2-EGFP (Clontech), M07Rx (GeneCopoeia), M11Ra (GeneCopoeia)
Enzyme
Various restriction enzymes (NEB), Pfu archaeal dna polymerase (worker is given birth in Shanghai), T4DNA ligase enzyme (Invitrogen); INT recombinase (GeneCopoeia), IHF (GeneCopoeia)
The test kit class
Plasmid extraction QIAprep Spin Miniprep Kit (QIAGEN), glue reclaims test kit QIAEX II GelExtraction Kit (QIAGEN), Wizard Genomic DNA Purification Kit (Promega),
Chemical reagent
Peptone Tryptone, yeast extract Yeast Extract (OXOID), inorganic salt commonly used do not have dated especially all from Shanghai traditional Chinese medicines group, and organic salt does not have dated especially all available from Sigma
Molecular weight Marker
100bp DNA Marker (Bio-Rad); 1kb DNA Marker (Bio-Rad); Protein molecular weight Marker (the biochemical cell in Shanghai institute); Pre-dsred protein molecular weight Marker (Bio-Rad)
Substratum and solution
1)The LB substratum: the 10g Tryptones, the 5g yeast extract, 10g NaCl is dissolved in the 1000ml distilled water, transfers pH to 7.0,121 ℃ of high pressure steam sterilizations, 15min; Add the 15g/L agar powder in the solid medium. 2)50x TAE damping fluid: 242.2g Tris Base, 57.1ml HAc, (0.5mol/L, pH8.0), adding distil water is to 100ml for 100ml EDTA. 3)Plasmid is taken out lysate (1ml) for a short time: 730 μ l H 2O, 200 μ l 10%SDS, 50 μ l 2MNaOH, 20 μ l 500mM EDTA. 4)The required S.O.B nutrient solution of RbCl chemoreception attitude: peptone 20g/L; Yeast extract 5g/L; NaCl 0.6g/L; KCl 0.5g/L; Sterilization adds the MgCl that sterilizes before using 2, MgSO4 is to final concentration 10mM. 5)Intestinal bacteria attitude cell damping fluid 1:RbCl 12g/L; MnCl 24H 2O9.9g/L; CaCl 22H 2O 1.5g/L; Glycerine 150g/L; KAc 2.94g/L; Transfer to pH5.8 by 10%HAc, filtration sterilization, 4 ℃ of preservations. 6)Competent escherichia coli cell damping fluid 2:0.5M pH6.8MOPS 20mL; RbCl 1.2g/L; CaCl 22H 2O 11g/L; Glycerine 150g/L; Filtration sterilization, 4 ℃ of preservations. 7)Tricine Gel (Ricin glue) reaction buffer: 10 * anode buffer liquid (500ml): Tris 121.1g, H 2O 500ml, pH transfer to 8.9 (HCl allotments).Negative electrode damping fluid: Tris 12.11g, Ricin 17.29g, SDS 1g. 8)Cell pyrolysis liquid: 20mM Tris-HCl, 150mM NaCl and 1%v/v Triton X-100, pH 7.5, protein inhibitor (available from Roche), 10mM NEM (available from Sigma). 9)30% polyacrylamide solution: the 29g acrylamide, 1g Bis adds water to 100ml, fully dissolves after-filtration, preserves standby in 4 ℃ of brown bottles. 10)The fast staining fluid of 5 * SDS-PAGE (500mL): 250mg Xylene Brilliant Cyanine G G 250, 95% ethanol 125ml, H 3PO 4250ml adds ethanol earlier during preparation, wait fully to add H again after the dissolving 3PO 4Keep in Dark Place at 4 degree, use preceding dilution. 11)The slow staining fluid of SDS-PAGE (500mL): coomassie brilliant blue R250 1.25g, methyl alcohol 225mL, water 225mL, glacial acetic acid 50mL. 12)10 * SDS electrophoretic buffer: 250mM Tris, 1.92N glycine, 1%SDS. 13)5 * Western Blot electrotransfer damping fluid 5L:Tris 145.2g, Gly 73.2g. 14)10×TTBS：200mM?Tris，1.5N?NaCl，0.5％Tween20。 15)2 * mammalian cell lysate (CoIP): 2%NP-40,20% glycerine, 0.27MNaCl, 40mM Tris (pH8.0). 16)NTA lysis buffer: 50mM NaH 2PO 4, 300mM NaCl, NaOH transfers pH to 8.0. 17)NTA lavation buffer solution: 50mM NaH 2PO 4, 300mM NaCl, the 5-20mM imidazoles, NaOH transfers pH to 8.0. 18)NTA elution buffer: 50mM NaH 2PO 4, 300mM NaCl, the 250mM imidazoles, NaOH transfers pH to 8.0. 19)Protein dialysis buffer liquid: 50% glycerine (v/v), 50mM Tris-HCl, 10mM MgCl 2, HCl transfers pH to 7.4. 20)Cellular immunization dyeing confining liquid: 1% sheep blood serum (biochemical cell institute), 3%BSA, 0.1%NaN 3, 0.1%Trition-100 (PBS). 21)Caryoplasm separating experiment lysate.Buffer A: 10mM Hepes, pH 7.9,10mM KCL, 1mM EGTA, 0.15%NP-40,1mM DTT, proteinase inhibitor; Buffer B: 20mM Hepes, pH7.9,400mM NaCl, 1mM EDTA, 1mM EGTA, 0.5%NP-40, proteinase inhibitor.
Key instrument and equipment
Pcr amplification instrument: Bio-Rad; Horizontal nucleic acid electrophoresis groove: Liuyi Instruments Plant, Beijing; SW-CJ-IF type clean work station: Suzhou Decontamination Equipment Plant; 5415D desk centrifuge: Ependoff; 320-S pH meter: MELLER; JY92-II type ultrasonic cell disruptor: the new sesame scientific instrument in Ningbo institute; Vertical electrophoresis system: Bio-RadMini Protein II; Decolorization swinging table: its woods Bel of Haimen; Vacuum pump: its woods Bel of Haimen; Electric heating constant temperature tank: DK-8D; Gel imaging analysis system: Bio-Rad; Low temperature tabletop refrigerated centrifuge: Beckman company, HITACH
The foundation of reorganization system in embodiment 1. mammalian cells
I. experimental technique and step
The acquisition of Int (Integrase) target sequence and codon optimized
1. in the NCBI gene pool, obtain the Int gene order in intestinal bacteria source, and it is codon optimized to utilize DNAworks2.0 software to carry out mammalian cell expression. the sequence oInt (shown in SEQ ID NO:1, its pairing intergrase is shown in SEQ ID NO:2) after obtaining to optimize.
2. utilize the oInt behind synthetic optimization of method of overlapping PCR
The designed primer of oInt that is used for is shown in SEQ ID NOs.:3-26.
A. reaction system is one group with four primers, reacts according to shown in Figure 8:
Template: inner primer, 2 primers in centre of respectively organizing primer shown in Figure 8, for example primer 2 and 3, respectively 0.1 μ l; Primers F/R: outer primer, 2 primers respectively organizing the two ends of primer shown in Figure 8, for example primer 1 and 4, respectively 0.5 μ l; Pfu enzyme: 1 μ l; 10 * Pfu damping fluid: 5 μ l; DNTP:1 μ l; H 2O:41.8 μ l.
The b.PCR program:
95℃，2min→(94℃，30sec→56℃，30sec→72℃，30sec)×25→72℃，10min→4℃
3. the glue of segmentation PCR product reclaims: (QIAEX II Gel Extraction Kit 150 QIAGEN), reclaims with reference to product description to use glue to reclaim test kit
4.oInt acquisition: several small segments that the purifying that front PCR reaction is obtained is good continue to carry out the PCR reaction once more as template, obtain oInt
Secondary PCR and M07-oInt Construction of eukaryotic
Several small segments that the purifying that front PCR reaction is obtained is good continue to carry out the PCR reaction once more as template, and with the purpose band oInt that reaction obtains M07 (reactivation gene) carrier of packing into
P25:CAA TTCGAAATGGGGCGAAGAAGATCCCACGAGC 3 ' (forward primer)
(underscore is the NspV recognition site, SEQ ID NO:27)
P26:ATAAGAATGC GGCCGCCTTGATTTCAATCTTGTCCCACTCC 5 ' (reverse primer)
(underscore is a Not I recognition site, SEQ ID NO:28)
A. reaction system:
Template: each 1 μ l; Primers F/R: each 1 μ l; Pfu enzyme: 1 μ l; 10 * Pfu damping fluid: 5 μ l; DNTP:1 μ l; H 2O:41.6 μ l;
The b.PCR program:
95℃，4min→[94℃，30sec→60℃，30sec→72℃，90sec]×25→72℃，10min→72℃，30min→4℃
Carrying out purifying by aforementioned glue recycling step reclaims.
1. the enzyme of the PCR product of carrier and oInt is cut: oInt and M07 carrier carry out double digestion with NspV and NotI.
2. connect: inset: 5 μ l; Carrier: 2 μ l; Connect damping fluid (5X): 2 μ l; T4 ligase enzyme: 1 μ l.
4 ℃ connect 12 hours
3.RbCl the preparation of competent cell: (1) is scoring to the LB flat board with DH5 α bacterial classification, 37 ℃, and 10-12h; (2) choose mono-clonal in 30ml S.O.B, 37 ℃, overnight incubation; (3) by taking over the night bacterium at 1: 100 in 200ml S.O.B, 37 ℃, be cultured to OD 550=0.35, about 2hour; (4) bacterium liquid is transferred to cryosel rapidly and bathes in (3～-5 ℃), precooling 15min (shaking once gently in～3 minutes), the 500ml of precooling simultaneously Centrifuge Cup; (5) precooling whizzer; (6) bacterium liquid is transferred to rapidly in the 500ml Centrifuge Cup; (7) 4500rpm * 5min, abandons supernatant by 4 ℃; (8) add 4 * 16ml damping fluid 1, light mixing suspends, 15min during cryosel is bathed; (9) 4000rpm * 5min, abandons supernatant by 4 ℃; (10) add 4 * 4ml damping fluid 2, suspension cell is on ice; (11) be distributed into 200 μ l/ pipes (pipe precooling) immediately; (12) liquid nitrogen flash freezer; (13)-70 ℃ preservation.
4. transform: (1) connects product with 5 μ l and adds in the RbCl competent cell, places 30min behind the mixing on ice.(2) 42 ℃ of temperature are bathed 2min, ice bath 2min.(3) add 1ml LB, 37 ℃ of temperature are bathed 45min～1h.The centrifugal 1min of (4) 6,000rpm abandons supernatant, stays about 100 μ l liquid and will precipitate suspension, sucking-off liquid shop dish.(5) inversion is put in 12～15h in 37 ℃ of incubators.
5. a small amount of extracting (alkaline process) of plasmid: 1mL lysate: H 2O 730 μ l; 10%SDS 200 μ l; 2M NaOH50 μ l; 500mM EDTA 20 μ l.
(1) the full clone of picking is in containing suitable antibiotic substratum, and (12～14h) contain the thalline of required plasmid to 37 ℃ of incubated overnight.(2) get 0.8～1ml and spend the night bacterium in the Eppendorf of 1.5ml pipe, centrifugal 7000rpm * 1min removes supernatant.(3) add 100 μ l H 2The O suspension cell.(4) add 100 μ l lysates, mixing reacted 2～5 minutes gently.(5) MgCl of adding 50 μ l precooling 1M 2, mixing is placed 2min at least on ice, centrifugal 13000rpm * 2min.(6) KAc of adding 50 μ l precooling 5M, mixing is placed 2min on ice, centrifugal 13000rpm * 2min.(7) get supernatant (about 300 μ l) to new pipe, add 100% ethanol of 0.6ml precooling, mixing, centrifugal 13000rpm * 2min.(8) carefully remove most supernatant, 500 μ l, 70% ethanol room temperature washing precipitation, 13000rpm * 1min, vacuum pump blots washing liq.(9) put super clean bench 5～10min and make the ethanol volatilization fully.(10) stand-by with 20 μ l TE (containing 0.1 μ l RNase) dissolving.
6. the enzyme of plasmid is cut and is identified and order-checking
The plasmid that builds is carried out enzyme cut evaluation, confirm whether the purpose fragment inserts carrier, and entrust Mei Ji company to carry out the mensuration of sequence, sequencing result shows that inserting carrier is required purpose fragment really.
M07-oInt is in intracellular expression and location
1. be used for a small amount of preparation of the plasmid DNA of cell transfecting
The plasmid that transfection is used needs purity very high, with the test kit QIAprep Spin MiniprepKit 250 of Qiagen company, the extracting plasmid DNA, step is as follows: (1) gradation is got 3mL and is spent the night bacterium in the centrifuge tube of 1.5mL, 8, centrifugal 1 minute of 000rpm removes supernatant.(2) add 250 μ L Buffer P1 (Qiagen), the abundant suspended bacteria piece of vibrator.(3) add 250 μ L Buffer P2 (Qiagen), put upside down mixing gently 4～6 times, room temperature leaves standstill puts to the solution becomes thickness, not above 5 minutes.(4) add 350 μ L Buffer N3 (Qiagen), put upside down mixing gently 4～6 times, placed on ice 10 minutes.Centrifugal 10 minutes of (5) 13,000rpm get supernatant in post.13, centrifugal 1 minute of 000rpm abandons and passes liquid.(6) add 750 μ L Buffer PE (Qiagen), 13, centrifugal 1 minute of 000rpm abandons and passes liquid.Centrifugal 1 minute of (7) 13,000rpm place a clean centrifuge tube with pillar, and room temperature was placed 10 minutes.(8) add dilution buffer liquid (Qiagen) 50 μ l, placed 2 minutes.Centrifugal 2 minutes of (9) 13,000rpm pass liquid and are connected in the centrifuge tube, promptly obtain highly purified plasmid DNA
2. the cultivation of cell and transfection (plasmid DNA is transferred in the mammalian cell)
293,293T cell, use the training liquid of DMEM+10%FBS to cultivate, when cell long when testing required full scale (being generally 24 hours), cell state well (is judged after examining under a microscope and is obtained) simultaneously, (with 24 holes is example then to can be used for transfection, all the other are scaling in proportion): (1) changed liquid in preceding 1 hour in formal transfection, exhaust training liquid with the lancet head, slow respectively again Yan Bi carefully adds the DMEM that does not contain serum (as far as possible cell not being blown afloat) of 250ml, puts back to incubator (overlong time of putting at room temperature can influence cell state) then rapidly; (2) in the EP pipe, add the DMEM that 50 μ l do not contain serum, more required transfection plasmid (or contrast, confidential reference items plasmid, be generally about 100ng) is added wherein mixing; (3) do not contain at 25 μ l and add 1 μ l transfection reagent Plus among the DMEM of serum, add behind the mixing described in 2 in the EP pipe, mixing left standstill 15 minutes; (4) do not contain at 25 μ l and add 1 μ l transfection reagent Lipo among the DMEM of serum, add behind the mixing described in 3 in the EP pipe, mixing left standstill 15 minutes; (5) mixing is contained (the generally the rarest multiple hole is to avoid experimental error) in the target hole that plasmid reagent 50 μ l evenly are added drop-wise to the cell cultures dish, mixing is put back to culturing room rapidly gently; (6) transfection stopped after 3 hours, will coil taking-up, exhausted training liquid fast with the lancet head, added the DMEM that 500ml contains 10% serum again and cultivated; (7) at different cells and experiment purpose, the time of receipts cell not necessarily if do the RNAi experiment, is then cultivated results after 48 hours after the transfection; If general expression experiment did not then wait, specifically according to the experiment demand in 24-48 hour
3. detect the expression amount of oInt in mammalian cell by immunoblotting (Western Blot)
The step that adopts is as follows: the HEK293T cell is taken out in (1) transfection after 24 hours, inhales and removes supernatant, with 2 * SDS sample-loading buffer (0.1M Tris-HCl, 4%SDS, beta-mercaptoethanol 2ml, glycerine 25ml, bromjophenol blue 0.04～0.05g, H 2O 23ml) direct lysing cell is received sample.(2) above-mentioned sample is carried out the SDS-PAGE electrophoresis.(3) change film (the wet type electroporation, Bio-Rad): SDS-PAGE glue is immersed in the conventional electrotransfer damping fluid 30 minutes.On the electrotransfer plate, spread two-layer buffering spacer and one deck filter paper successively, glue is layered on the filter paper, spread nitrocellulose filter and cover the target protein region, repave one deck filter paper and two-layer buffering spacer.Good the electrotransfer plate holder.Connect constant current power supply (250mA), changeed film 60 minutes.(4) film that takes a turn for the better is positioned over rock in 5% skimmed milk sealing 1 hour.(prescription of 10 * damping fluid is: Tris 24.2g with lavation buffer solution; NaCl 87.74g; Tween 5g; PH8.0; Add water to 1L) rinsing 5 minutes, repeated washing 3 times.(5) film is immersed in anti-(available from Sigma) solution in mouse source one of anti--EGFP and rocked 1 hour.With lavation buffer solution rinsing 5 minutes, repeated washing 3 times.(6) again film is immersed in the solution of two anti-(available from the Rockland) that contain anti-mouse and rocked 0.5 hour, with damping fluid rinsing 5 minutes, repeated washing 3 times.(7) with Infrared fluorescence imager (Odyssey) observations.
4. caryoplasm separating experiment
(1) the HEK293T cell is taken out in transfection after 24 hours, inhales and removes supernatant, with 500ulPBS eluant solution cell.(2) with buffer A (10mM Hepes, PH7.9; 10mM KCL; 1mM EGTA; 0.15%NP-10; 1Mm DTT) re-suspended cell is placed 10min on ice.4 ℃ are descended 12, centrifugal 30 seconds of 000g.Collect the kytoplasm supernatant.(3) after precipitation is cleaned three times through buffer A at buffer B (20mM Hepes, PH7.9; 400mM NaCl; 1mM EDTA; 1mM EGTA, 0.5%NP-40) resuspended, 4 ℃ shook 15 minutes.Centrifugal back supernatant is the nucleus extract.
(4) Western detects
5. cellular immunization dyeing
(1) cell removes nutrient solution, PBS washing three times.(2) 4% PFA (diluting) 1ml with PBS, 4 degree fixed cell 30min.(3) remove PFA, PBS washs once, the penetrating processing of 0.2% TritionX-100 20min.(4) the PBS washing is three times, each 5min.(5) Blocking Solution (1% sheep blood serum, 3%BSA, 0.1%NaN3, the PBS of 0.1%Tritionx-100) sealing is 1 hour, and is recyclable.(6) PBS washing three times (each 5min).(7) one anti-hatching one hour.(8) the PBS washing is three times, each 5min.(9) the two anti-30min of hatching.(10) the PBS washing is three times, each 5min.(11) have facing down of cell to place cover glass length and be added with on the slide glass of mounting with oil, the room temperature lucifuge is placed and is spent the night.
II. experimental result and analysis
Segmental optimization of oInt and acquisition
Owing to do not have intergrase (Integrase) in the mammalian cell, in the human genome in also not with the albumen of Int similar.So we take engineered method, the colibacillary Integrase gene order of having utilized the DNAWorks2.0 software optimization, and attempt it is expressed in mammalian cell.DNAWorks software now belongs to a shareware of NIH Helix system by people such as Hoover exploitation, is mainly used to design, optimizes, synthesizes goal gene.Then, the oInt gene after utilizing that the PCR overlap technique is synthetic and optimizing.Overlap extension pcr (gene splicing by overlap extension PCR, be called for short SOE PCR) owing to adopt primer with complementary end, make the PCR product form overlapping chain, thereby the amplified fragments lap splice of different sources is got up in the extension by overlapping chain in amplified reaction subsequently.This technology utilizes round pcr to carry out the efficient gene reorganization external, and does not need restriction endonuclease digestion and ligase enzyme to handle, and can utilize other product that relies on the method for digestion with restriction enzyme to be difficult to obtain of the very fast acquisition of this technology.From NCBI gene library, obtain the intestinal bacteria Integrase fragment (NC_007675.1) of wild-type, carry out codon optimizedly with DNAWORK2.0 software, and design 16 primers, the complementary overlap (Fig. 8) of 16bp is arranged between per two primers.In the middle of utilizing two primers as template (Fig. 8. primer 2, primer 3), two on both sides as amplimer (as Fig. 8. primer 1, primer 4), mode by PCR amplifies six sections (Fig. 9 A. sections 1～6) long dna fragmentation, six sections PCR products after the purifying recovery as template, are utilized primer 1 and primer 16, finally amplify required oInt fragment (Fig. 9 B) makes up work as follow-up clone template.
OInt is in intracellular expression of 293T and location
In order to set up the Gateway reorganization system in the mammalian cell, the oInt gene after we will optimize is attempted at the 293T cell inner expression.OInt sees Figure 10 in the expression of results of 293T cell.OInt has reasonable expression in the 293T cell as can be seen from Figure 10, and the basically identical of size and prediction.
In order to understand oInt in intracellular expression and localization, we again with the oInt transfection in the Hela cell, and utilize the method for immunofluorescence to observe oInt in intracellular location (Figure 11 A).As can be seen from Figure 11A, the EGPF of cotransfection all has expression in nucleus and tenuigenin, and oInt expresses in nucleus mostly.We have further carried out the caryoplasm separating experiment, detect the embody amount (Figure 11 B) of oInt in caryoplasm with Western.As can be seen, oInt has expression (Figure 11 B, swimming lane 5 and swimming lane 8) in nucleus and tenuigenin among the figure, expresses many slightly in the nucleus.May cause by excessive transfection oInt.
The foundation of embodiment 2.BP recombining reaction detection architecture
I. experimental technique and step
The structure of BP reaction detection carrier
1.pIBP and pIP detects the structure (as follows) of carrier
2.attP1, the acquisition of terminator sequence-attB1
With Dev01.1 is template, and the design primer amplification goes out the attP1 fragment
With M11 is template, design primer amplification terminator sequence-attB1 fragment and do not contain the termination fragment in attB1 site.The AttP1 primer:
P46:TCG CCTAGCTAGCAAATAATGATTTTA 3 ' (forward primer)
(line place is the NheI restriction enzyme site, SEQ ID NO:29)
P47:CACGC GGATCCTACAGGTCACTAATACCA 5 ' (reverse primer)
(line place is the BamHI restriction enzyme site, SEQ ID NO:30)
Terminator sequence-attB1 primer:
P48:CGCGC GGATCCTTGGGATCTTTGTGAAGGAACCTTACTTCTGTGGTGTGA 3 ' (line place is the BamHI restriction enzyme site, SEQ ID NO:31)
P49-1:ATGCAT CCATGGTTGTGGCCAGCCTGCTTTTTTGTACAAACTTGTTGGAACCCTAAAGG 5 ' (line place is the BstXI restriction enzyme site, SEQ ID NO:32) does not contain the terminator sequence reverse primer of attB1:
P49-2：ATGCAT CCATGGTTGTGGGGAACCCTAAAGG
(line place is the BstXI restriction enzyme site, SEQ ID NO:33)
The attP1 fragment that PCR is gone out according to the cloning process among the embodiment 2 and terminator sequence-attB1 insert to construct in pIRES2-EGFP (Invitrogen) carrier and detect carrier pIBP; With attP1 with do not insert to construct among the pIRES2-EGFP and check carrier pIP with the terminator sequence in attB1 site.
3.attP1 the structure of mutant clon
For making up the pIBP mutant can express EGFP, as follows according to the method design primer of Fig. 7:
P50：TCGCCTAGCTAGCAATAATCATTTTATT(SEQ?ID?NO：34)
P51：CAATCCTTTCTTATAATCCCA(SEQ?ID?NO：35)
P52：TGGGATTATAAGAAAGGATTG(SEQ?ID?NO：36)
With primer P50 and primer P52, primer P51 and primer P47 are respectively forward and reverse primer, are template with pIBP, utilize PCR condition among the embodiment 2, and PCR goes out two bar segment 1 and fragment 2, carries out electrophoretic separation, carry out glue according to aforesaid method and reclaim.Being template with fragment 1 and fragment 2 then, is forward and reverse primer with primer P50 and primer P47, and with above-mentioned reaction system and condition, PCR once more so just can obtain the gene fragment of the attP1 after the complete sudden change.The pIBP that makes up after promptly can obtaining suddenling change according to the method among the embodiment 2 clones.The sudden change of pIP makes up the same.
4. external BP reaction system
BP clones enzyme: 2ul; 5*BP damping fluid: 2ul; Dev01.1:1ul; PIBP:2ul; H 2O:3ul.Under 4 ℃, 12 hours.
The structure of BP reaction detection carrier attP-termination and attB-EGFP
With Dev01.1 is template, and the design primer amplification goes out attP1, attP2 fragment
With M11 is template, and the design primer amplification goes out the terminator sequence fragment
With pIRES2-EGFP is template, and the design primer amplification goes out the attB-EGFP fragment
AttP1 and attP2 primer:
P53:CCG GAATTCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTG 3 ' (line place is the NheI restriction enzyme site, SEQ ID NO:37)
P54:CTAG CTCGAGCCTTATCA TCTAGATACAGGTCACTAATACCATCTAAGT 5 ' (line place is followed successively by Xhol and XbaI enzyme cutting site, SEQ ID NO:38)
P55:CTAG CTCGAGTACAGGTCACTAATACCATCTAAGT 3 ' (line place is the XhoI restriction enzyme site, SEQ ID NO:39)
P56:ATAAGAAT GCGGCCGCCAAATAATGATTTTATTTTGACTGA 5 ' (line place is the NotI restriction enzyme site, SEQ ID NO:40)
Stop the fragment primer:
P57:CCG TCTAGAATGGCTTCGTACCCCTGCCATCAAC 3 ' (line place is the XbaI enzyme cutting site, SEQ ID NO:41)
P58:CTAG CTCGAGTCAGTTAGCCTCCCCCATCTCCCGG 5 ' (line place is the XhoI restriction enzyme site, SEQ ID NO:42)
Stop the fragment primer:
P59:TTACCG ACGCGTACAAGTTTGTACAAAAAAGCAGGCTATGGTGAGCAAGGGCGAGGAGCTGT 3 ' (line place is the MluI restriction enzyme site, SEQ ID NO:43)
P60:AGGAAAAAA GCGGCCGCGGGGACCACTTTGTACAAGAAAGCTGGGTTTACTTGTACAGCTCGTCCATGCCG 5 ' (line place is the NotI restriction enzyme site, SEQ ID NO:44)
AttP1, attP2 fragment and the TK fragment that PCR is gone out according to the cloning process of embodiment 2 inserts to construct in M02 (Guangzhou?FulenGen?Co., Ltd.) carrier and detects carrier attP-and stop.Detect carrier attB-EGFP with constructing in attB-EGFP fragment access M07 (Guangzhou?FulenGen?Co., Ltd.) carrier.
II. experimental result and analysis
Detect the structure of carrier pIBP
In order to detect Gateway recombination system functional in mammalian cell, we have designed the detection carrier pIBP of a BP reaction.Its structure as shown in figure 12, we reach a segment table at terminator sequence (polyA) and are placed between EGFP albumen and the promotor CMV, if take place that BP reacts then terminator sequence is stripped from, EGFP albumen obtains expressing.
The validity of vitro detection pIBP carrier
In order further to detect the pIBP carrier in external validity, we utilize existing Gateway reaction kit (reactivation gene) that pIBP is recombinated external, and detect.Detection method such as Figure 13 utilize the method for PCR to judge whether pIBP recombinates.We find as a result, and the pIBP carrier of structure is at external can effectively recombinate (Figure 14).
The reorganization system of oInt mediation detects in embodiment 3. cells
I. experimental technique and step
Cell counting is carried out in utilization focusing altogether
24 hours Hela cell after the transfection is carried out cell dyeing and fixing according to the method for 2.2.3.5.Utilize Laser Scanning Confocal Microscope to take pictures after fixing 24 hours.The per-cent that the cell of expressing green fluorescence accounts for total cell is observed in 10 visuals field of picked at random.Carry out statistical study at last.
II. experimental result and analysis
Utilize the EGFP fluorescence intensity to detect the oInt recombination efficiency
Utilize oInt albumen to attempt setting up the BP recombining reaction.At first, with pIPB detect plasmid with the oInt cotransfection in the 293T cell, judge the transfection efficiency (Figure 15) of pIBP according to the expression amount of EGFP.We find that the fluorescence intensity of EGFP increases to some extent along with the increasing of oInt transfection amount.But, after reaching 1: 1, the two ratio increases the transfection amount of oInt again, and DeGrain is so the ratio that we all adopted 1: 1 in the experiment is afterwards carried out transfection to pIBP and oInt.
Utilize the recombining reaction verity of PCR method checking oInt mediation
In order further to confirm the reorganization of pIPB, our geometric ratio transfection pIBP and oInt, and extracted the DNA of cell adopts method in the experiment of vitro detection pIBP validity to carry out PCR and detects.
The result as shown in figure 16, this result shows: the BP recombining reaction has taken place in pIBP carrier really, we can see the fragment of a 300bp effect by PCR, the same Figure 13 of inspection principle.
Utilizing the characteristic of the burnt technology for detection oInt mediation of copolymerization is the recombination efficiency of recombining reaction in the Hela cell
Since the EGFP fluorescence intensity that FL600 records after the transfection a little less than, in order better to calculate and measure the recombination efficiency of oInt mediation, utilized common focusing in conjunction with Cytometric method, the more accurate BP that recorded is reflected at recombination efficiency (Figure 17) in the Hela cell.The cell that every hole fixes has utilized the Laser Scanning Confocal Microscope random shooting photo in 10 different visuals field.The ratio that accounts for total cell count (DAPI dyeing, blueness) according to expression EGFP cell (green) in the photo is represented the recombination efficiency (Figure 18) that BP reacts.
The above results shows: mediated the BP recombining reaction that detects carrier pIBP really at the oInt of Hela cell inner expression.The cell of the expressing EGFP BP recombining reaction that promptly has been successful carrying out has only the expression that EGFP is arranged in the cell (swimming lane 3) of transfection oInt, and only the cell of transfection pIBP (swimming lane 2) does not then have.
For the better verity of proof BP reorganization, our transfection have only the detection carrier pIP (Figure 19) in attP1 site.And further detecting the Hela cell BP reorganization stability of oInt mediation, we have compared after the transfection 24 hours and the situation (Figure 19) of 48 hours expression EGFP cells.Equally, utilize above-mentioned method for cell count to measure the recombination efficiency (Figure 20) of BP reaction, when finding 48h, the cell quantity of expressing EGFP does not have too many minimizing, and this illustrates the non-reversibility of the BP reaction that oInt mediates and recombinant expressed stability to a certain extent.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Reference
1.Killy TIG such as NJ, 1993,9 (12); 412-421.
2.Trinh KR etc., Journal of Immunological Methods, 200,244910:185-193.
3.Huang CF etc., Chinese Science Bulletin, 2001,46 (4): 265-271.
4.Ruff CG etc., Pharmacology﹠amp; Therapeutics, 2007,113 (3): 619-634.
5.Lewandoski?M，Nat?Rev?Genet，2001，2(10)：743-755.
6.Berton O etc., Seience, 2006,311 (5762): 864-868.
7.Hnasko TS etc., Proc Natl Acad Sci USA, 2006,103 (23): 8858-8863.
8.Testa G etc., Embo Rep, 200,1 (2): 120-121.
9.Fraser M.J. etc., J.Virol., 1983,47 (2): 287-300.
10.Cary L.C. etc., Virology, 1989,172 (1): 156～169.
11.Handler?A.M.，Mol.Biol.，2002.32(10)：1211-1220.
12.Sarkar A. etc., Mol.Genet.Genom., 2003.270 (2): 173～180.
13.Keith J.H. etc., BMC Mol.Biol., 2008,9 (1): 73.
14.O ' Brochta D A etc., Insect Biochem.Molecular.Biol, 1996,26 (8～9): 739-753.
15.Elick T A etc., Mol Gen Genetic, 1977, (255): 605～610.
16.Bauser C A etc., Insect Mol Biol, 1999,8 (2): 223～230.
17.Elick T A etc., Genetica, 1996, (97): 127～139.
18.Lobo N etc., Mol Gen Genetic, 1999 (261): 803～810.
19.Fraser M J etc., J.Insect Mol.Bio., 1996, (5): 141～151.
20.Ivics Z. etc., Cell.1997.91:501-510.
21.WuSCY etc., Proc Natl Acad Sci USA, 2006.103:15008.15013.
22.Geurts A M etc., Mol Ther.2003,8:108-117.
23.Izsvak Z etc., J Mol Biol, 2000,302:93.102.
24.Fischer S E J etc., Proc Nail Acad Sci USA.2001.98:6759-676.
25.Geurts A M etc., PLoS Genet.2006.2:e156.
26.Sheng Ding etc., Cell.2005.122:473-483.
27.Bradley CK etc., Genesis, 2007,45 (3): 145-151.
Sequence table
＜110〉Shanghai Inst. of Life Science, CAS
＜120〉in mammalian cell, carry out the method and system that locus specificity is recombinated
<130>101843
<160>44
<170>PatentIn?version?3.3
 
<210>1
<211>1071
<212>DNA
＜213〉artificial sequence
<220>
<221>CDS
<222>(1)..(1071)
 
<400>1
atg?ggg?cga?aga?aga?tcc?cac?gag?cgc?aga?gac?ctc?cca?ccc?aac?ctg 48
Met?Gly?Arg?Arg?Arg?Ser?His?Glu?Arg?Arg?Asp?Leu?Pro?Pro?Asn?Leu
1 5 10 15
tac?atc?aga?aac?aac?ggc?tat?tac?tgc?tac?agg?gac?ccc?aga?acc?ggc 96
Tyr?Ile?Arg?Asn?Asn?Gly?Tyr?Tyr?Cys?Tyr?Arg?Asp?Pro?Arg?Thr?Gly
20 25 30
aag?gag?ttc?ggc?ctg?ggc?cgg?gac?agg?aga?att?gcc?att?aca?gag?gct 144
Lys?Glu?Phe?Gly?Leu?Gly?Arg?Asp?Arg?Arg?Ile?Ala?Ile?Thr?Glu?Ala
35 40 45
atc?cag?gct?aat?atc?gag?ctg?ttc?agc?ggg?cac?aag?cac?aag?ccc?ctg 192
Ile?Gln?Ala?Asn?Ile?Glu?Leu?Phe?Ser?Gly?His?Lys?His?Lys?Pro?Leu
50 55 60
aca?gcc?aga?atc?aac?agc?gac?aac?agc?gtg?acc?ctg?cat?tcc?tgg?ctg 240
Thr?Ala?Arg?Ile?Asn?Ser?Asp?Asn?Ser?Val?Thr?Leu?His?Ser?Trp?Leu
65 70 75 80
gat?aga?tat?gag?aag?atc?ctg?gcc?agc?aga?ggc?atc?aag?cag?aag?acc 288
Asp?Arg?Tyr?Glu?Lys?Ile?Leu?Ala?Ser?Arg?Gly?Ile?Lys?Gln?Lys?Thr
85 90 95
ctc?atc?aac?tac?atg?agc?aag?atc?aag?gcc?atc?aga?aga?ggc?ctg?ccc 336
Leu?Ile?Asn?Tyr?Met?Ser?Lys?Ile?Lys?Ala?Ile?Arg?Arg?Gly?Leu?Pro
100 105 110
gat?gcc?ccc?ctg?gaa?gac?atc?acc?act?aag?gag?atc?gcc?gcc?atg?ctt 384
Asp?Ala?Pro?Leu?Glu?Asp?Ile?Thr?Thr?Lys?Glu?Ile?Ala?Ala?Met?Leu
115 120 125
aac?gga?tac?atc?gac?gaa?ggc?aag?gct?gcc?agt?gcc?aaa?ctg?atc?aga 432
Asn?Gly?Tyr?Ile?Asp?Glu?Gly?Lys?Ala?Ala?Ser?Ala?Lys?Leu?Ile?Arg
130 135 140
agc?acc?ctg?agc?gac?gcc?ttt?aga?gag?gct?atc?gcc?gaa?ggc?cac?atc 480
Ser?Thr?Leu?Ser?Asp?Ala?Phe?Arg?Glu?Ala?Ile?Ala?Glu?Gly?His?Ile
145 150 155 160
act?acc?aac?cac?gtg?gct?gcc?aca?aga?gcc?gcc?aag?agc?gag?gtg?aga 528
Thr?Thr?Asn?His?Val?Ala?Ala?Thr?Arg?Ala?Ala?Lys?Ser?Glu?Val?Arg
165 170 175
aga?agc?aga?ctg?acc?gct?gac?gag?tac?ctg?aag?atc?tac?cag?gcc?gcc 576
Arg?Ser?Arg?Leu?Thr?Ala?Asp?Glu?Tyr?Leu?Lys?Ile?Tyr?Gln?Ala?Ala
180 185 190
gaa?agc?agc?ccc?tgt?tgg?ctg?aga?ctg?gcc?atg?gag?ctg?gca?gtg?gtg 624
Glu?Ser?Ser?Pro?Cys?Trp?Leu?Arg?Leu?Ala?Met?Glu?Leu?Ala?Val?Val
195 200 205
acc?ggc?cag?aga?gtg?ggc?gac?ctg?tgt?gag?atg?aag?tgg?agc?gat?atc 672
Thr?Gly?Gln?Arg?Val?Gly?Asp?Leu?Cys?Glu?Met?Lys?Trp?Ser?Asp?Ile
210 215 220
gtg?gac?gga?tac?ctg?tac?gtg?gag?cag?tcc?aag?acc?ggc?gtg?aaa?atc 720
Val?Asp?Gly?Tyr?Leu?Tyr?Val?Glu?Gln?Ser?Lys?Thr?Gly?Val?Lys?Ile
225 230 235 240
gcc?atc?ccc?acg?gcc?ctg?cac?atc?gac?gcc?ctg?ggc?atc?agc?atg?aag 768
Ala?Ile?Pro?Thr?Ala?Leu?His?Ile?Asp?Ala?Leu?Gly?Ile?Ser?Met?Lys
245 250 255
gaa?act?ctg?gac?aag?tgc?aag?gag?att?ctg?ggt?ggc?gag?acc?atc?att 816
Glu?Thr?Leu?Asp?Lys?Cys?Lys?Glu?Ile?Leu?Gly?Gly?Glu?Thr?Ile?Ile
260 265 270
gcc?agc?acc?aga?cgc?gag?ccc?ctg?tcc?agc?ggc?acc?gtc?agc?aga?tac 864
Ala?Ser?Thr?Arg?Arg?Glu?Pro?Leu?Ser?Ser?Gly?Thr?Val?Ser?Arg?Tyr
275 280 285
ttc?atg?aga?gcc?aga?aag?gcc?agc?ggc?ctg?agc?ttc?gag?ggc?gac?ccc 912
Phe?Met?Arg?Ala?Arg?Lys?Ala?Ser?Gly?Leu?Ser?Phe?Glu?Gly?Asp?Pro
290 295 300
ccc?acc?ttc?cac?gaa?ttg?aga?agc?ctg?tcc?gcc?aga?ctg?tac?gag?aag 960
Pro?Thr?Phe?His?Glu?Leu?Arg?Ser?Leu?Ser?Ala?Arg?Leu?Tyr?Glu?Lys
305 310 315 320
cag?atc?tca?gac?aag?ttc?gcc?cag?cac?ctg?ctg?ggg?cac?aag?agc?gac 1008
Gln?Ile?Ser?Asp?Lys?Phe?Ala?Gln?His?Leu?Leu?Gly?His?Lys?Ser?Asp
325 330 335
acc?atg?gcg?agc?cag?tat?aga?gac?gat?aga?ggc?agg?gag?tgg?gac?aag 1056
Thr?Met?Ala?Ser?Gln?Tyr?Arg?Asp?Asp?Arg?Gly?Arg?Glu?Trp?Asp?Lys
340 345 350
att?gaa?atc?aag?tga 1071
Ile?Glu?Ile?Lys
355
<210>2
<211>356
<212>PRT
＜213〉artificial sequence
 
<400>2
Met?Gly?Arg?Arg?Arg?Ser?His?Glu?Arg?Arg?Asp?Leu?Pro?Pro?Asn?Leu
1 5 10 15
Tyr?Ile?Arg?Asn?Asn?Gly?Tyr?Tyr?Cys?Tyr?Arg?Asp?Pro?Arg?Thr?Gly
20 25 30
Lys?Glu?Phe?Gly?Leu?Gly?Arg?Asp?Arg?Arg?Ile?Ala?Ile?Thr?Glu?Ala
35 40 45
Ile?Gln?Ala?Asn?Ile?Glu?Leu?Phe?Ser?Gly?His?Lys?His?Lys?Pro?Leu
50 55 60
Thr?Ala?Arg?Ile?Asn?Ser?Asp?Asn?Ser?Val?Thr?Leu?His?Ser?Trp?Leu
65 70 75 80
Asp?Arg?Tyr?Glu?Lys?Ile?Leu?Ala?Ser?Arg?Gly?Ile?Lys?Gln?Lys?Thr
85 90 95
Leu?Ile?Asn?Tyr?Met?Ser?Lys?Ile?Lys?Ala?Ile?Arg?Arg?Gly?Leu?Pro
100 105 110
Asp?Ala?Pro?Leu?Glu?Asp?Ile?Thr?Thr?Lys?Glu?Ile?Ala?Ala?Met?Leu
115 120 125
Asn?Gly?Tyr?Ile?Asp?Glu?Gly?Lys?Ala?Ala?Ser?Ala?Lys?Leu?Ile?Arg
130 135 140
Ser?Thr?Leu?Ser?Asp?Ala?Phe?Arg?Glu?Ala?Ile?Ala?Glu?Gly?His?Ile
145 150 155 160
Thr?Thr?Asn?His?Val?Ala?Ala?Thr?Arg?Ala?Ala?Lys?Ser?Glu?Val?Arg
165 170 175
Arg?Ser?Arg?Leu?Thr?Ala?Asp?Glu?Tyr?Leu?Lys?Ile?Tyr?Gln?Ala?Ala
180 185 190
Glu?Ser?Ser?Pro?Cys?Trp?Leu?Arg?Leu?Ala?Met?Glu?Leu?Ala?Val?Val
195 200 205
Thr?Gly?Gln?Arg?Val?Gly?Asp?Leu?Cys?Glu?Met?Lys?Trp?Ser?Asp?Ile
210 215 220
Val?Asp?Gly?Tyr?Leu?Tyr?Val?Glu?Gln?Ser?Lys?Thr?Gly?Val?Lys?Ile
225 230 235 240
Ala?Ile?Pro?Thr?Ala?Leu?His?Ile?Asp?Ala?Leu?Gly?Ile?Ser?Met?Lys
245 250 255
Glu?Thr?Leu?Asp?Lys?Cys?Lys?Glu?Ile?Leu?Gly?Gly?Glu?Thr?Ile?Ile
260 265 270
Ala?Ser?Thr?Arg?Arg?Glu?Pro?Leu?Ser?Ser?Gly?Thr?Val?Ser?Arg?Tyr
275 280 285
Phe?Met?Arg?Ala?Arg?Lys?Ala?Ser?Gly?Leu?Ser?Phe?Glu?Gly?Asp?Pro
290 295 300
Pro?Thr?Phe?His?Glu?Leu?Arg?Ser?Leu?Ser?Ala?Arg?Leu?Tyr?Glu?Lys
305 310 315 320
Gln?Ile?Ser?Asp?Lys?Phe?Ala?Gln?His?Leu?Leu?Gly?His?Lys?Ser?Asp
325 330 335
Thr?Met?Ala?Ser?Gln?Tyr?Arg?Asp?Asp?Arg?Gly?Arg?Glu?Trp?Asp?Lys
340 345 350
Ile?Glu?Ile?Lys
355
<210>3
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>3
atggggcgaa?gaagatccca?cgagcgcaga?gacctcccac?ccaacctgta?catcagaaa 59
<210>4
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>4
ctccttgccg?gttctggggt?ccctgtagca?gtaatagccg?ttgtttctga?tgtacaggt 59
<210>5
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>5
cagaaccggc?aaggagttcg?gcctgggccg?ggacaggaga?attgccatta?cagaggcta 59
<210>6
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>6
ggcttgtgct?tgtgcccgct?gaacagctcg?atattagcct?ggatagcctc?tgtaatggc 59
<210>7
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>7
ggcacaagca?caagcccctg?acagccagaa?tcaacagcga?caacagcgtg?accctgcat 59
<210>8
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>8
tgcctctgct?ggccaggatc?ttctcatatc?tatccagcca?ggaatgcagg?gtcacgctg 59
<210>9
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>9
ctggccagca?gaggcatcaa?gcagaagacc?ctcatcaact?acatgagcaa?gatcaaggc 59
<210>10
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>10
ggtgatgtct?tccagggggg?catcgggcag?gcctcttctg?atggccttga?tcttgctca 59
<210>11
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>11
cctggaagac?atcaccacta?aggagatcgc?cgccatgctt?aacggataca?tcgacgaag 59
<210>12
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>12
tcgctcaggg?tgcttctgat?cagtttggca?ctggcagcct?tgccttcgtc?gatgtatcc 59
<210>13
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>13
gaagcaccct?gagcgacgcc?tttagagagg?ctatcgccga?aggccacatc?actaccaac 59
<210>14
<211>59
<212>DNA
＜213〉artificial sequence
<400>14
ttcttctcac?ctcgctcttg?gcggctcttg?tggcagccac?gtggttggta?gtgatgtgg 59
<210>15
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>15
agcgaggtga?gaagaagcag?actgaccgct?gacgagtacc?tgaagatcta?ccaggccgc 59
<210>16
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>16
tgccagctcc?atggccagtc?tcagccaaca?ggggctgctt?tcggcggcct?ggtagatct 59
<210>17
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>17
ggccatggag?ctggcagtgg?tgaccggcca?gagagtgggc?gacctgtgtg?agatgaagt 59
<210>18
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>18
ttggactgct?ccacgtacag?gtatccgtcc?acgatatcgc?tccacttcat?ctcacacag 59
<210>19
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>19
acgtggagca?gtccaagacc?ggcgtgaaaa?tcgccatccc?cacggccctg?cacatcgac 59
<210>20
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>20
ccttgcactt?gtccagagtt?tccttcatgc?tgatgcccag?ggcgtcgatg?tgcagggcc 59
<210>21
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>21
ctggacaagt?gcaaggagat?tctgggtggc?gagaccatca?ttgccagcac?cagacgcga 59
<210>22
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>22
ggctctcatg?aagtatctgc?tgacggtgcc?gctggacagg?ggctcgcgtc?tggtgctgg 59
<210>23
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>23
atacttcatg?agagccagaa?aggccagcgg?cctgagcttc?gagggcgacc?cccccacct 59
<210>24
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>24
tgcttctcgt?acagtctggc?ggacaggctt?ctcaattcgt?ggaaggtggg?ggggtcgcc 59
<210>25
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>25
gactgtacga?gaagcagatc?tcagacaagt?tcgcccagca?cctgctgggg?cacaagagc 59
<210>26
<211>82
<212>DNA
＜213〉artificial sequence
 
<400>26
tcacttgatt?tcaatcttgt?cccactccct?gcctctatcg?tctctatact?ggctcgccat 60
ggtgtcgctc?ttgtgcccca?gc 82
<210>27
<211>34
<212>DNA
＜213〉artificial sequence
 
<400>27
caattcgaaa?tggggcgaag?aagatcccac?gagc 34
<210>28
<211>41
<212>DNA
＜213〉artificial sequence
 
<400>28
ataagaatgc?ggccgccttg?atttcaatct?tgtcccactc?c 41
<210>29
<211>27
<212>DNA
＜213〉artificial sequence
 
<400>29
tcgcctagct?agcaaataat?gatttta 27
<210>30
<211>29
<212>DNA
＜213〉artificial sequence
 
<400>30
cacgcggatc?ctacaggtca?ctaatacca 29
<210>31
<211>50
<212>DNA
＜213〉artificial sequence
 
<400>31
cgcgcggatc?cttgggatct?ttgtgaagga?accttacttc?tgtggtgtga 50
<210>32
<211>59
<212>DNA
＜213〉artificial sequence
 
<400>32
atgcatccat?ggttgtggcc?agcctgcttt?tttgtacaaa?cttgttggaa?ccctaaagg 59
<210>33
<211>31
<212>DNA
＜213〉artificial sequence
 
<400>33
atgcatccat?ggttgtgggg?aaccctaaag?g 31
<210>34
<211>28
<212>DNA
＜213〉artificial sequence
 
<400>34
tcgcctagct?agcaataatc?attttatt 28
<210>35
<211>21
<212>DNA
＜213〉artificial sequence
 
<400>35
caatcctttc?ttataatccc?a 21
<210>36
<211>21
<212>DNA
＜213〉artificial sequence
 
<400>36
tgggattata?agaaaggatt?g 21
<210>37
<211>51
<212>DNA
＜213〉artificial sequence
 
<400>37
ccggaattcc?aaataatgat?tttattttga?ctgatagtga?cctgttcgtt?g 51
<210>38
<211>49
<212>DNA
＜213〉artificial sequence
 
<400>38
ctagctcgag?ccttatcatc?tagatacagg?tcactaatac?catctaagt 49
<210>39
<211>35
<212>DNA
＜213〉artificial sequence
 
<400>39
ctagctcgag?tacaggtcac?taataccatc?taagt 35
<210>40
<211>41
<212>DNA
＜213〉artificial sequence
 
<400>40
ataagaatgc?ggccgccaaa?taatgatttt?attttgactg?a 41
<210>41
<211>34
<212>DNA
＜213〉artificial sequence
 
<400>41
ccgtctagaa?tggcttcgta?cccctgccat?caac 34
<210>42
<211>35
<212>DNA
＜213〉artificial sequence
 
<400>42
ctagctcgag?tcagttagcc?tcccccatct?cccgg 35
<210>43
<211>62
<212>DNA
＜213〉artificial sequence
 
<400>43
ttaccgacgc?gtacaagttt?gtacaaaaaa?gcaggctatg?gtgagcaagg?gcgaggagct 60
gt 62
<210>44
<211>71
<212>DNA
＜213〉artificial sequence
 
<400>44
aggaaaaaag?cggccgcggg?gaccactttg?tacaagaaag?ctgggtttac?ttgtacagct 60
cgtccatgcc?g 71

Claims (10)

1. the integrase gene that can in Mammals, express, it is selected from down group:
(a) nucleotide sequence that constitutes by the sequence shown in the SEQ ID NO:1;
(b) have the nucleotide sequence shown in the SEQ ID NO:1, and can in Mammals, express and mediate the nucleotide sequence of locus specificity reorganization;
(c) under stringent condition with (a) or the nucleotide sequence hybridization that (b) is limited, and can in Mammals, express and mediate the nucleotide sequence that locus specificity is recombinated; Or
(d) with (a)-(c) in nucleotide sequence complementary nucleotide sequence that each limited.
2. integrase gene as claimed in claim 1 is characterized in that, described gene is the nucleotide sequence that is made of the sequence shown in the SEQ ID NO:1.
3. the intergrase that can express in Mammals is characterized in that, described intergrase is selected from down group:
(i) by the coded aminoacid sequence of the described integrase gene of claim 1;
(ii) process replaces, lacks or adds one or several amino acid in the aminoacid sequence that (i) limits, and can mediate the aminoacid sequence of locus specificity reorganization in Mammals; Or
(iii) (i) or (ii) described in conservative property variation polypeptide or its active fragments or its reactive derivative of aminoacid sequence.
4. intergrase as claimed in claim 3 is characterized in that, described intergrase is made of the aminoacid sequence shown in the SEQ ID NO:2.
5. carrier, described carrier comprises the described gene of claim 1.
6. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 5.
7. one kind is carried out the method that locus specificity is recombinated in mammalian cell, and described method comprises:
(A) the described integrase gene of claim 1 is changed in the mammalian cell, or the described intergrase of claim 3 is imported in the mammalian cell;
(B) under the condition that is fit to the locus specificity reorganization, cultivate described mammalian cell.
8. method as claimed in claim 7 is characterized in that, described integrase gene is the nucleotide sequence shown in the SEQ ID NO:1.
9. method as claimed in claim 7 is characterized in that, described intergrase is the aminoacid sequence shown in the SEQ ID NO:2.
10. method as claimed in claim 7 is characterized in that, described Mammals is selected from: people, rat, mouse, dog, monkey, pig, horse, ox or sheep.
CN 201010159522 2010-04-29 2010-04-29 Method and system for performing site-specific recombination in mammalian cells Pending CN102234656A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 201010159522 CN102234656A (en) 2010-04-29 2010-04-29 Method and system for performing site-specific recombination in mammalian cells

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 201010159522 CN102234656A (en) 2010-04-29 2010-04-29 Method and system for performing site-specific recombination in mammalian cells

Publications (1)

Publication Number Publication Date
CN102234656A true CN102234656A (en) 2011-11-09

Family

ID=44885782

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 201010159522 Pending CN102234656A (en) 2010-04-29 2010-04-29 Method and system for performing site-specific recombination in mammalian cells

Country Status (1)

Country Link
CN (1) CN102234656A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105985944A (en) * 2015-01-29 2016-10-05 中国科学院生物物理研究所 Novel method of intracellular site-specific covalent RNA labeling
CN111487399A (en) * 2020-03-26 2020-08-04 湖南师范大学 Application of protein molecular marker in research on fish germ cell development
CN116286982A (en) * 2022-09-09 2023-06-23 广州凯普医药科技有限公司 HPV genotyping detection positive reference, preparation method and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1717489A (en) * 2002-11-28 2006-01-04 贝林格尔英格海姆法玛两合公司 Sequence specific DNA recombination in eukaryotic cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1717489A (en) * 2002-11-28 2006-01-04 贝林格尔英格海姆法玛两合公司 Sequence specific DNA recombination in eukaryotic cells

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
《Journal of Molecular Biology》 20000310 Elke Lorbach et al. Site-specific Recombination in Human Cells Catalyzed by Phage lambda Integrase Mutants 1175-1181 1-10 第296卷, 第5期 *
《Journal of Molecular Biology》 20020531 Nicole Christ et al. Site-specific Recombination in Eukaryotic Cells Mediated by Mutant lambda Integrases: Implications for Synaptic Complex Formation and the Reactivity of Episomal DNA Segments 305-314 1-10 第319卷, 第2期 *
《NCBI Accession NO.NP_040609 》 20000403 Chen,C.Y. et al. integration protein [Enterobacteria phage lambda] 全文 1-10 , *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105985944A (en) * 2015-01-29 2016-10-05 中国科学院生物物理研究所 Novel method of intracellular site-specific covalent RNA labeling
CN105985944B (en) * 2015-01-29 2019-05-28 中国科学院生物物理研究所 A kind of new method of intracellular site specific covalent labeled RNA
CN111487399A (en) * 2020-03-26 2020-08-04 湖南师范大学 Application of protein molecular marker in research on fish germ cell development
CN111487399B (en) * 2020-03-26 2021-09-17 湖南师范大学 Application of protein molecular marker in research on fish germ cell development
CN116286982A (en) * 2022-09-09 2023-06-23 广州凯普医药科技有限公司 HPV genotyping detection positive reference, preparation method and application thereof
CN116286982B (en) * 2022-09-09 2024-01-30 广州凯普医药科技有限公司 HPV genotyping detection positive reference, preparation method and application thereof

Similar Documents

Publication Publication Date Title
US8598328B2 (en) Tol1 factor transposase and DNA introduction system using the same
Takasu et al. Efficient TALEN construction for Bombyx mori gene targeting
CN105142669B (en) Genomic modification and regulation and control based on CRISPR
KR20220032050A (en) rigged CASX system
JP5841996B2 (en) Use of endogenous promoters to express heterologous proteins
CN109804066A (en) Programmable CAS9- recombination enzyme fusion proteins and application thereof
WO2018226855A1 (en) Engineered crispr-cas9 nucleases
Zhang et al. Myomaker is required for the fusion of fast-twitch myocytes in the zebrafish embryo
CA2667974A1 (en) Chimeric zinc finger recombinases optimized for catalysis by directed evolution
CN102344494A (en) Nicotinamide adenine dinucleotide gene coding fluorescent probe as well as preparation method and application thereof
EP3535394B1 (en) Dna plasmids for the fast generation of homologous recombination vectors for cell line development
CN104910276A (en) Gene encoded nicotinamide adenine dinucleotide phosphate fluorescent probe, preparation method and application thereof
CN102234656A (en) Method and system for performing site-specific recombination in mammalian cells
KR20220024527A (en) Systems and methods for double recombinase-mediated cassette exchange (dRMCE) in vivo and their disease models
US9102750B2 (en) Branchiostoma derived fluorescent proteins
CN105524175A (en) Gene encoding hydrogen peroxide fluorescent probe, preparation method and applications thereof
CN102653771B (en) Expression vector of fused protein of glutamine transporter 1 as well as construction method and application thereof
US20230193322A1 (en) CAS9 Fusion Proteins and Related Methods
Spencer et al. Definitive localization of intracellular proteins: Novel approach using CRISPR-Cas9 genome editing, with glucose 6-phosphate dehydrogenase as a model
JP6956995B2 (en) Genome editing method
Gil et al. Functional characterization of the human mariner transposon Hsmar2
TWI515203B (en) Nuclear localization signal peptides derived from vp2 protein of chicken anemia virus and uses of said peptides
CN108659110B (en) Improved red fluorescent protein and application thereof
KR20130069188A (en) Zinc finger nuclease for targeting myostatin and use thereof
AU2008334910A1 (en) Method of generating RHO 0 cells

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20111109