CN102229907A

CN102229907A - Pseudomonas engineering bacteria generating doxorubicin

Info

Publication number: CN102229907A
Application number: CN2011100567719A
Authority: CN
Inventors: 廖志勇; 杨小芳
Original assignee: BEIJING SAINUO BAIAO BIOLOGICAL TECHNOLOGY CO LTD
Current assignee: BEIJING SAINUO BAIAO BIOLOGICAL TECHNOLOGY CO LTD
Priority date: 2011-03-09
Filing date: 2011-03-09
Publication date: 2011-11-02

Abstract

The invention provides a pseudomonas engineering bacteria generating doxorubicin. A dnrH gene, a dnrX gene and a dnrU gene in a doxorubicin biosynthesizing gene cluster from a streptomyces peucetius ATCC 29050 are deleted, and a Pm promoter from a pseudomonas is inserted in front of a doxA gene coding an oxidoreductase. Then, the reconstructed gene cluster and a screening marker gene are together integrated into a genome of a pseudomonas putida KT2440 to construct the pseudomonas engineering bacteria. The invention lays foundations for heterogenous expression and large-scale industrialized production of doxorubicin, and has a wide application value.

Description

Produce the false unit cell engineering bacteria of Zorubicin

Technical field

The present invention relates to the genetically engineered field, specifically, relate to a kind of false unit cell engineering bacteria that produces Zorubicin.

Background technology

Zorubicin and daunomycin are anthracycline antibiotics, are cancer therapy drugs commonly used clinically.Zorubicin has another name called the 14-doxorubicin, is 4 ' position hydroxylation derivative of promise osamine in road in the promise rhzomorph structure.Zorubicin and Dao Nuo rhzomorph structural similitude, so mechanism of action is also identical.Yet Zorubicin is compared with road promise rhzomorph, and the curative effect of same dose is stronger, and toxic side effect is lower, and does not have crossing drug resistant, and antitumor spectrum is wider than road promise rhzomorph, makes it that higher using value be arranged, and becomes at present one of most widely used antitumor drug clinically.When treatment Zorubicin often and other chemotherapeutics cytosine arabinoside for example, vincristine(VCR), ametycin etc. merge and use with the increase curative effect.

Zorubicin biological synthesis gene cluster size is 41313bp altogether, and doxA genes encoding oxydo-reductase wherein is responsible for promise rhzomorph in road is carried out the biosynthesizing step that hydroxylation obtains Zorubicin.Because the imperfection of DoxA katalysis makes the bacterial strain that contains the Zorubicin biological synthesis gene cluster, for example streptomycete Streptomyces peucetius ATCC 29050 produces Zorubicin and Dao Nuo rhzomorph simultaneously.The production of adopting S.peucetius ATCC 29050 to carry out Zorubicin comes with some shortcomings, for example thalli growth speed slow (nearly 48 hours of the doubling time of thalline), the difficult cultivation (need the strict environment that is rich in oxygen, and need fully to stir so that the thalline mixing) and genetic breeding difficulty carry out that (bacterial strain is a gram-positive microorganism, cell walls is thicker, and mutagenic compound are difficult to bring into play effect) etc.These factors are restricting the effective development and application to Zorubicin.In recent years, the heterogenous expression of secondary metabolite biological synthesis gene cluster becomes the effective means that improves compound output or transform compound targetedly.

In heterogenous expression host's selection, because the use of the actinomycetes codon of pseudomonas and microbiotic main source is close, posttranslational modification is arranged, safety non-toxic (as type strain pseudomonas putida Pseudomonas putida KT2440), growth fast, advantages such as the secondary metabolite background is clear become one of first-selected host bacterium.The heterogenous expression that carries out biological synthesis gene cluster therein has good application potential.

Summary of the invention

The false unit cell engineering bacteria that the purpose of this invention is to provide a kind of high yield Zorubicin.

Another object of the present invention provides the application of above-mentioned false unit cell engineering bacteria in producing Zorubicin.

In order to realize the object of the invention, a kind of false unit cell engineering bacteria that produces Zorubicin of the present invention, it is the Pm promotor of inserting with dnrH, dnrX in the Zorubicin biological synthesis gene cluster and dnrU gene elmination and before the doxA gene of coding oxydo-reductase from pseudomonas, then improved gene cluster is integrated in the genome of pseudomonas putida (Pseudomonas putida) KT2440 and obtains.

Aforesaid engineering bacteria, wherein said Zorubicin biological synthesis gene cluster derive from streptomycete (Streptomyces peucetius) ATCC 29050.

Aforesaid engineering bacteria, improved gene cluster are to be integrated in the genome of pseudomonas putida (Pseudomonas putida) KT2440 with the selection markers gene.

Aforesaid engineering bacteria, to be the Zorubicin biological synthesis gene cluster that will transform be integrated into the zone between the trpE gene and trpC in the pseudomonas putida KT2440 genome and obtain with the selection markers gene for it.

Wherein, trpE gene and trpC gene encode respectively o-amino benzoyl acid synthase component I and indoles-3-glycerol-3-phosphate synthetic enzyme, be to be PP_0418, PP_0419, trpG and trpD gene between trpE and the trpC between trpE gene and trpC gene, their lipase of encoding respectively, 32 the amino acid whose unknown polypeptide of encoding, anthranilate synthase component I I and anthranilate phosphoribosyl transferase.These genes participate in the biosynthesizing of anthranilic acid, are nonessential gene, promptly remove physiology and biochemical function that they do not influence bacterial strain.

Aforesaid engineering bacteria, described selection markers gene are kalamycin resistance gene or gentamicin resistant gene.

Aforesaid engineering bacteria, to be the Zorubicin biological synthesis gene cluster that will transform be integrated into the zone between the trpE gene and trpC in the pseudomonas putida KT2440 genome and obtain with kalamycin resistance gene for it.

Aforesaid engineering bacteria, it is pseudomonas putida (Pseudomonas putida) Sino-HDR, now be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, BeiChen West Road, Chaoyang District, BeiJing City, address institute of microbiology of the Chinese Academy of Sciences, preserving number CGMCC NO.4638, preservation date on March 7th, 2011.The cultural method of this project bacterium is: described engineering bacteria is inoculated in the LB substratum, cultivates under 30 ℃.

The present invention also provides the application of above-mentioned engineering bacteria in producing Zorubicin, and it is that described engineering bacteria is carried out fermentation culture, and separation and purification obtains the target product Zorubicin from fermented liquid then.

The present invention is by engineered method, to derive from dnrH, dnrX and dnrU gene elmination in the Zorubicin biological synthesis gene cluster of streptomycete (Streptomycespeucetius) ATCC 29050 and before the doxA gene of coding oxydo-reductase, insert Pm promotor, and improved gene cluster will be integrated in the genome of pseudomonas putida (Pseudomonas putida) KT2440 with the selection markers gene make up the false unit cell engineering bacteria that obtains the high yield Zorubicin then from pseudomonas.Wherein, Sino-HDR ferments to pseudomonas putida, and tunning detects through high performance liquid chromatography (HPLC) and shows: Zorubicin output is 3.51 μ g/ml, and road promise rhzomorph output is 0.85 μ g/ml.And not carrying out dnrH, the Zorubicin that the pseudomonas putida Sino-DNDR of dnrX and dnrU gene elmination and doxA high expression level (preserving number CGMCC NO.4637) fermentation obtains and the output of Dao Nuo rhzomorph are respectively 2.34 μ g/ml and 3.01 μ g/ml.As seen in pseudomonas putida Sino-HDR bacterial strain, the output of Zorubicin significantly improves.Obtained strains also can be by optimization of fermentation conditions and target compound separation and the output that improves Zorubicin further such as purification step, reach the purpose of large-scale industrial production, so the present invention's value that has a wide range of applications.

Description of drawings

Fig. 1 is that the improved Zorubicin biological synthesis gene cluster of the present invention is integrated into the synoptic diagram in the P.putidaKT2440 genome, wherein: doxE-dnrM represents the dnrM gene fragment that replaced by the doxE gene fragment, Δ dnrH, Δ dnrX and Δ dnrU represent dnrH, knocking out of these three genes of dnrX and dnrU, xylS-Pm-doxA represents that the doxA gene places under the effect of Pm promotor, xylS is a regulatory gene of regulating the Pm promoter expression, bla is an ampicillin resistance gene, sacB is a 6-fructosyl transferase gene, oriT is in conjunction with shifting fragment, trpE is the o-amino benzoyl acid synthase component I gene of encoding respectively, kan is a kalamycin resistance gene, trpC is indoles-3-glycerol-3-phosphate synthase gene, gph is a phosphoric acid ethanol phosphatase gene, PP_0418 is the gene of coding lipase, PP_0419 is the gene of unknown polypeptide, trpG is an anthranilate synthase component I I gene, trpD is the anthranilate phosphoribosyl transferase gene, PP_0423 is the gene of unknown function, DE1, DE2, DE3 and DE4 are the designed PCR primer of checking P.putidaSino-HDR genotype.

Fig. 2 is the agarose gel electrophoresis figure of P.putida Sino-HDR strain gene type analysis of the present invention, and wherein: M represents DL2000DNAMarker, and 1 is the 1.2kb of DE1 and DE2 primer amplification, and 2 is the 1.2kb of DE3 and DE4 primer amplification.

Fig. 3 is high performance liquid chromatography (HPLC) analytical results of P.putida Sino-HDR strain fermentation product of the present invention, wherein: A is promise rhzomorph and Zorubicin standard substance, B is the tunning of P.putidaSino DNDR bacterial strain, and C is the tunning of P.putida Sino-HDR bacterial strain.

Embodiment

Following examples are used to illustrate the present invention, but are not used for limiting the scope of the invention.

The term that uses in following examples unless other explanation is arranged, generally has the implication of those of ordinary skills' common sense.

In following examples, various processes of Xiang Ximiaoshuing and method are not ordinary methods as known in the art, the source of agents useful for same, trade(brand)name and being necessary listed its moiety, all when occurring first, indicate, thereafter used identical reagent if no special instructions, and is all identical with the content of indicating first.

Bacterial strain that uses in following examples and plasmid are disclosed bacterial strain and plasmid:

1.Escherichia?coli?DH10B。Genotype F-mcrA (mrr-hsdRMS-mcrBC) 80 dlacZ M15 lacX74 deoR recA1araD139 (ara, leu) 7697 galU galK rpsL endA1 nupG.Document: LifeTechnologies, Inc.Focus, 1990,12:19.Available from American I nvitrogen company.

2.E.coli?HB101/pRK2073。Document: Marx CJ, Lidstrom ME.evelopment of improved versatile broad-host-range vectors for use inmethylotrophs and other Gram-negative bacteria.icrobiology.2001,147 (8): 2065-75.Provide by Mary professor Lidstrom of Washington, DC university.

3.P.putida?KT2440。Document: Nelson KE, Weinel C, Paulsen IT etc., Complete genome sequence and comparative analysis of themetabolically versatile Pseudomonas putida KT2440.Environ Microbiol 2002,4:799-808.Provide by Karen doctor Nelson of U.S. Joint Genome Institute.

4.S.peucetius?ATCC?29050。Document: Otten SL, Stutzman-Engwall KJ, Hutchinson CR.Cloning and expression of daunorubicin biosynthesisgenes from Streptomyces peucetius and S.peucetius subsp.caesius.JBacteriol.1990,172 (6): 3427-34.Provide by professor C.RichardHutchinson of Univ Wisconsin-Madison USA.

5.pBluescript?II?KS(-)。Document: Alting-Mees MA, Short JM.pBluescript II:gene mapping vectors.Nucleic Acids Res, 1989,17:9494.Available from U.S. Novagen company.

6.pBAD322 and pBAD322C.Document: Cronan JE.A family ofarabinose-inducible Escherichia coli expression vectors having pBR322copy control.Plasmid 2006,55 (2): 152-7.Provide by U.S. professor JohnCronan of University of Illinois.

7.pKD4。Document: Datsenko KA, Wanner BL.One-step inactivation ofchromosomal genes in Escherichia coli K-12 using PCR products.ProcNatl Acad Sci USA.2000,97 (12): 6640-5.Releasing professor BarryWanner of university from sufferings by the U.S. provides.

8.pMOD4-RT。Document: Zhang Y, Nash L, Fisher AL.A simplified, robust, and streamlined procedure for the production of C.eleganstransgenes via recombineering.BMC Dev Biol.2008; 8:119.Provide by Alfred professor Fisher of Univ. of Pittsburgh.

9.pEX100Tlink。Document: Quenee L, Lamotte D, Polack B.CombinedsacB-based negative selection and cre-lox antibiotic marker recycling forefficient gene deletion in pseudomonas aeruginosa.Biotechniques.2005,38 (1): 63-7.Benoit professor Polack by French Centre Hospitalier Universitaire provides.

10.pBBR1MCS-1。Document: Kovach ME, Elzer PH, Hill DS etc., Fournew derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes.Gene.1995,166 (1): 175-6.Upright Michael professor Kovach of university provides by United States Louisiana.

11.pJB861。Document: Blatny JM, Brautaset T, Winther-Larsen HC etc., Improved broad-host-range RK2 vectors useful for high and lowregulated gene expression levels in gram-negative bacteria.Plasmid.1997,38 (1): 35-51.Provide by Norway Norwegian University of Science and Technology Svein professor Valla of university.

12.pJB861 it is U82000 that the Genbank of sequence receives number (Accession No.).

13. it is NC_002947 that the Genbank of pseudomonas putida KT2440 genome sequence receives number (Accession No.).

The structure of embodiment 1 Zorubicin biological synthesis gene cluster cloning vector

For making up the expression vector of Zorubicin biological synthesis gene cluster, it is integrated into subsequently on the P.putida KT2440 genome and expresses, carried out the transformation of low copy plasmid in succession, the clone of P.putida KT2440 genome homologous fragment, just screens and work such as negative selection markers clone the clone of Zorubicin biological synthesis gene cluster homology arm.

1. the preparation of competence intestinal bacteria DH10B and DNA transform

The single bacterium colony of the fresh streak culture intestinal bacteria DH10B of picking 37 ℃ of shaken overnight to the 2ml LB liquid nutrient medium go among the 50ml LB with 1/50 volume from flat board, and shaking culture is to thalline OD ₆₀₀Be about 0.6.Bacterium liquid is poured in the centrifuge tube of precooling, ice bath 10 minutes, 4 ℃, centrifugal 5 minutes of 5000rpm abandons supernatant.Glycerine washing precipitation twice with 10% is suspended in 10% glycerine of 200 μ l at last, every pipe packing 50 μ l.

DNA is connected in the electric transformed competence colibacillus cell that product adds to the DH10B that 50 μ l melt on ice, flick mixing.Mixed solution is transferred in the 1mm electricity revolving cup of precooling on ice, electric shock transforms.Electricity conversion condition: 1mm electricity revolving cup, 200 Ω, 1800V, the Gene PulserII of Bio-Rad company ^RThe electricity conversion instrument.Add 1ml LB liquid nutrient medium to electric revolving cup, the piping and druming mixing is transferred to solution in the aseptic 1.5ml eppendorf pipe, and 37 ℃ or 30 ℃ of shaking culture are after 60 minutes, and conversion fluid is coated on the corresponding antibiotic resistant panel, 37 ℃ or 30 ℃ of cultivations.Picking list bacterium colony is cultivated in containing corresponding antibiotic liquid nutrient medium, extracts plasmid, the enzyme evaluation of cutting and check order.

The composition of LB substratum (g/ml, %): peptone 1, yeast extract 0.5, sodium-chlor 1 adds 1.5% agar during solid culture, sterilized 20 minutes for 115 ℃.

2.S.peucettus a small amount of of ATCC 29050 genomic dnas is extracted

To line on the ISPII solid plate at-70 ℃ of frozen bacterial strains, cultivate more than 2 days for 30 ℃; Picking one ferfas piece is cultivated to 20mL ISPII liquid nutrient medium from solid plate, and 30 ℃ of 220rpm/ minute shaking tables were cultivated about 30 hours; Get the 1.0ml thalline to the 1.5ml centrifuge tube, 13, centrifugal 30 seconds of 200rpm collects thalline; Thalline is resuspended in the 467 μ l TE damping fluids, and mixing adds 30ml 10%SDS (sodium laurylsulfonate), adds the Proteinase K solution 3ml of 20mg/ml, mixing, and 37 ℃ are incubated 1 hour; Add isopyknic phenol: chloroform extracting, mixing, 13, centrifugal 10 minutes of 200rpm; Get supernatant, repeat above-mentioned steps; Go feelings, add the extracting of equal-volume chloroform, mixing, 13, centrifugal 10 minutes of 200rpm; Get supernatant, add the 5M sodium-acetate of 1/10 volume, the Virahol of 0.6 times of volume, mixing to adularescent flocks produces; With the flocks of glass stick picking, clean with 70% ethanol; Flocks is dissolved in an amount of TE damping fluid, placed 30 minutes, and placed 37 ℃ to treat that DNA dissolves fully then for 50 ℃.

The composition of ISPII substratum (g/ml, %): yeast extract 0.3; Malt extract 1; Glucose 1; PH7.3 adds the agar of 1.5% (mass volume ratio) during solid culture.Sterilized 20 minutes for 115 ℃.

3. the transformation of carrier

PBAD322 is that the pBR322 source contains low copy replicon, is subjected to the plasmid of L-arabinose abduction delivering.At first it is transformed to reduce its size, remove, and increase the multiple clone site that blue hickie screens that improves that helps cloning the noisy restriction enzyme site of follow-up clone.Introduce promptly the encode sacB gene of 6-fructosyl transferase and of negative selection markers subsequently, become the suicide plasmid that the external source fragment can be integrated on the pseudomonas putida KT2440 genome in fact in conjunction with shifting fragment oriT.Suicide plasmid can not be outside the karyomit(e) of host bacterium self-replicating, under selection pressure, be integrated on host's the genome by clone's homologous fragment thereon.

[1] the gene original paper araC-pBAD of removal L-arabinose abduction delivering

PBAD322 is carried out after enzyme cuts with NheI, obtain three fragments of 0.2kb, 1.3kb and 3.4kb, reclaim the fragment of 3.4kb, after oneself connects with the T4-ligase enzyme, the competent cell of Transformed E .coli DH10B, the size that screening obtains removing the araC-pBAD zone is the clone of 1.5kb, called after pBR7.

[2] introducing of multiple clone site

Design primer BR1:5 '-CCATTCGCCATTCAGGCTGCGC-3 ', BR2:5 '-GCGCAACGCAATTAATGTGAG-3 '.With pKS (-) plasmid DNA is template, and pcr amplification obtains the fragment that contains two sequencing primers of M13F, M13R and multiple clone site zone of 479bp.After pBR cut with HindIII and NheI enzyme, handle to make it blunt endization with the T4 polysaccharase, after cutting glue and reclaiming the back and the amplified production of BR1 and BR2 is connected with the T4-ligase enzyme, the competent cell of Transformed E .coli DH10B screens and obtains recombinant clone pBR7.Order-checking shows that pBR7 inserts segmental in the right direction, and DH10B/pBR7 shows blue on the LB flat board that contains IPTG (isopropyl-) and XGal (5-bromo-4-chloro-3-indoles-β-D-galactoside), is correct phenotype.

[3] introducing of sacB-oriT box gene

Design primer CST 1:5 '-GGGGAATTCCTTCAATAATATTGAAAAAGG-3 ', CST2:5 '-GGGGGATCCTTACCAATGCTTAATCAGTGAG-3 ', with the pKD4 plasmid DNA is template, and pcr amplification obtains the ampicillin resistance gene fragment of 0.9kb.Design primer CST3:5 '-GGGAGATCTTTATTTGTTAACTGTTAATTG-3 ', CST4:5 '-GGGAATATTGTTCGTGTAGACTTTCCTTGG-3 ', with the pEX100Tlink plasmid DNA is template, and pcr amplification obtains the sacB-oriT box gene fragment of 2.4kb.The ampicillin resistance gene fragment is cut with SspI and BamHI enzyme, sacB-oriT box gene fragment is cut with BglII and SspI enzyme, both with cut pBR7 through the SspI enzyme after the 2.4kb fragment that obtains under the effect of T4-ligase enzyme, be connected, the competent cell of Transformed E .coli DH10B, screening recombinant plasmid pBRST.

4. the clone of homologous fragment on the pseudomonas putida KT2440 genome

TrpE on the selection KT2440 genome and trpC gene are as the homologous fragment that the Zorubicin gene cluster is integrated on the genome.TrpE gene and trpC gene encode respectively o-amino benzoyl acid synthase component I and indoles-3-glycerol-3-phosphate synthetic enzyme, be to be PP_0418, PP_0419, trpG and trpD gene between trpE and the trpC between trpE gene and trpC gene, their lipase of encoding respectively, 32 the amino acid whose unknown polypeptide of encoding, anthranilate synthase component I I and anthranilate phosphoribosyl transferase.These genes participate in the biosynthesizing of anthranilic acid, are nonessential gene, promptly remove physiology and biochemical function that they do not influence bacterial strain.

[1] clone of trpE gene

Design primer CST5:5 '-GGGGAGCTCGGCCGCTGCCGGCTACAACCG-3 ', CST6:5 '-GGGGAATTCCAGATCGATCAGCATCAGGTG-3 ', with pseudomonas putida KT2440 genomic dna is template, pcr amplification obtains the trpE gene of 1.0kb, after cutting with SacI and EcoRI enzyme, be cloned into the same loci of pBRST, obtain recombinant plasmid pBRSTtrpE.

[2] clone of trpC gene

Design primer CST7:5 '-GGGAAGCTTTATGGACAGCAAGCGAACCGG-3 ', CST8:5 '-GGGGGATCCTCAGAAGAACTCGTCAAGAAG-3 ', with the pKD4 plasmid DNA is template, pcr amplification obtains the kan gene of 1.0kb, kan is a kalamycin resistance gene, is used to screen the Zorubicin gene cluster and is integrated into recombinant bacterial strain on the genome.Design primer CST9:GGGGAATTCAGATCTGGGCGTGATCCGCGAGCACTTC-3 ', CST10:5 '-GGGCTCGAGGCCGGTTTCTCGCAGCAGCAC-3 ', with pseudomonas putida KT2440 genomic dna is template, and pcr amplification obtains the trpC gene of 1.0kb.

The kan gene is cut with HindIII and BamHI enzyme, the trpC gene is cut with BglII and XhoI enzyme, both with the pKS (-) that cuts with HindIII and XhoI enzyme after being connected under the effect of T4-ligase enzyme, the competent cell of Transformed E .coli DH10B, screening obtains cloning the plasmid pNTC of kan-trpC box gene.After pNTC cut with HindIII and XhoI enzyme, reclaim the 2.0kb fragment, be cloned into HindIII and XhoI enzyme and cut and, obtain trpE and trpC and be cloned into the low recombinant clone that copies on the plasmid, called after pBRSTEC with the pBRSTtrpE that alkaline phosphatase is handled.

5. the structure that contains the clone of Zorubicin biological synthesis gene cluster homology arm and positive-negative selection mark

For realizing at first needing the fragment (being referred to as " homology arm ") of Zorubicin biological synthesis gene cluster both sides is cloned on the cloning vector, in order to screen the purpose clone, need to introduce selection markers simultaneously with recombined engineering method clone Zorubicin biological synthesis gene cluster; In order to remove selection markers, need to introduce negative selection markers.

[1] clone of Zorubicin biological synthesis gene cluster homology arm

Design primer DHA1:5 '-AAAGAATTCGAGTCGTCGCCTCTGCGGCCCC-3 ', DHA2:5 '-AAAACTAGTGTCGCCGCGCGGGCCGAGCAGG-3 ', with S.peucetius ATCC 29050 genomic dnas is template, amplification obtains 1.5kb, after cutting with EcoRI and SpeI enzyme, be cloned into the same loci of pKS (-), obtain containing the clone pDHA1 of Zorubicin biological synthesis gene cluster left side 1.5kb homology arm.

Design primer DHA3:5 '-AAAACTAGTGTTCAGGTGACGCACCATCTTG-3 ', DHA4:5 '-AAAAAGCTTCAACACGTGACCTTCCTCAGACC-3 ', with S.peucetius ATCC 29050 genomic dnas is template, amplification obtains 1.5kb, after cutting with SpeI and HindIII enzyme, be cloned into the same loci of pKS (-), obtain containing the clone pDHA2 of Zorubicin biological synthesis gene cluster right side 1.5kb homology arm.Cut pDHA1 with EcoRI and SpeI enzyme, reclaim 1.5kb left side fragment; Cut pDHA2 with SpeI and HindIII enzyme, reclaim 1.5kb right side fragment; Two fragments with under the effect of T4-ligase enzyme, be connected the competent cell of Transformed E .coli DH10B, screening recombinant plasmid pDHA3 with the pKS (-) that the HindIII enzyme is cut with EcoRI.

[2] clone of positive-negative selection mark

Selected positive selection markers is tetracycline resistance gene tet, and negative selection markers makes the bacterial strain that contains this plasmid not grow under the Streptomycin sulphate environment for the proteic rpsL of coding intestinal bacteria rrna S12, rpsL genetic expression.RpsL and tet constitutive gene box, tet and rpsL by the driving of pompF promotor to strengthen its expression in intestinal bacteria.After the Streptomycin sulphate screening,, in the time of clone's goal gene the rpsL-tet box gene is removed by the homologous recombination between the homology arm.

Design primer DHA5:5 '-GGGTCTAGATCGCTGTCGAGATATGACGGTG-3 ', DHA6:5 '-GGGTCTAGAGATGATAAGCTGTCAAACATGAG-3 ', with the pMOD4-RT plasmid DNA is template, pcr amplification obtains the rpsL-tet box gene of 2.0kb, with the XbaI enzyme cutting rear clone to pKD4, with getting 1.8kb behind the XbaI enzyme cutting, Transformed E .coli BW25141 bacterial strain obtains recombinant plasmid pR6KRT.PR6KRT contains the R6K replicon, can not duplicate in general bacterial strain such as DH10B, HB101 and DH5 α, and BW25141 expresses the host bacterium that pir albumen becomes pR6KRT by the R6K replicon.

[3] homology arm and selection markers is connected

Use XbaI enzyme cutting pR6KRT, cut the rpsL-tet box gene that glue reclaims 2.0kb, link to each other the competent cell of Transformed E .coli DH10B with the pDHA3 that cuts with the SpeI enzyme and handle through alkaline phosphatase, with penbritin and the dual screening of tsiklomitsin, obtain screening recombinant plasmid pDHA4.

6. the structure of clone gene bunch and integrative gene expression type plasmid

To contain the homology arm of Zorubicin biological synthesis gene cluster and just screening and after the plasmid pDHA4 of negative selection markers cuts with EcoRI and HindIII enzyme, reclaim the fragment of 4.0kb, link to each other with the pBRSTEC that cuts with the HindIII enzyme with EcoRI and handle through alkaline phosphatase, the competent cell of Transformed E .coliDH10B, the final plasmid pDHA5 that obtains clone's Zorubicin biological synthesis gene cluster.

The clone and the modification of embodiment 2 Zorubicin biological synthesis gene clusters

The present invention utilizes recombined engineering method clone's Zorubicin biological synthesis gene cluster and it is modified.

1. the structure of the plasmid of express recombinant enzyme gene

Because resistance marker related in the clone gene bunch experiment is more, we have at first made up the recombinase expression plasmid of tool chlorampenicol resistant.

Design primer RC1:5 '-AAACATGGATATTAATACTGAAACTG-3 ', RC2:5 '-AAAAAGCTTGTCATCGCCATTGCTCCCCAAATAC-3 ', with lambda DNA as template, pcr amplification obtains recombinase gene (being gam, bet and the exo gene) fragment of 1.9kb, cut the same loci of rear clone with NcoI and HindIII enzyme, gained plasmid called after pBADRed to pBAD322C.

Because pBADRed contains identical replicon with pDHA5, for avoiding plasmid incompatibility, after pBADRed cut with NsiI and PstI enzyme, reclaim araC-pBAD and the recombinase gene fragment of 3.2kb, with be connected with the pBBR1MCS-1 carrier that the HindIII enzyme is cut with PstI, transform the competent cell of Transformed E .coli DH10B, screening obtains inducing recombinase gene to express by pectinose, contains the recombinase expression plasmid pBBR1Red-C of BBR1 replicon.

2. the recombined engineering method of Zorubicin biological synthesis gene cluster is cloned

[1] cloning vector is converted into the plasmid of express recombinant enzyme

The electric transformed competence colibacillus cell of preparation DH10B/pBBR1Red-C adds the paraxin of 25 μ g/ml during cultivation, all the other methods are with the preparation of DH10B electricity transformed competence colibacillus cell.Transform pDHA5, screen, obtain bacterial strain DH10B/pBBR1Red-C+pDHA5 with penbritin, tsiklomitsin and paraxin.

[2] L-arabinose induces the preparation and the DNA of the electric transformed competence colibacillus cell of the bacterial strain that recombinase expresses to transform

The single bacterium colony of the fresh streak culture DH10B/pBBR1Red-C+pDHA5 of picking contains 37 ℃ of shaken overnight the corresponding antibiotic LB liquid nutrient medium to 2ml on containing corresponding antibiotic LB flat board, go among the 50ml LB with 1/50 volume, shaking culture is to thalline OD ₆₀₀Be about at 0.2 o'clock, the adding final concentration is 0.15% L-arabinose, continues to be cultured to thalline OD ₆₀₀Be about 0.6.Follow-up step transforms with preparation and the DNA of competence intestinal bacteria DH10B.

[3] clone of Zorubicin biological synthesis gene cluster

Electricity transforms through 5 μ g S.peucetius ATCC of mechanical shearing, 29050 genomic dnas, at the enterprising row filter of LB substratum that contains 200 μ g/ml Streptomycin sulphates, obtain 22 clones, cut checking through enzyme, comprising two correct clones, clone's called after pSino-200 of Zorubicin biological synthesis gene cluster will be contained finally.

3.TDP-D-glucose 4, the reparation of 6-dehydrase gene

Because Zorubicin produces dnrM gene in the Zorubicin biological synthesis gene cluster among the bacterium S.peucetius ATCC 29050 the 183rd Nucleotide generation phase shift mutation and abnormal end, so the TDP-D-glucose 4 of dnrM genes encoding, the 6-dehydrase gene can not show normal activity.Be to recover TDP-D-glucose 4, the activity of 6-dehydrase gene, we have at first cloned functional TDP-D-glucose 4 from S.peucetius ATCC 29050, and 6-dehydrase gene fragment will lose the gene of function again in its displacement protogene bunch.

[1] TDP-D-glucose 4, the clone in 6-dehydratase zone

According to the TDP-D-glucose 4 in streptomycete source, the conserved sequence of 6-dehydrase gene design degenerate primer GDH1:5 '-CSGGSGSSGCSGGSTTCATSGG-3 ', GDH2:5 '-GGGWRCTGGYRSGGSCCGTAGTT G-3 ', wherein S=G or C, W=A or T, Y=C or T, R=A or G.With S.peucetius ATCC 29050 genomic dnas is template, pcr amplification obtains the target product of about 0.6kb, order-checking obtains 542 bases after being cloned into the pGEM-T carrier, present open reading frame since the 3rd, 180 coded amino acid of 540bp fragment do not have terminator sequence, promptly be included in the complete albumen, with this gene fragment called after doxE.Homology is relatively found the TDP-D-glucose 4 in DoxE and other streptomycetes source, and the 6-dehydrase gene has very high homology.As with the Streptomycin sulphate biological synthesis gene cluster in TDP-D-glucose 4, the homology of 6-dehydrase gene StrE is 67%; With TDP-D-glucose 4 in the moral amine sugar biosynthetic gene cluster bunch, the homology of 6-dehydrase gene DesIV is 62%.This shows that the doxE that is cloned is functional TDP-D-glucose 4, the 6-dehydrase gene.

[2] displacement of functional gene

Realize that with the recombined engineering method doxE gene replaces corresponding dnrM Gene Partial.Design primer DOMD 1:5 '-GACGACAGCAGGGTGGAGATCTCCTCATGACCATGAAGATCCTGGTGACATCGCTG TCGAGATATGACGGTG-3 ', preceding 50 bases are the homology arm at dnrM 5 ', back 22 bases for amplification rpsL-tet box gene 5 ' primer; DOMD2:5 '-ACCCGGCCACCGCTCAGCAGGGTCGTCACAAAACGCGGAATGACCTTCTCGATGAT AAGCTGTCAAACATGAG-3 ', preceding 50 bases are the homology arm at dnrM 3 ', back 23 bases for amplification rpsL-tet box gene 3 ' primer.With the pR6KRT plasmid DNA is template, and amplification obtains the purpose product of 2.1kb, is the target practice DNA that contains homology arm and rpsL-tet box gene.

PSino-200 is transformed the electric transformed competence colibacillus cell of DH10B/pBBR1Red-C, screen with paraxin and penbritin, obtained strains is DH10B/pBBR1Red-C+pSino-200, the electric transformed competence colibacillus cell that the preparation pectinose induces recombinase gene to express, transform the target practice DNA of 300ng 2.1kb, screen with streptomycin resistance, 4 of picking clones are through cultivating and the checking of upgrading grain at random, be the recombinant clone that contains target practice DNA, promptly the rpsL-tet box gene has replaced dnrM gene 541bp.With this recombinant plasmid called after pSino-201.

In order to realize replacing the part that dnrM loses function with doxE, design primer DOMD3:5 '-GACGACAGCAGGGTGGAGATCTCCTCATGACCATGAAGATCCTGGTGACAGGCGCC GCGGGGTTCATCGGC-3 ', preceding 50 bases are the homology arm at dnrM 5 ', and back 21 bases are the primer of amplification doxE5 '; DOMD4:5 '-ACCCGGCCACCGCTCAGCAGGGTCGTCACAAAACGCGGAATGACCTTCTCTGGGTA CTGGTACGGCCCGTAG-3 ', preceding 50 bases are the homology arm at dnrM 3 ', back 22 bases are the primer of amplification doxE 3 '.With the doxE gene is template, and pcr amplification obtains the 640bp product, is the leather of beating that contains homology arm and doxE gene and clings to DNA.

PSino-201 is transformed the electric transformed competence colibacillus cell of DH10B/pBBR1Red-C, screen with paraxin and penbritin, obtained strains is DH10B/pBBR1Red-C+pSino-201, the electric transformed competence colibacillus cell that the preparation pectinose induces recombinase gene to express, transform the target practice DNA 300ng of 640bp, screen, obtain 90 clones with streptomycin resistance, it is sensitive tetracycline that the tetracyclin resistance checking is found 82, shows that the rpsL-tet box gene loses.Picking purpose clone through cultivating and the checking of upgrading grain, is the recombinant clone that contains target practice DNA at random, and promptly the doxE gene has replaced the rpsL-tet box gene.With this recombinant plasmid called after pSino-202, the 541bp that this plasmid promptly comprises the dnrM gene is replaced by the 540bp of doxE obtains functional TDP-D-glucose 4, the 6-dehydrase gene, and therefore Zorubicin biological synthesis gene cluster wherein is complete.

The gene knockout of dnrH, dnrX and dnrU in the embodiment 3 Zorubicin biological synthesis gene clusters

Gene dnrH, dnrX and dnrU are the negative regulator genes in the Zorubicin biological synthesis gene cluster, DnrH and DnrX catalysis Zorubicin and daunomycin are converted into paromycin (baumycin) class glucosides, DnrU catalysis daunomycin is converted into 13 (R)-dihydroxyl daunomycin, they are the metabolic by product of Zorubicin, blocking being formed with of they is beneficial to and makes biosynthetic precursor small molecules metabolism stream definite object product Zorubicin, thereby increase the output of Zorubicin, eliminate separation and purifying that by product helps target product simultaneously.

1.dnrH knocking out of gene

Adopt the recombined engineering method that dnrH is carried out gene knockout, at first by homologous recombination just to screen and negative screening-gene box rpsL-tet replaces the dnrH gene, by oligonucleotide mediated homologous recombination rpsL-tet is removed subsequently.Final first three and back three Nucleotide that only keep dnrH gene open reading frame had so both been realized knocking out in the reading frame of dnrH gene, did not destroy the polar effect of downstream gene expression again.

Design primer DOMD5:5 '-AACCCGCTCAGCCGTGCCGTCCGCCCCGCCCCGGAGGTGAGTTCCCCGTGTCGCTG TCGAGATATGACGGTG-3 ', preceding 50 bases are the 5 ' homology arm that contains dnrH gene open reading frame initiator codon GTG sequence, back 22 bases for amplification rpsL-tet box gene 5 ' primer; DOMD6:5 '-CCGCCGGTCACGATCACGGATCGCTGTGTGTTCTCCATGCGGCGAGGCTAGATGAT AAGCTGTCAAACATGAG-3 ', preceding 50 bases are the homology arm that contains 3 of dnrH gene terminator codon TAG ', back 23 bases for amplification rpsL-tet box gene 3 ' primer.With the pR6KRT plasmid DNA is template, and amplification obtains the purpose product of 2.1kb, is the target practice DNA that contains homology arm and rpsL-tet box gene.

PSino-202 is transformed the electric transformed competence colibacillus cell of DH10B/pBBR1Red-, screen with paraxin and penbritin, obtained strains is DH10B/pBBR1Red-C+pSino-202, prepare the electric transformed competence colibacillus cell that its L-arabinose induces recombinase gene to express, transform the target practice DNA of 300ng 2.1kb, screen with tetracyclin resistance, 4 of picking clones are through cultivating and the checking of upgrading grain at random, be the recombinant clone that contains target practice DNA, promptly the rpsL-tet box gene has replaced the dnrH gene.With this recombinant plasmid called after pSino-203.

Design primer DOMD7:5 '-CAGCCGTGCCGTCCGCCCCGCCCCGGA GGTGAGTTCCCCGTGTAGCCTCGCCGCATGGAGAACACACAGCGATCCG TGATCGTG-3 ', preceding 42 bases are back 42 base sequences of 50bp 5 ' homology arm, and back 42 bases are preceding 42 base sequences of 50bp 3 ' homology arm.

PSino-203 is transformed the electric transformed competence colibacillus cell of DH10B/pBBR1Red-C, screen with paraxin and penbritin, obtained strains is DH10B/pBBR1Red-C+pSino-203, prepare the electric transformed competence colibacillus cell that its L-arabinose induces recombinase gene to express, transform 300ng DOMD7 oligonucleotide, screen with streptomycin resistance, 4 of picking clones find to be the sensitive tetracycline type at random, through cultivating and the checking of upgrading grain, they be that the rpsL-tet box gene eliminates recombinant clone, with the plasmid called after pSino-204 of this dnrH gene knockout.

2.dnrX gene knockout

The principle of gene knockout and basic step are with the gene knockout of dnrH.

Design primer DOMD8:5 '-CCGGCACGCCCTCTCTGTCCGGCGGTCCGGGGACGACGCCACCGGGATCATCGCTG TCGAGATATGACGGTG-3 ', preceding 50 bases are the 5 ' homology arm that comprises dnrX gene terminator codon reverse complementary sequence TCA, back 22 bases for amplification rpsL-tet box gene 5 ' primer; DOMD9:5 '-CCGGGCGGTGGCCCCGGACCGGCGGCCACTCAGCATCGAGAGGGATCATGGATGAT AAGCTGTCAAACATGAG-3 ', preceding 50 bases are the homology arm that contains 3 of dnrX gene start codon reverse complementary sequence CAT ', back 23 bases for amplification rpsL-tet box gene 3 ' primer.With the pR6KRT plasmid DNA is template, and amplification obtains the target practice DNA that contains homology arm and rpsL-tet box gene of 2.1kb.

Transform pSino-204 to DH10B/pBBR1Red-C, the electric transformed competence colibacillus cell that the L-arabinose of preparation obtained strains induces recombinase gene to express, electricity transforms and screens the gene knockout of step with dnrH, obtains the recombinant plasmid called after pSino-205 that the rpsL-tet box gene has replaced the dnrX gene.

Design primer DOMD10:5 '-CCCTCTCTGTCCGGCGGTCCGGGGACGACGCCACCGGGATCACATGATCCCTCTCG ATGCTGAGTGGCCGCCGGTCCGGGGCCA-3 ', contain 42 bases of upstream and downstream homology arm respectively.

Transform pSino-205 to DH10B/pBBR1Red-C, the electric transformed competence colibacillus cell that the L-arabinose of preparation obtained strains induces recombinase gene to express, DOMD10 oligonucleotide electricity transforms and screens the gene knockout of step with dnrH, obtains the recombinant clone pSino-206 that the rpsL-tet box gene is eliminated.

3.dnrU gene knockout

Because dnrU and its upstream gene dpsG express for transcribing coupling, the termination codon subdivision of dpsG and the initiator codon of the dnrU four oligonucleotide TCAT of overlapping, the selection of dnrU gene knockout experiment is only to keep these four bases of TCAT, and leaves out every other base.Because the dnrV gene in dnrU gene downstream uses the promotor of himself, so knocking out of dnrU do not influence the dnrV expression of gene.

Design primer DOMD11:5 '-CGGACATCTCGCGGATGAGACGGACATGCGGGCGGGGCGGGCCGCCGCCGTCGCTG TCGAGATATGACGGTG-3 ', preceding 50 bases are 50 Nucleotide in dnrU gene reading frame downstream, back 22 bases for amplification rpsL-tet box gene 5 ' primer; DOMD12:5 '-CGCATAGCATGCTGATCTTCGTCAACGAGAGGCTGCGAGCGGCGGCATGAGATGAT AAGCTGTCAAACATGAG-3 ', preceding 50 bases be contain dnrU gene and dpsG gene four overlapping base TCAT reverse complementary sequence 3 ' homology arm, 23 bases in back for amplification rpsL-tet box gene 3 ' primer.With the pR6KRT plasmid DNA is template, and amplification obtains the target practice DNA that contains homology arm and rpsL-tet box gene of 2.1kb.

Transform pSino-206 to DH10B/pBBR1Red-C, the electric transformed competence colibacillus cell that the L-arabinose of preparation obtained strains induces recombinase gene to express, electricity transforms and screens the gene knockout of step with dnrH, obtains the recombinant plasmid called after pSino-207 that the rpsL-tet box gene has replaced the dnrU gene.

Design primer DOMD 13:5 '-TCGCGGATGAGACGGACATGCGGGCGGGGCGGGCCGCCGCCGTCATGCCGCCGCTC GCAGCCTCTCGTTGACGAAGATCAGCAT-3 ', contain 42 bases of upstream and downstream homology arm respectively.

Transform pSino-207 to DH10B/pBBR1Red-C, the electric transformed competence colibacillus cell that the L-arabinose of preparation obtained strains induces recombinase gene to express, DOMD13 oligonucleotide electricity transforms and screens the gene knockout of step with dnrH, obtains the recombinant clone pSino-208 that the rpsL-tet box gene is eliminated.

Embodiment 4 places the doxA gene under the control of pseudomonas induction type high expression level promotor

DoxA genes encoding oxydo-reductase in the Zorubicin biological synthesis gene cluster, catalysis road promise rhzomorph hydroxylation generates Zorubicin.But the catalyzed reaction of DoxA is also incomplete, so S.peucetius ATCC 29050 former strains while birth canal promise rhzomorph and Zorubicins, and the former output is higher than the latter.Increase doxA expression of gene amount, catalyzed reaction is carried out to the Zorubicin direction further.For reaching this purpose, selected effective xylS-Pm strong promoter expression system in pseudomonas putida KT2440.XylS and Pm are respectively the regulatory gene and the m-methyl benzoic acid inductive strong promoter of the meta manipulator of degraded aromatic cycle compound among the pseudomonas TOL plasmid pWWO, and the effect of Pm is subjected to the positive regulation of xylS.The high expression level of Pm strong promoter orders about the high expression level of doxA gene.

Adopt the recombined engineering method to introduce the principle of xylS-Pm and step basically with the gene knockout of dnrH, at first the rpsL-tet box gene is inserted into 5 of doxA gene ' end, and the doxA gene of removal corotation record and ten Nucleotide between the dnrV gene, under the negative screening effect of Streptomycin sulphate, reach the purpose of xylS-Pm and doxA gene fusion with the xylS-Pm replacement rpsL-tet box gene that contains homology arm subsequently.

Design primer DOMD14:5 '-GGCTTGCGCTGCATGGTCATCATGGGACACGCGAACGGGTCGACGGCCACTCGCTG TCGAGATATGACGGTG-3 ', preceding 50 bases are the 5 ' homology arm that contains doxA gene start codon sequence, back 22 bases for amplification rpsL-tet box gene 5 ' primer; DOMD15:5 '-ACTGCGGGAGGGGTACCCCGCGGCGGCGGGCGGTGCCTCGTGAGCGGCGAGATGAT AAGCTGTCAAACATGAG-3 ', preceding 50 bases be contain 3 of dnrV gene open reading frame end ' homology arm, back 23 bases for amplification rpsL-tet box gene 3 ' primer.With the pR6KRT plasmid DNA is template, and amplification obtains the target practice DNA that contains homology arm and rpsL-tet box gene of 2.1kb.

Transform pSino-208 to DH10B/pBBR1Red-C, the electric transformed competence colibacillus cell that the L-arabinose of preparation obtained strains induces recombinase gene to express, electricity transforms and screens the gene knockout of step with dnrH, obtains the recombinant plasmid pSino-209 that the rpsL-tet box gene replaces sequence between doxA gene and the dnrV gene.

Design primer DOMD16:5 '-GGCTTGCGCTGCATGGTCATCATGGGA CACGCGAACGGGTCGACGGCCACACATGTTCATGACTCCATTATTATTG-3 ', preceding 50 bases are the 5 ' homology arm that contains doxA gene start codon sequence, and back 26 bases are the primer of amplification Pm end; DOMD17:5 '-ACTGCGGGAGGGGTACCCCGCGGCGGCGGGCGGTGCCTCGTGAGCGGCGATCAAGC CACTTCCTTTTTGCATTG-3 ', preceding 50 bases be contain 3 of dnrV gene open reading frame end ' homology arm, back 24 bases are the primer of amplification xylS end.With the pJB861 plasmid DNA is template, and pcr amplification obtains the product of 1.8kb, is the target practice DNA that contains xylS-Pm.

Transform pSino-209 to DH10B/pBBR1Red-C, the electric transformed competence colibacillus cell that the L-arabinose of preparation obtained strains induces recombinase gene to express, the electricity that contains the xylS-Pm of homology arm transforms and screens the gene knockout of step with dnrH, obtains the recombinant plasmid pSino-210 that xylS-Pm replaces the rpsL-tet box gene.In this plasmid, doxA is by Pm expression that promotor drives.

The heterogenous expression of embodiment 5 improved Zorubicin biological synthesis gene clusters

1. three parents transform pseudomonas putida KT2440 in conjunction with transfer method

With P.putida KT2440 is the host bacterium, and E.coli HB101/pRK2073 is the bacterial strain of secondary transfer, and E.coli DH10B/pSino-209 is the bacterial strain that contains DNA to be transformed.Three bacterial strains are operated in conjunction with transfer method with three parents, screen with kalamycin resistance, bear screening with 10% sucrose, final obtain improved Zorubicin biological synthesis gene cluster and be integrated into bacterial strain between P.putida KT2440 genome trpE and the trpC.

2. genotypic checking

Design primer DE1:5 '-TCAAGGCCTTGGCCCGTTGGC-3 ' is the primer at trpE upstream gene gph; DE2:5 '-TGTTCAGGTGCACCTGTAGGC-3 ' is the primer at dnrL gene in the Zorubicin biological synthesis gene cluster; DE3:5 '-ATATTGCTGAAGAGCTTGGCG-3 ' is the primer at kanamycin gene kan; DE4:5 '-TAGACCAGTGCAACGTTCACC-3 ' is the primer at trpC downstream gene PP_0423.

Four bacterial strains of picking at random are template with their genomic dna, and DE1, DE2 and DE3, DE4 are the purpose fragment that primer increases respectively and obtains 1.2kb, and be in full accord with expection.Check order behind two purpose fragment clonings with one of them bacterial strain, sequence results is entirely true, shows that the Zorubicin biological synthesis gene cluster has been integrated into the genome of pseudomonas putida KT2440.The bacterial strain called after P.putida Sino-HDR that genotype is correct the most at last.

The synoptic diagram that obtains P.putida Sino-HDR by homologous recombination method as shown in Figure 1.The PCR result of P.putida Sino-HDR genotype checking as shown in Figure 2.

The analysis of embodiment 6 P.putida Sino-HDR tunnings

By fermentation culture, adopt high performance liquid chromatography (HPLC) method to detect tunning, identify that the expression of P.putida SinoHDR bacterial strain produces the situation of Zorubicin and Dao Nuo rhzomorph.

The efficient liquid phase chromatographic analysis result of P.putida Sino-HDR strain fermentation product as shown in Figure 3.Wherein A is promise rhzomorph and Zorubicin standard substance, the content of road promise rhzomorph and Zorubicin standard substance is respectively 1 μ g, the retention time of road promise rhzomorph is 19.7 minutes, the retention time of Zorubicin is 10.9 minutes, B is the tunning of P.putida Sino-DNDR bacterial strain, and C is the tunning of P.putida Sino-HDR bacterial strain.

According to the calculated by peak area result of standard substance, the output of the tunning Zorubicin of visible engineering strain P.putidaSino-HDR is 3.51 μ g/ml, and road promise rhzomorph output is 0.85 μ g/ml.

Though above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements all belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.

Claims

1. produce the false unit cell engineering bacteria of Zorubicin, it is characterized in that, it is the Pm promotor of inserting with dnrH, dnrX in the Zorubicin biological synthesis gene cluster and dnrU gene elmination and before the doxA gene of coding oxydo-reductase from pseudomonas, then improved gene cluster is integrated in the genome of pseudomonas putida (Pseudomonas putida) KT2440 and obtains.

2. engineering bacteria according to claim 1 is characterized in that, described Zorubicin biological synthesis gene cluster derives from streptomycete (Streptomyces peucetius) ATCC 29050.

3. engineering bacteria according to claim 1 and 2 is characterized in that, improved gene cluster is to be integrated in the genome of pseudomonas putida (Pseudomonasputida) KT2440 with the selection markers gene.

4. engineering bacteria according to claim 3 is characterized in that, described selection markers gene is kalamycin resistance gene or gentamicin resistant gene.

5. according to claim 3 or 4 described engineering bacterias, it is characterized in that it is improved Zorubicin biological synthesis gene cluster is integrated into the zone between the trpE gene and trpC in the pseudomonas putida KT2440 genome with the selection markers gene and obtains.

6. engineering bacteria according to claim 5 is characterized in that, it is improved Zorubicin biological synthesis gene cluster is integrated into the zone between the trpE gene and trpC in the pseudomonas putida KT2440 genome with kalamycin resistance gene and obtains.

7. engineering bacteria according to claim 6 is characterized in that, it is pseudomonas putida (Pseudomonas putida) Sino-HDR, preserving number CGMCC NO.4638.

8. the cultural method of the described engineering bacteria of claim 7 is characterized in that, described engineering bacteria is inoculated in the LB substratum, cultivates under 30 ℃.

9. the application of each described engineering bacteria of claim 1～7 in producing Zorubicin.