CN102221610B - Method for rapidly detecting pathogenic bacteria at high efficiency, biological dependent sensor and preparation method thereof - Google Patents
Method for rapidly detecting pathogenic bacteria at high efficiency, biological dependent sensor and preparation method thereof Download PDFInfo
- Publication number
- CN102221610B CN102221610B CN 201010150617 CN201010150617A CN102221610B CN 102221610 B CN102221610 B CN 102221610B CN 201010150617 CN201010150617 CN 201010150617 CN 201010150617 A CN201010150617 A CN 201010150617A CN 102221610 B CN102221610 B CN 102221610B
- Authority
- CN
- China
- Prior art keywords
- concentration
- monoclonal antibody
- biotin
- under
- minutes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention provides a method for rapidly detecting pathogenic bacteria at high efficiency, a biological dependent sensor and a preparation method thereof, wherein the biological dependent sensor comprises a plastid with the function of converting signals and a capturing system with the function of recognizing molecules; the method for rapidly detecting the pathogenic bacteria at high efficiency comprises the following steps: preparing the biological dependent sensor; using the biological dependent sensor to capture a sample detecting solution; simultaneously setting the blank comparison and the positive concentration comparison of a standard substance and starting anadenosine triphosphate synthetic reaction; and carrying out the detection by utilizing a fluorescence scanner. The scheme in the invention has the advantages of low detection limit and short detection time; the detection limit can reach 100cfu/hole; if the detection limit is computed according to 1cfu/25g, the whole detecting course is not beyond 12 hours, is shortened by at least 60 hours than the conventional microorganism test method and is shortened by at least 36 hours than a PCR (Polymerase chain Reaction) method; and when the concentration of the bacteria in a sample is higher than 1cfu/25g, the needed time is short, thus the deep influence on food safety and disease treatment bacterium control can be generated.
Description
Technical field
The present invention relates to the food safety detection technical field, particularly relate to a kind of method that rapidly and efficiently detects pathogenic bacteria, biology sensor and preparation method thereof.
Background technology
The food security malignant event occurs repeatedly in the world wide in recent years, no matter developed country or developing country, and the food-borne pathogens incidence is high, and the fast detecting of food-borne pathogens is the focus that research is both at home and abroad paid close attention to always.Prior art is general to adopt following detection method that food-borne pathogens is carried out fast detecting:
Scheme one, traditional microbial method, namely the detection method of GB13091-2002 regulation generally needs following five continuous stages: increased bacterium in advance 16～20 hours with non-selective fluid nutrient medium; Increased bacterium 24 hours at the selected liq nutrient culture media; Line identification is 24 hours on the selective medium; Separate, choose bacterium colony and cultivated again 24 hours; Identify, identify that with suitable biochemistry and serology experiment 76h finally draws testing result.As can be seen from the above step, the step that traditional microbial method detects pathogenic bacteria comprises enrichment, selection cultivation, separation, biochemical identification, also needs kind of type to determine sometimes, needs 5～7 days just can go out report, length consuming time, complex operation.
Scheme two, real-time polymerase chain reaction (PCR, Polymerase Chain Reaction) method, as: various pathogens method for quick in the SNT1869---2007 food; Publication number CN1536090A, name are called the scheme of " food-borne pathogens fast detecting genetic chip and application thereof "; Publication number is that CN1814789A, name are called " frequent pathogenic bacteria multiple PCR rapid detecting kit and detection method thereof in livestock and poultry meat and the aquatic products " etc., above-mentioned round pcr all needs through the specific primer design, increases bacterium, the preparation of DNA or PNA, steps such as pcr amplification, detection.But round pcr because and responsive, be easy to be subjected to extraneous factor to influence, in case there is the exogenous DNA of minute quantity to pollute, just false positive results may appear.On the one hand, food is complicated response matrix, and the factor that influences the PCR reaction is a lot, if can not effectively get rid of the interference of each influence factor, false positive results may occur; On the other hand, if various test condition controls are improper in the PCR operating process, be easy to cause the product sudden change, also may cause false negative result.The selection of primer design and target sequence is the key factor that determines PCR result, the primer difference is the amplified matter difference then, if primer design is improper. then directly influence to the selection of crucial target sequence, thereby reduce sensitivity and the specificity that PCR detects, even fall flat.In addition, the reagent costliness that PCR method is required, some is also harmful to the person, and complex operation complexity in the testing process, needs long detection time, and overall detection time was greater than 48 hours.
Scheme three, ELISA method, detection method as GB/T22429-2008 regulation comprises: increase bacterium before sample is done and handled 24 hours, enrichment liquid after heat treated just like bag by in the solid phase container of specific antibody (primary antibodie), object bacteria is combined, unconjugated other compositions of flush away with primary antibodie; Add the specificity ELIAS secondary antibody, again unconjugated other compositions of flush away; Add specific substrates and react with it, generate fluorescent chemicals or colored compound, by fluorescence intensity or absorbance, with reference point relatively, through drawing assay in 2.5 hours.But the ELISA method also has its shortcoming that can't overcome: at first, the operation skill of this technology is stronger, and it is very big to result's influence to the control of key point, important first step application of sample in the ELISA method, sample adds and the error of blending process can be amplified in following all multioperations step by step, causes the testing result deviation greatly even false positive and false negative occur; Secondly, be prone to cross pollution between the hole in the operating process, false positive occurs; In addition, this method detectability is higher, reaches 10
6Cfu (ColonyForming Units, colony-forming units)/liter.
Summary of the invention
Technical matters to be solved by this invention provides a kind of method that rapidly and efficiently detects pathogenic bacteria, can solve prior art and detect long, problems such as process is loaded down with trivial details, cost height of limit for height, detection time.
The present invention also provides a kind of biological dependent sensor and preparation method thereof, to guarantee the above-mentioned method application in practice that rapidly and efficiently detects pathogenic bacteria.
In order to address the above problem, the invention discloses a kind of method that rapidly and efficiently detects pathogenic bacteria, comprising:
Biological dependent sensor preparation process: the chromatoplast that in each enzyme mark hole of ELISA Plate, forms and be marked with the pH sensitive fluorescent probe after with the Thermophilic Bacteria ultrasonication, mix by 4: 1 volume ratio with β subunit monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody seizure complex, under 40 rev/mins, 35～38 ℃ conditions, hatched 1 hour, obtain having the biological dependent sensor of Acquisition Detection target capability;
Detect thing and catch step: each the enzyme mark hole in ELISA Plate adds the biological dependent sensor that 10 microlitres prepare, add 20～100 microlitre sample detection liquid again, the positive concentration contrast of blank and standard items is set simultaneously, under 35～38 ℃ of conditions, hatched 25～35 minutes the Acquisition Detection object;
Detect step: add the synthetic damping fluid of 70 microlitre adenosine triphosphates again in each enzyme mark hole of ELISA Plate and start the adenosine triphosphate synthetic reaction, after temperature is bathed 10～15 minutes under 38～45 ℃ of temperature, detect with the fluorescent scanning instrument; Wherein, the excitation wavelength of described fluorescent scanning instrument is that 485 nanometers, emission wavelength are 538 nanometers; The synthetic damping fluid of described adenosine triphosphate comprise concentration be 50 mMs/liter three (methylol) methylglycine, 10% glycerine, concentration be 5 mMs/liter sodium dihydrogen phosphate, concentration be 5 mMs/liter magnesium chloride, NaOH adjust pH to 8.0, the adenosine diphosphate that to face with preceding adding final concentration be 2 mMs.
Preferably, before catching step, described detection thing also comprises the sample pretreatment step: will carry out inactivation treatment by the test sample of standard handler preparation, get 1～10 milliliter the concussion mixing deactivation after sample solution, the centrifuging of carrying out 4000 rev/mins, 30 minutes is handled, the bacterial sediment that obtains is suspended to original volume with stroke-physiological saline solution, after repeating above-mentioned separation and suspension process 1 time or 2 times again, the sample solution after the concussion mixing suspends forms sample detection liquid.
Preferably, also comprise data processing step after described detection step: whether the blank group of reference and positive controls contain pathogenic bacteria to test sample qualitatively judges.
Preferably, described biological dependent sensor comprises the chromatoplast with signal transformation function and has the system of catching of molecular recognition function that the preparation method of described biological dependent sensor specifically comprises:
The chromatoplast preparation process: cultivated Thermophilic Bacteria 20～24 hours at 60～80 ℃ of high temperature shaking tables, under 4 ℃, 4000 rev/mins condition centrifugal 30 minutes then, abandon supernatant, collect thalline; The thalline that obtains is resuspended with lavation buffer solution, under 4 ℃, 8000 rev/mins condition centrifugal 10 minutes then, thalline after collect cleaning is that 200 watts, circulation connect that to disconnect 9 seconds, effective time in 5 seconds be to carry out the low temperature ultrasonication under 10 minutes the condition at power; Bacterium liquid after the ultrasonication was removed cell fragment and part foreign protein in centrifugal 30 minutes under 4 ℃, 12000 rev/mins condition, collect supernatant again at 4 ℃, ultracentrifugation is 1 hour under 40000 rev/mins the condition, to precipitate with the tris-HCI buffer suspension, obtain the chromatoplast suspension; Wherein, described lavation buffer solution comprise 50 mMs/liter three (methylol) methylglycine, concentration be the sucrose of 0.25 mol and concentration be 4 mMs/liter magnesium chloride, NaOH adjust pH to 8.0; Described hydroxymethyl aminomethane-hydrochloride buffer comprise concentration be 20 mMs/liter hydroxymethyl aminomethane, concentration be 100 mMs/liter sodium chloride, concentration be 5 mMs/liter magnesium chloride and concentration be 10% glycerine, the hydrogen chloride adjust pH is to 8.0.
PH sensitive fluorescent probe markers step: get chromatoplast suspension 600 microlitres, removed glycerine in centrifugal 30 minutes under 12000 rev/mins condition, the precipitation that obtains is suspended to original volume with ultrasonic damping fluid; Add the pH sensitive fluorescent probe that 1～2 microlitre mass concentration is 1 mg/ml then, mixing connects in circulation that to disconnect 8 second effective time in 5 seconds be that water-bath is ultrasonic under 3 minutes the condition, fills test tube with ultrasonic damping fluid; Under 4 ℃, 12000 rev/mins condition centrifugal 30 minutes then, damping fluid suspension precipitation with pH8.0～8.5, repeat centrifugal, suspension process 4 times, the centrifugation time that the back is three times is 15 minutes, other conditions are constant, the final pH sensitive fluorescent probe that dissociates of removing fully obtains the good chromatoplast of mark; Wherein, described ultrasonic damping fluid be pH value 5.0～6.0, concentration be 0.01 mM/liter TRIS buffer;
Catch the construction step of system: with monoclonal antibody and the biotin of the β subunit of F0F1-ATP enzyme, detect object monoclonal antibody and biotin all in 3: 2 be connected the ratio mixing, making the concentration of two kinds of antibody be is that 0.1 mg/ml, biotin concentration are 1 micromoles per liter, waits for half an hour under the room temperature condition; Then, with the β subunit monoclonal antibody-biotin complex of F0F1-ATP enzyme, detect object monoclonal antibody-biotin complex by behind 1: 1 the volume ratio mixing, add 1.1 times of volume 1 micromolar streptavidins, after 15～30 minutes, obtain having the complex of β subunit monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody composition of capture ability under the room temperature condition;
Biological dependent sensor generates step: the β monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody that adds 40 microlitres in each hole of ELISA Plate catches complex, and the good chromatoplast of 10 microlitre marks, beat mixing gently, under 40 rev/mins, 35～38 ℃ environment, hatched 1 hour, obtain can the Acquisition Detection object biological dependent sensor.
Preferably, before described construction step of catching system, also comprise: judge the β subunit monoclonal antibody solution of described F0F1-ATP enzyme and detect in the monoclonal antibody solution of object whether contain sodium azide, if then use the phosphate buffer dialysis of pH8.0 to remove wherein sodium azide.
Preferably, also comprise β subunit monoclonal antibody preparation process described before catching the system construction step: be template with the Thermophilic Bacteria genome, the gene order of the β subunit by polymerase chain reaction method amplification F0F1-ATP enzyme, with the sequence of β subunit clone, heterogenous expression, purifying, obtain the β subunit monoclonal antibody of F0F1-ATP enzyme again through MONOCLONAL ANTIBODIES SPECIFIC FOR.
Preferably, the sequence of the β subunit of described F0F1-ATP enzyme is:
ATGACAAGAGGACGCGTTATCCAAGTCATGGGTCCGGTTGTAGACGTCAAGTTTGAGAACGGCCACTTGC
CGGCGATCTACAACGCCCTGAAAATTCAACATAAAGCGCGCAACGAAAACGAAGTCGACATCGACTTGAC
ATTGGAAGTCGCCTTGCACCTTGGCGATGATACAGTACGGACGATCGCGATGGCGTCCACAGACGGCCTC
ATCCGCGGCATGGAAGTCATCGATACCGGTGCACCGATTTCGGTGCCGGTCGGCGAAGTCACGCTTGGCC
GCGTGTTCAACGTCTTGGGCGAGCCGATCGACTTGGAAGGCGACATTCCGGCTGACGCCCGCCGCGACCC
GATTCACCGTCCGGCGCCAAAATTCGAGGAATTGGCGACGGAAGTCGAAATTTTGGAAACGGGGATTAAA
GTCGTTGACTTGCTTGCCCCGTATATTAAAGGCGGAAAAATCGGTTTGTTCGGCGGCGCTGGCGTAGGAA
AAACGGTCTTGATTCAAGAGCTGATCCACAACATCGCCCAAGAGCACGGCGGGATTTCCGTCTTTGCTGG
CGTCGGCGAACGGACGCGCGAAGGAAACGACTTGTACCATGAGATGAAAGATTCCGGCGTCATCAGCAAA
ACGGCCATGGTGTTCGGACAAATGAATGAGCCGCCGGGGGCGCGGATGCGCGTCGCCTTGACCGGCTTGA
CGATGGCCGAATACTTCCGTGATGAACAAGGCCAAGACGTGTTGCTCTTTATCGATAACATCTTCCGTTT
CACGCAGGCCGGTTCGGAAGTGTCGGCGCTGTTAGGCCGCATGCCGTCGGCCGTTGGTTACCAACCGACA
TTGGCGACGGAGATGGGTCAATTGCAAGAGCGGATCACGTCGACGGCGAAAGGATCGATCACCTCGATTC
AAGCGATTTACGTCCCGGCCGACGACTATACGGACCCGGCTCCGGCCACGACGTTCTCGCACTTGGATGC
GACGACGAACCTGGAGCGGAAGCTCGCGGAGATGGGGATTTATCCGGCCGTTGACCCGCTCGCTTCGACA
TCGCGTGCGTTGGCGCCGGAAATCGTCGGCGAGGAGCACTACCAAGTCGCCCGCAAAGTGCAGCAAACGC
TGCAACGTTATAAAGAATTGCAAGACATCATCGCCATCTTGGGGATGGATGAACTGTCGGATGAAGACAA
ACTCGTCGTTCATCGCGCCCGCCGCATCCAGTTCTTCTTGTCGCAAAACTTCCACGTGGCGGAGCAGTTC
ACGGGCCAACCGGGCTCCTACGTGCCGGTGAAAGAAACAGTGCGCGGCTTTAAAGAAATTTTGGAAGGCA
AATACGACCATCTTCCGGAAGATGCGTTCCGCTTAGTCGGCCGCATTGAAGAAGTCGTTGAAAAAGCGAA
AGCGATGGGTGTCGAAGTGTGA。
According to another preferred embodiment of the present invention, a kind of biological dependent sensor is also disclosed, comprise the chromatoplast with signal transformation function and the system of catching with molecular recognition function, wherein: described chromatoplast is the vesicles that the ultrasonic back of Thermophilic Bacteria cell membrane turns up and forms, be inlaid with the F0F1-ATP enzyme on the film of this vesicles, the chromatoplast cell inner mark has the pH sensitive fluorescent probe; The described system of catching is the β subunit monoclonal antibody of F0F1-ATP enzyme and the complex that biotin is connected to form, and, detect the complex that object monoclonal antibody and biotin are connected to form, connect the β subunit monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody that obtains by streptavidin and catch complex.
According to an also preferred embodiment of the present invention, a kind of preparation method of biological dependent sensor is disclosed, comprising:
The chromatoplast preparation process: cultivated Thermophilic Bacteria 20～24 hours at 60～80 ℃ of high temperature shaking tables, under 4 ℃, 4000 rev/mins condition centrifugal 30 minutes then, abandon supernatant, collect thalline; The thalline that obtains is resuspended with lavation buffer solution, under 4 ℃, 8000 rev/mins condition centrifugal 10 minutes then, thalline after collect cleaning is that 200 watts, circulation connect that to disconnect 9 seconds, effective time in 5 seconds be to carry out the low temperature ultrasonication under 10 minutes the condition at power; Bacterium liquid after the ultrasonication was removed cell fragment and part foreign protein in centrifugal 30 minutes under 4 ℃, 12000 rev/mins condition, collect supernatant again at 4 ℃, ultracentrifugation is 1 hour under 40000 rev/mins the condition, to precipitate with hydroxymethyl aminomethane-hydrochloride buffer suspension, obtain the chromatoplast suspension; Wherein, the described lavation buffer solution of described lavation buffer solution comprise 50 mMs/liter three (methylol) methylglycine, concentration be the sucrose of 0.25 mol and concentration be 4 mMs/liter magnesium chloride, NaOH adjust pH to 8.0; Described hydroxymethyl aminomethane-hydrochloride buffer comprise concentration be 20 mMs/liter hydroxymethyl aminomethane, concentration be 100 mMs/liter sodium chloride, concentration be 5 mMs/liter magnesium chloride and concentration be 10% glycerine, hydrogen chloride adjust pH to 8.0; PH sensitive fluorescent probe markers step: get chromatoplast suspension 600 microlitres, removed glycerine in centrifugal 30 minutes under 12000 rev/mins condition, the precipitation that obtains is suspended to original volume with ultrasonic damping fluid; Add the pH sensitive fluorescent probe that 1～2 microlitre mass concentration is 1 mg/ml then, mixing, circulation connect disconnected in 5 seconds 8 second effective time be carry out under 0～4 ℃ of water-bath under 3 minutes the condition ultrasonic, afterwards with concentration be 10 mMs/liter phosphate buffer fill test tube; Under 4 ℃, 12000 rev/mins condition centrifugal 30 minutes then, damping fluid suspension precipitation with pH8.0～8.5, repeat centrifugal, suspension process 4 times, the centrifugation time that the back is three times is 15 minutes, other conditions are constant, the final pH sensitive fluorescent probe that dissociates of removing fully obtains the good chromatoplast of mark; Wherein, described ultrasonic damping fluid be pH value 5.0～6.0, concentration be 0.01 mM/liter TRIS buffer;
Catch the construction step of system: with monoclonal antibody and the biotin of the β subunit of F0F1-ATP enzyme, detect object monoclonal antibody and biotin all in 3: 2 be connected the ratio mixing, making the concentration of two kinds of antibody be is that 0.1 mg/ml, biotin concentration are 1 micromoles per liter, waits for half an hour under the room temperature condition; Then, with the β subunit monoclonal antibody-biotin complex of F0F1-ATP enzyme, detect object monoclonal antibody-biotin complex by behind 1: 1 the volume ratio mixing, add 1.1 times of volume 1 micromolar streptavidins, after 15～30 minutes, obtain having the complex of β subunit monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody composition of catching target detection thing function under the room temperature condition;
Biological dependent sensor generates step: the β monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody that adds 40 microlitres in each hole of ELISA Plate catches complex, and the good chromatoplast of 10 microlitre marks, beat mixing gently, under 40 rev/mins, 35～38 ℃ environment, hatched 1 hour, obtain can the Acquisition Detection object biological dependent sensor.
Preferably, also comprise β subunit monoclonal antibody preparation process described before catching the system construction step: be template with the Thermophilic Bacteria genome, the gene order of the β subunit by polymerase chain reaction method amplification F0F1-ATP enzyme, with the sequence of β subunit clone, heterogenous expression, purifying, obtain the β subunit monoclonal antibody of F0F1-ATP enzyme again through MONOCLONAL ANTIBODIES SPECIFIC FOR.
Compared with prior art, the present invention has the following advantages:
At first, the present invention program's detectability is low, and detection time is short.Its detectability can reach the 100cfu/ hole, calculates if press 1cfu/25g, and whole testing process is no more than 12 hours, and the Micro biological Tests method than routine shortens 60 hours at least, shortens 36 hours than PCR method; When bacteria concentration was higher than 1cfu/25g, required time was shorter, therefore, can produce profound influence to food security and the bacterium control of curing the disease.
Secondly, the required reagent of the present invention program is the conventional reagent in laboratory, can save the detection cost.
The 3rd, increase before the present invention program also has the bacterium time short, (only comprise biological dependent sensor preparation, application of sample and three steps such as startup reaction, detection, and every batch can be detected a plurality of samples) simple to operate, can avoid existing PCR detection method advantages such as false recessiveness or false positive testing result to occur because of the extraneous factor influence.
In addition, the present invention program not only can be with reference to blank group and positive controls to the cause a disease detection of mushroom of detected material, and also the curve of setting up according to the relative intensity of fluorescence of variable concentrations standard items carries out the residual class of medicine to detected material and detects.
Description of drawings
Fig. 1 is the prepared chromatoplast structural representation of biological dependent sensor preparation method one embodiment of the present invention;
Fig. 2 is that the biological dependent sensor preparation method of the present invention one embodiment pH sensitive fluorescent probe folk prescription is to mark chromatoplast process synoptic diagram;
Fig. 3 is that the biological dependent sensor preparation method of the present invention one embodiment catches system construction process synoptic diagram;
Fig. 4 is that biological dependent sensor one embodiment of the present invention is based on the model synoptic diagram of the biological dependent sensor of F0F1-ATP enzyme;
Wherein, 41-enzyme mark hole; Load has the chromatoplast of F0F1-ATP enzyme on the 42-film; The 43-F0F1-ATP enzyme; The 44-pH sensitive fluorescent probe; The β subunit monoclonal antibody of 45-F0F1-ATP enzyme; The 46-biotin; The 47-streptavidin; 48-target detection thing monoclonal antibody.
Embodiment
For above-mentioned purpose of the present invention, feature and advantage can be become apparent more, the present invention is further detailed explanation below in conjunction with the drawings and specific embodiments.
One of core idea of the present invention is: utilize the exclusive enzyme of F0F1-ATP (Adenosine-Triphosphate, adenosine triphosphate) enzyme mechanism alive to research and develop the pathogenic bacteria detection technique of high-sensitive biosensor F0F1-ATP enzyme.The F0F1-ATP enzyme is a rotation molecular motor, and it can utilize strides film H
+Gradient is synthesized ATP, again can hydrolysising ATP and antiport H
+In the ATP building-up process, proton can be from pump in the chromatoplast film to film the outside, cause inner membrance microenvironment Solution H
+Concentration change.Connecting the load meeting at the F0F1-ATP enzyme influences its verticity in various degree, connects the change difference that different loads causes the proton transport velocity at its β subunit.Fluorescence probe with the pH sensitivity comes inductive load, and its fluorescence intensity finally reaches testing goal as signal reaction and quantitative loading condition.
Among the present invention program in the biological dependent sensor biological identification element be monoclonal antibody, signal conversion element is optical element.Its ultimate principle is: test substance and the combination of molecular recognition elements specificity, biochemical reaction takes place, the biological information that produces by signal converter be converted into can quantitative Treatment light signal, amplify and output through instrument again, thereby reach the purpose of analyzing and testing.Biological dependent sensor analytical technology is compared with traditional detection method has that selectivity is good, highly sensitive, analysis speed fast, low cost and other advantages.Prevention to food security and pathogenic bacteria illness outbreak is significant.Having broad application prospects in real time and aspect the specific detection fast of food contaminant.
Biological dependent sensor and preparation method thereof embodiment:
A kind of biological dependent sensor that detects pathogenic bacteria comprises that (1) has the chromatoplast of signal transformation function.From the chromatoplast that Thermophilic Bacteria prepares, be the vesicles that the ultrasonic back of Thermophilic Bacteria cell membrane turns up and forms, the F0F1-ATP enzyme of inlaying on this vesica film also turns up thereupon---and the hydrophobic side exposes.(2) has the system of catching of molecular recognition function.This biology dependent sensor can adopt the following steps preparation:
Heterogenous expression and the purifying of the β subunit of step 1, Thermophilic Bacteria ATPase:
Be template with Thermophilic Bacteria (Thermomicrobium ATCC27502) genome, with the β subunit of PCR method amplification F0F1-ATP enzyme, then to the amplification gene order-checking and carry out sequence alignment, determine that institute's amplification gene is the β subunit of F0F1-ATP enzyme, its sequence is:
ATGACAAGAGGACGCGTTATCCAAGTCATGGGTCCGGTTGTAGACGTCAAGTTTGAGAACGGCCACTTGC
CGGCGATCTACAACGCCCTGAAAATTCAACATAAAGCGCGCAACGAAAACGAAGTCGACATCGACTTGAC
ATTGGAAGTCGCCTTGCACCTTGGCGATGATACAGTACGGACGATCGCGATGGCGTCCACAGACGGCCTC
ATCCGCGGCATGGAAGTCATCGATACCGGTGCACCGATTTCGGTGCCGGTCGGCGAAGTCACGCTTGGCC
GCGTGTTCAACGTCTTGGGCGAGCCGATCGACTTGGAAGGCGACATTCCGGCTGACGCCCGCCGCGACCC
GATTCACCGTCCGGCGCCAAAATTCGAGGAATTGGCGACGGAAGTCGAAATTTTGGAAACGGGGATTAAA
GTCGTTGACTTGCTTGCCCCGTATATTAAAGGCGGAAAAATCGGTTTGTTCGGCGGCGCTGGCGTAGGAA
AAACGGTCTTGATTCAAGAGCTGATCCACAACATCGCCCAAGAGCACGGCGGGATTTCCGTCTTTGCTGG
CGTCGGCGAACGGACGCGCGAAGGAAACGACTTGTACCATGAGATGAAAGATTCCGGCGTCATCAGCAAA
ACGGCCATGGTGTTCGGACAAATGAATGAGCCGCCGGGGGCGCGGATGCGCGTCGCCTTGACCGGCTTGA
CGATGGCCGAATACTTCCGTGATGAACAAGGCCAAGACGTGTTGCTCTTTATCGATAACATCTTCCGTTT
CACGCAGGCCGGTTCGGAAGTGTCGGCGCTG
GCATGCCGTCGGCCGTTGGTTACCAACCGACA
TTGGCGACGGAGATGGGTCAATTGCAAGAGCGGATCACGTCGACGGCGAAAGGATCGATCACCTCGATTC
AAGCGATTTACGTCCCGGCCGACGACTATACGGACCCGGCTCCGGCCACGACGTTCTCGCACTTGGATGC
GACGACGAACCTGGAGCGGAAGCTCGCGGAGATGGGGATTTATCCGGCCGTTGACCCGCTCGCTTCGACA
TCGCGTGCGTTGGCGCCGGAAATCGTCGGCGAGGAGCACTACCAAGTCGCCCGCAAAGTGCAGCAAACGC
TGCAACGTTATAAAGAATTGCAAGACATCATCGCCATCTTGGGGATGGATGAACTGTCGGATGAAGACAA
ACTCGTCGTTCATCGCGCCCGCCGCATCCAGTTCTTCTTGTCGCAAAACTTCCACGTGGCGGAGCAGTTC
ACGGGCCAACCGGGCTCCTACGTGCCGGTGAAAGAAACAGTGCGCGGCTTTAAAGAAATTTTGGAAGGCA
AATACGACCATCTTCCGGAAGATGCGTTCCGCTTAGTCGGCCGCATTGAAGAAGTCGTTGAAAAAGCGAA
AGCGATGGGTGTCGAAGTGTGA。
To this sequence molecular cloning, heterogenous expression, purifying carries out Monoclonal Antibody.The monoclonal antibody for preparing is carried out molecular sieve purification, and is standby.The β subunit that cause obtains need schedule to last the Monoclonal Antibody process about half a year, can obtain this subunit monoclonal antibody, so this step need be carried out before biological dependent sensor preparation in advance.
The preparation of step 2, chromatoplast:
Cultivate Thermophilic Bacteria (Thermomicrobium ATCC27502) 20～24h (Hour, hour) at 60～80 ℃ of high temperature shaking tables.Centrifugal 30min (Minute, minute) under 4 ℃, 4000rpm (Revolutions Per Minute, rev/min) condition abandons supernatant, the collecting precipitation thalline then.Thalline lavation buffer solution (50mmol/L tricine-NaOH, pH8.0,0.25mol/L sucrose, 4mmol/L MgCl
2Damping fluid) resuspended, centrifugal 10min under 4 ℃, 8000rpm condition, collect thalline after cleaning carry out the low temperature ultrasonication (200w, on 5s, off 9s, effective time 10min).Bacterium liquid after the ultrasonication centrifugal 30min under 4 ℃, 12000rpm condition removes cell fragment and part foreign protein, collects supernatant again at 4 ℃, carries out ultracentrifugation 1h under the 40000rpm condition, and precipitation is chromatoplast.Gained chromatoplast Tris-HCl damping fluid (20mmol/L Tris-Cl, 100mmol/L NaCl, 5mmol/L MgCl
2, 10% glycerine, pH8.0) suspension is standby.The structure of this chromatoplast comprises cell membrane turns up and forms in the ultrasonic procedure vesica and F0F1-ATP enzyme as shown in Figure 1; This vesica is not only the carrier of F0F1-ATP enzyme, and simultaneously for this enzyme provides the proton storehouse, and the inside and outside proton ladder difference of film is the power of this enzymic synthesis ATP; The F0F1-ATP enzyme comprises Cn (10≤n≤14) ring and α, β, δ, γ, ε, a, b2 subunit, and in the present invention program, active site (being on the β subunit) load target that is chosen in the F0F1-ATP enzyme detects thing.
Step 3, measure with pH sensitive fluorescent probe F1300 folk prescription hydrolysing activity behind mark chromatoplast and the mark:
Get the chromatoplast suspension 600 μ L of step 2 preparation, centrifugal 30min removes glycerine under the 12000rpm condition, and the precipitation of gained is suspended to original volume with ultrasonic damping fluid (pH5.0～6.0,0.01mmol/L Tris-HCl).Adding 1～2 μ L mass concentration then is the F1300 fluorescence probe of 1mg/mL, mixing, ultrasonic under 0～4 ℃ of water-bath (On 5s under the miniwatt, Off 8s, effective time 3min).After ultrasonic the finishing with single times of phosphate buffer (1 * PBS, Phosphate Buffered Saline) fills test tube, centrifugal 30min under 4 ℃, 12000rpm condition then, with pH8.0-8.5 damping fluid suspension precipitation, repeat 4 times, back three centrifugation times are 15min, and other conditions are constant, finally remove free F1300 probe fully, obtain the good chromatoplast of mark (hereinafter to be referred as F1300-ch).The mark flow process comprises adding ultrasonic step 22 and the free probe step 23 of centrifugal removal under fluorescence probe step 21, the low ph condition as shown in Figure 2.
Need to prove, because ultrasonic heat release, for guaranteeing 0～4 ℃ water bath condition, can be chosen in and put ice in the water.
The ATP hydrolysing activity of F1300-ch is measured can adopt enzyme coupling method, changes to measure ATPase hydrolysis vigor by detecting the absorbance of NADH at 340nm wavelength place.1 enzyme unit definition alive is hydrolyzable 1 μ mol ATP in every milligram of chromatoplast per minute.
Step 4, the structure with the system of catching of molecular recognition function:
With the monoclonal antibody (step 1 preparation) of the β subunit of F0F1-ATP enzyme and biotin, detect object monoclonal antibody and biotin be connected ratio all by mixing in 3: 2, room temperature half an hour.Wherein antibody concentration is 0.1mg/mL; Biotin concentration is 1 μ mol/L.If contain sodium azide (NaN in the storage liquid of antibody
3), adopt the phosphate buffer dialysis of pH8.0 to remove NaN before using earlier
3
The β subunit monoclonal antibody-biotin of F0F1-ATP enzyme, detect object monoclonal antibody-biotin two complexs by behind 1: 1 volume ratio mixing, add the streptavidin of 1.1 times of volume 1 μ mol, room temperature 15～30min.Obtain having the complex of β subunit monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody composition of catching the target detection thing.Above-mentioned building process of catching system as shown in Figure 3.
Finishing of step 5, biological dependent sensor:
Add 40 μ L β monoclonal antibody-biotin-streptavidin-biotins-target detection thing monoclonal antibody and catch complex in the every hole of ELISA Plate, 10 μ lL F1300-ch beat mixing gently.Under 40rpm, 35～38 ℃ of (preferably adopting 37 ℃) conditions, hatch 1h, obtain can the Acquisition Detection target biological dependent sensor, the structural representation of this biology dependent sensor is as shown in Figure 4.
Utilize the method embodiment of pathogenic bacteria in the biological dependent sensor test sample:
Step 1, sample pretreatment
Test sample with reference to the preparation of GB/T 4789.30 regulated procedures is carried out inactivation treatment, get the sample solution after the deactivation of 1～10mL concussion mixing, carrying out the centrifuging of 4000rpm, 30min handles, the bacterial sediment that obtains is suspended to original volume with stroke-physiological saline solution, after repeating above-mentioned separation and suspension process 1 time or 2 times again, sample solution after the concussion mixing suspends forms sample detection liquid.
Need to prove that the temperature of different pathogenic bacteria deactivations all is different with the time that needs deactivation, need to select the gentleest deactivation condition, guarantee its destruction is reduced to bottom line, as: 55 ℃ of O157:H7 bacterium, 5～20min get final product deactivation; Singly increase 70～80 ℃ of Liszts, 20～30min gets final product deactivation; And staphylococcus aureus generally needs 80 ℃, 1h deactivation.
Catching of step 2, detection thing
Each enzyme mark hole in ELISA Plate adds the biological dependent sensor that the aforementioned biological dependent sensor preparation process of 10 μ L prepares, and adds 20 μ L～100 μ L sample preparation liquid again.Blank and standard items positive control are set simultaneously, hatch 25～35min (preferably adopt 37 ℃ and hatch 30min), Acquisition Detection object for 35 ℃～38 ℃.
Step 3, detection
Add 70 μ L ATP synthetic damping fluid (50mmol/L Tricine-NaOHpH8.0,10% glycerine, 5mmol/L NaH again in every hole of ELISA Plate
2PO
4, 5mmol/L MgCl
2, facing with preceding adding final concentration is 2mmol adenosine diphosphate ADP) and start the ATP synthetic reaction, 38～45 ℃ of temperature are bathed 10～15min (preferably adopting 45 ℃ of temperature to bathe 15min) back and are detected selective excitation wavelength 485nm, emission wavelength 538nm with the fluorescent scanning instrument.
Step 4, data are handled
With reference to blank group and positive controls the pathogenic bacteria that detect in the thing are qualitatively judged.
Need to prove, by the present invention program, can also quantitatively judge microbiotic, the residual situation of medicine in the food according to the typical curve that the relative intensity of fluorescence of variable concentrations standard items is set up.
Below, be example with the detection method of Listeria monocytogenes in the food, specify the method for utilizing biological dependent sensor to detect food-borne pathogens, comprising:
Step 1, sample pretreatment:
With reference to GB/T 4789.30 regulated procedures, the preparation test sample, and increase the bacterium cultivation;
Wherein, the processing procedure that increases bacterium is specially:
60～70 ℃ of enrichment liquids, carry out 5～20min deactivation, get the enrichment liquid after the deactivation of 1～10mL concussion mixing then, under 4000rpm, 30min condition, separate, the gained bacterial sediment is suspended to original volume with stroke-physiological saline solution, twice of repetitive operation separation and suspension process.The centrifugal thalline that obtains is suspended to original volume with stroke-physiological saline solution for the third time, the concussion mixing, and liquid is standby as detecting.
Step 2, positive control:
Cultivate reference culture (ATCC15313) 18～24h, with coated plate counting behind the bacterium liquid gradient dilution, the standard bacterial concentration of calculating is 5.03 * 10
8Cfu/mL, reference culture liquid increase the bacterium processing procedure and aforementioned to increase the bacterium process identical.Gradient dilution obtained 5 * 10 after the thalline of precipitation returned to original volume
3, 5 * 10
4, 5 * 10
5The positive control of cfu/mL.
Need to prove, because the pathogenic bacteria detection is qualitative detection, only need one group of positive control to get final product theoretically, design a plurality of positive controls here, is for the feasibility of the technical program better is described.
The preparation of step 3, F0F1-ATP enzyme immunity biosensor:
At first, be prepared chromatoplast, and carry out fluorescence labeling, concrete steps are:
Cultivate Thermophilic Bacteria (Thermomicrobium ATCC27502) 24h at 60 ℃ of high temperature shaking tables, centrifugal 30min under 4 ℃, the condition of 4000rpm abandons supernatant then, collects thalline; The thalline that obtains lavation buffer solution (50mmol/L tricine-NaOH, pH8.0,0.25mol/L sucrose, 4mmol/L MgCl
2Damping fluid) resuspended, centrifugal 10min under 4 ℃, the condition of 8000rpm collects the thalline after cleaning then, is 200w, ON 5s, OFF 9s, effective time to be to carry out the low temperature ultrasonication under the condition of 10min at power; Centrifugal 30min under 4 ℃, the condition of 12000rpm removes cell fragment and part foreign protein with the bacterium liquid after the ultrasonication, collect supernatant again at 4 ℃, ultracentrifugation 1h under the condition of 40000rpm, to precipitate with Tris-HCl damping fluid (20mmol/L Tris-Cl, 100mmol/L NaCl, 5mmol/L MgCl
2, 10% glycerine pH8.0) suspends, and obtains the chromatoplast suspension,
PH sensitive fluorescent probe markers step: get chromatoplast suspension 600 μ L, centrifugal 30min removes glycerine under the condition of 12000rpm, the precipitation that obtains with ultrasonic damping fluid (pH5.0～6.0,0.01mmol/LTris-HCl) ultrasound suspending is to original volume; Add the pH sensitive fluorescent probe F1300 that 1 μ L mass concentration is 1mg/mL then, mixing, ON 5s, OFF 8s, effective time are that water-bath is ultrasonic under the condition of 3min under miniwatt, fill test tube with ultrasonic damping fluid; Centrifugal 30min under 4 ℃, the condition of 12000rpm then, damping fluid suspension precipitation with pH8.0～8.5, repeat centrifugal, suspension process 4 times, the centrifugation time that the back is three times is 15min, other conditions are constant, the final pH sensitive fluorescent probe that dissociates of removing fully obtains the good chromatoplast of mark;
Secondly, be the establishment step of the system of catching:
With the monoclonal antibody of the β subunit of F0F1-ATP enzyme and biotin, detect object monoclonal antibody and biotin all in 3: 2 be connected the ratio mixing, make the concentration of two kinds of antibody be to 0.1mg/mL, biotin concentration are 1 μ mol/L, wait for half an hour under the room temperature condition; Then, with the β subunit monoclonal antibody-biotin complex of F0F1-ATP enzyme, detect object monoclonal antibody-biotin complex by behind 1: 1 the volume ratio mixing, add 1.1 times of volume 1 micromolar streptavidins, behind following 15 minutes of the room temperature condition, obtain having the complex of β subunit monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody composition of catching the target detection thing;
Finishing of the 3rd, F0F1-ATP enzyme immunity biosensor:
Biological dependent sensor generates step: the β monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody that adds 40 μ L in each hole of ELISA Plate catches complex, and the good chromatoplast of 10 μ L marks, beat mixing gently, under 40rpm, 35～38 ℃ of environment, hatch 1h, obtain can the Acquisition Detection object biological dependent sensor.
Step 4, detection:
At first, application of sample in the enzyme mark hole of ELISA Plate comprises:
Sample detection liquid, 5 * 10
3Cfu/mL positive control, 5 * 10
4Cfu/mL positive control, 5 * 10
5Totally five groups of the positive control of cfu/mL, blanks (stroke-physiological saline solution) are selected Britain Corning company ELISA Plate for use, and every group arranges 10 parallel holes, and every hole adds 20 μ L, five groups of respectively corresponding " unknown number " cfu/ holes, 10
2The cfu/ hole, 10
3The cfu/ hole, 10
430min is hatched for 37 ℃ in cfu/ hole and 0cfu/ hole.
Then, start synthetic reaction and record testing result
Every hole adds ATP synthetic damping fluid (50mmol/LTricine pH8.0,10% glycerine, the 5mmol/L NaH that 70 μ L final concentrations are 2mmol/L ADP again
2PO
4, 5mmol/L MgCl
2) starting the ATP synthetic reaction, 45 ℃ of temperature are bathed 15min, and selective excitation wavelength 485nm, emission wavelength 538nm react the detection of back relative fluorescence value.
Step 5, testing result are as follows:
| Group | Blank 0cfu/ hole | Positive control 10 2The cfu/ hole | Positive control 10 3The cfu/ hole | Positive control 10 4The cfu/ hole | Sample sets |
| The relative fluorescence value | 0.115363 | 0.114175 | 0.11295 | 0.111617 | 0.115358 |
Be not difficult to find out that from above-mentioned testing result this test result of samples is not for detecting Listeria monocytogenes.
For aforesaid each method embodiment, simple in order to describe, so it all is expressed as a series of combination of actions, but those skilled in the art should know, the present invention is not subjected to the restriction of described sequence of movement, because according to the present invention, some step can adopt other orders or carry out simultaneously.Secondly, those skilled in the art should know that also said method embodiment all belongs to preferred embodiment, and related action and instrument might not be that the present invention is necessary.
More than a kind of method that rapidly and efficiently detects pathogenic bacteria provided by the present invention, biology sensor and preparation method thereof are described in detail, used specific case herein principle of the present invention and embodiment are set forth, the explanation of above embodiment just is used for helping to understand method of the present invention and core concept thereof; Simultaneously, for one of ordinary skill in the art, according to thought of the present invention, the part that all can change in specific embodiments and applications, in sum, this description should not be construed as limitation of the present invention.
Claims (9)
1. a method that rapidly and efficiently detects pathogenic bacteria is characterized in that, comprising:
Biological dependent sensor preparation process: the chromatoplast that in each enzyme mark hole of ELISA Plate, forms and be marked with the pH sensitive fluorescent probe after with the Thermophilic Bacteria ultrasonication, the seizure complex of forming with β subunit monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody mixes by the volume ratio of 4:1, under 40 rev/mins, 35～38 ℃ conditions, hatched 1 hour, obtain having the biological dependent sensor of the target of catching inspection thing ability;
Detect thing and catch step: each the enzyme mark hole in ELISA Plate adds the biological dependent sensor that 10 microlitres prepare, add 20～100 microlitre sample detection liquid again, blank and standard items positive control are set simultaneously, under 35～38 ℃ of conditions, hatched 25～35 minutes, catch the target detection thing;
Detect step: add the synthetic damping fluid of 70 microlitre adenosine triphosphates again in each enzyme mark hole of ELISA Plate and start the adenosine triphosphate synthetic reaction, after temperature is bathed 10～15 minutes under 38～45 ℃ of temperature, detect with the fluorescent scanning instrument; Wherein, detecting the excitation wavelength of using the fluorescent scanning instrument is that 485 nanometers, emission wavelength are 538 nanometers; The synthetic damping fluid of described adenosine triphosphate comprise concentration be 50 mMs/liter, the pH value is 8.0 ion buffer, 10% glycerine, concentration be 5 mMs/liter sodium dihydrogen phosphate, concentration be 5 mMs/liter magnesium chloride, face the adenosine diphosphate with preceding adding 2 mMs;
Wherein, described biological dependent sensor comprises the chromatoplast with signal transformation function and has the system of catching of molecular recognition function that the preparation method of described biological dependent sensor specifically comprises:
The chromatoplast preparation process: cultivated Thermophilic Bacteria 20～24 hours at 60～80 ℃ of high temperature shaking tables, under 4 ℃, 4000 rev/mins condition centrifugal 30 minutes then, abandon supernatant, collect thalline; The thalline that obtains is resuspended with lavation buffer solution, under 4 ℃, 8000 rev/mins condition centrifugal 10 minutes then, thalline after collect cleaning is that 200 watts, circulation connect that to disconnect 9 seconds, effective time in 5 seconds be to carry out the low temperature ultrasonication under 10 minutes the condition at power; Bacterium liquid after the ultrasonication was removed cell fragment and most of foreign protein in centrifugal 30 minutes under 4 ℃, 12000 rev/mins condition, collect supernatant again at 4 ℃, ultracentrifugation is 1 hour under 40000 rev/mins the condition, to precipitate with the tris-HCI buffer suspension, obtain the chromatoplast suspension; Wherein, described lavation buffer solution comprise concentration be 50 mMs/liter three (methylol) methylglycine, concentration be the sucrose of 0.25 mol and concentration be 4 mMs/liter magnesium chloride, NaOH adjust pH to 8.0; Described hydroxymethyl aminomethane-hydrochloride buffer comprise concentration be 20 mMs/liter hydroxymethyl aminomethane, concentration be 100 mMs/liter sodium chloride, concentration be 5 mMs/liter magnesium chloride and concentration be 10% glycerine, hydrogen chloride adjust pH to 8.0;
PH sensitive fluorescent probe markers step: get chromatoplast suspension 600 microlitres, removed glycerine in centrifugal 30 minutes under 12000 rev/mins condition, the precipitation that obtains is suspended to original volume with ultrasonic damping fluid; Add the pH sensitive fluorescent probe that 1～2 microlitre mass concentration is 1 mg/ml then, mixing connects in circulation that to disconnect 8 second effective time in 5 seconds be that water-bath is ultrasonic under 3 minutes the condition, fills test tube with ultrasonic damping fluid; Under 4 ℃, 12000 rev/mins condition centrifugal 30 minutes then, damping fluid suspension precipitation with pH8.0～8.5, repeat centrifugal, suspension process 4 times, the centrifugation time that the back is three times is 15 minutes, other conditions are constant, the final pH sensitive fluorescent probe that dissociates of removing fully obtains the good chromatoplast of mark; Wherein, described ultrasonic damping fluid be pH value 5.0～6.0, concentration be 0.01 mM/liter tris-HCI buffer;
Catch the construction step of system: monoclonal antibody and the biotin of the β subunit of F0F1-ATP enzyme, the monoclonal antibody and the biotin that detect object all are connected the ratio mixing in 3:2, make the concentration of two kinds of antibody be 0.1 mg/ml, biotin concentration is 1 micromoles per liter, waits for half an hour under the room temperature condition; Then, with the β subunit monoclonal antibody-biotin complex of F0F1-ATP enzyme, detect object monoclonal antibody-the biotin complex pressed the volume ratio mixing of 1:1 after, add 1.1 times of streptavidins that volumetric concentration is 1 micromoles per liter, after 15～30 minutes, obtain the seizure complex that β subunit monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody is formed under the room temperature condition;
Biological dependent sensor generates step: the β monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody that adds 40 microlitres in each hole of ELISA Plate catches complex, and the good chromatoplast of 10 microlitre marks, beat mixing gently, under 40 rev/mins, 35～38 ℃ environment, hatched 1 hour, obtain can the Acquisition Detection object biological dependent sensor.
2. detection method as claimed in claim 1, it is characterized in that, before catching step, described detection thing also comprises the sample pretreatment step: will carry out inactivation treatment by the test sample of standard handler preparation, get 1～10 milliliter the concussion mixing deactivation after sample solution, the centrifuging of carrying out 4000 rev/mins, 30 minutes is handled, the bacterial sediment that obtains is suspended to original volume with stroke-physiological saline solution, after repeating above-mentioned separation and suspension process 1 time or 2 times again, sample solution after the concussion mixing suspends forms sample detection liquid.
3. detection method as claimed in claim 1 is characterized in that, also comprises data processing step after described detection step: whether the blank group of reference and positive controls contain pathogenic bacteria to test sample qualitatively judges.
4. detection method as claimed in claim 1, it is characterized in that, also comprise β subunit monoclonal antibody preparation process described before catching the system construction step: be template with the Thermophilic Bacteria genome, the gene order of the β subunit by polymerase chain reaction method amplification F0F1-ATP enzyme, with the sequence of β subunit clone, heterogenous expression, purifying, obtain the β subunit monoclonal antibody of F0F1-ATP enzyme at last by MONOCLONAL ANTIBODIES SPECIFIC FOR.
5. detection method as claimed in claim 4 is characterized in that, the sequence of the β subunit of described F0F1-ATP enzyme is:
ATGACAAGAGGACGCGTTATCCAAGTCATGGGTCCGGTTGTAGACGTCAAGTTTGAGAACGGCCACTTGC
CGGCGATCTACAACGCCCTGAAAATTCAACATAAAGCGCGCAACGAAAACGAAGTCGACATCGACTTGAC
ATTGGAAGTCGCCTTGCACCTTGGCGATGATACAGTACGGACGATCGCGATGGCGTCCACAGACGGCCTC
ATCCGCGGCATGGAAGTCATCGATACCGGTGCACCGATTTCGGTGCCGGTCGGCGAAGTCACGCTTGGCC
GCGTGTTCAACGTCTTGGGCGAGCCGATCGACTTGGAAGGCGACATTCCGGCTGACGCCCGCCGCGACCC
GATTCACCGTCCGGCGCCAAAATTCGAGGAATTGGCGACGGAAGTCGAAATTTTGGAAACGGGGATTAAA
GTCGTTGACTTGCTTGCCCCGTATATTAAAGGCGGAAAAATCGGTTTGTTCGGCGGCGCTGGCGTAGGAA
AAACGGTCTTGATTCAAGAGCTGATCCACAACATCGCCCAAGAGCACGGCGGGATTTCCGTCTTTGCTGG
CGTCGGCGAACGGACGCGCGAAGGAAACGACTTGTACCATGAGATGAAAGATTCCGGCGTCATCAGCAAA
ACGGCCATGGTGTTCGGACAAATGAATGAGCCGCCGGGGGCGCGGATGCGCGTCGCCTTGACCGGCTTGA
CGATGGCCGAATACTTCCGTGATGAACAAGGCCAAGACGTGTTGCTCTTTATCGATAACATCTTCCGTTT
CACGCAGGCCGGTTCGGAAGTGTCGGCGCTGTTAGGCCGCATGCCGTCGGCCGTTGGTTACCAACCGACA
TTGGCGACGGAGATGGGTCAATTGCAAGAGCGGATCACGTCGACGGCGAAAGGATCGATCACCTCGATTC
AAGCGATTTACGTCCCGGCCGACGACTATACGGACCCGGCTCCGGCCACGACGTTCTCGCACTTGGATGC
GACGACGAACCTGGAGCGGAAGCTCGCGGAGATGGGGATTTATCCGGCCGTTGACCCGCTCGCTTCGACA
TCGCGTGCGTTGGCGCCGGAAATCGTCGGCGAGGAGCACTACCAAGTCGCCCGCAAAGTGCAGCAAACGC
TGCAACGTTATAAAGAATTGCAAGACATCATCGCCATCTTGGGGATGGATGAACTGTCGGATGAAGACAA
ACTCGTCGTTCATCGCGCCCGCCGCATCCAGTTCTTCTTGTCGCAAAACTTCCACGTGGCGGAGCAGTTC
ACGGGCCAACCGGGCTCCTACGTGCCGGTGAAAGAAACAGTGCGCGGCTTTAAAGAAATTTTGGAAGGCA
AATACGACCATCTTCCGGAAGATGCGTTCCGCTTAGTCGGCCGCATTGAAGAAGTCGTTGAAAAAGCGAA
AGCGATGGGTGTCGAAGTGTGA。
6. detection method as claimed in claim 1 is characterized in that, before described construction step of catching system, also comprises:
Whether the monoclonal antibody solution of judging the β subunit monoclonal antibody solution of described F0F1-ATP enzyme and detecting object contains sodium azide, if then use the phosphate buffer dialysis of pH8.0 to remove wherein sodium azide.
7. one kind is used for the biological dependent sensor that pathogenic bacteria detect, and it is characterized in that, comprises the chromatoplast with signal transformation function and the system of catching with molecular recognition function, wherein:
Described chromatoplast is the vesicles that the ultrasonic back of Thermophilic Bacteria cell membrane turns up and forms, and is inlaid with the F0F1-ATP enzyme on the film of this vesicles, and the chromatoplast cell inner mark has the pH sensitive fluorescent probe;
The described system of catching is the β subunit monoclonal antibody of F0F1-ATP enzyme and the complex that biotin is connected to form, and, detect the complex that object monoclonal antibody and biotin are connected to form, connect the β subunit monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody that obtains by streptavidin and have the complex of capture function;
Described biological dependent sensor adopts following method preparation:
The chromatoplast preparation process: cultivated Thermophilic Bacteria 20～24 hours at 60～80 ℃ of high temperature shaking tables, under 4 ℃, 4000 rev/mins condition centrifugal 30 minutes then, abandon supernatant, collect thalline; The thalline that obtains is resuspended with lavation buffer solution, under 4 ℃, 8000 rev/mins condition centrifugal 10 minutes then, thalline after collect cleaning is that 200 watts, circulation connect that to disconnect 9 seconds, effective time in 5 seconds be to carry out the low temperature ultrasonication under 10 minutes the condition at power; Bacterium liquid after the ultrasonication was removed cell fragment and most of foreign protein in centrifugal 30 minutes under 4 ℃, 12000 rev/mins condition, collect supernatant again at 4 ℃, ultracentrifugation is 1 hour under 40000 rev/mins the condition, to precipitate with the tris-HCI buffer suspension, obtain the chromatoplast suspension; Wherein, described lavation buffer solution comprise concentration be 50 mMs/liter three (methylol) methylglycine, concentration be the sucrose of 0.25 mol and concentration be 4 mMs/liter magnesium chloride, NaOH adjust pH to 8.0; Described hydroxymethyl aminomethane-hydrochloride buffer comprise concentration be 20 mMs/liter hydroxymethyl aminomethane, concentration be 100 mMs/liter sodium chloride, concentration be 5 mMs/liter magnesium chloride and concentration be 10% glycerine, hydrogen chloride adjust pH to 8.0;
PH sensitive fluorescent probe markers step: get chromatoplast suspension 600 microlitres, removed glycerine in centrifugal 30 minutes under 12000 rev/mins condition, the precipitation that obtains is suspended to original volume with ultrasonic damping fluid; Add the pH sensitive fluorescent probe that 1～2 microlitre mass concentration is 1 mg/ml then, mixing connects in circulation that to disconnect 8 second effective time in 5 seconds be that water-bath is ultrasonic under 3 minutes the condition, fills test tube with ultrasonic damping fluid; Under 4 ℃, 12000 rev/mins condition centrifugal 30 minutes then, damping fluid suspension precipitation with pH8.0～8.5, repeat centrifugal, suspension process 4 times, the centrifugation time that the back is three times is 15 minutes, other conditions are constant, the final pH sensitive fluorescent probe that dissociates of removing fully obtains the good chromatoplast of mark; Wherein, described ultrasonic damping fluid be pH value 5.0～6.0, concentration be 0.01 mM/liter tris-HCI buffer;
Catch the construction step of system: monoclonal antibody and the biotin of the β subunit of F0F1-ATP enzyme, the monoclonal antibody and the biotin that detect object all are connected the ratio mixing in 3:2, make the concentration of two kinds of antibody be 0.1 mg/ml, biotin concentration is 1 micromoles per liter, waits for half an hour under the room temperature condition; Then, with the β subunit monoclonal antibody-biotin complex of F0F1-ATP enzyme, detect object monoclonal antibody-the biotin complex pressed the volume ratio mixing of 1:1 after, add 1.1 times of streptavidins that volumetric concentration is 1 micromoles per liter, after 15～30 minutes, obtain the seizure complex that β subunit monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody is formed under the room temperature condition;
Biological dependent sensor generates step: the β monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody that adds 40 microlitres in each hole of ELISA Plate catches complex, and the good chromatoplast of 10 microlitre marks, beat mixing gently, under 40 rev/mins, 35～38 ℃ environment, hatched 1 hour, obtain can the Acquisition Detection object biological dependent sensor.
8. a preparation method who is used for the biology sensor of food safety detection is characterized in that, comprising:
The chromatoplast preparation process: cultivated Thermophilic Bacteria 20～24 hours at 60～80 ℃ of high temperature shaking tables, under 4 ℃, 4000 rev/mins condition centrifugal 30 minutes then, abandon supernatant, collect thalline; The thalline that obtains is resuspended with lavation buffer solution, under 4 ℃, 8000 rev/mins condition centrifugal 10 minutes then, thalline after collect cleaning is that 200 watts, circulation connect that to disconnect 9 seconds, effective time in 5 seconds be to carry out the low temperature ultrasonication under 10 minutes the condition at power; Bacterium liquid after the ultrasonication was removed cell fragment and part foreign protein in centrifugal 30 minutes under 4 ℃, 12000 rev/mins condition, collect supernatant again at 4 ℃, ultracentrifugation is 1 hour under 40000 rev/mins the condition, to precipitate with hydroxymethyl aminomethane-hydrochloride buffer suspension, obtain the chromatoplast suspension; Wherein, described lavation buffer solution comprise 50 mMs/liter three (methylol) methylglycine, concentration be the sucrose of 0.25 mol and concentration be 4 mMs/liter magnesium chloride, NaOH adjust pH to 8.0; Described hydroxymethyl aminomethane-hydrochloride buffer comprise concentration be 20 mMs/liter hydroxymethyl aminomethane, concentration be 100 mMs/liter sodium chloride, concentration be 5 mMs/liter magnesium chloride and concentration be 10% glycerine, hydrogen chloride adjust pH to 8.0;
PH sensitive fluorescent probe markers step: get chromatoplast suspension 600 microlitres, removed glycerine in centrifugal 30 minutes under 12000 rev/mins condition, the precipitation that obtains is suspended to original volume with ultrasonic damping fluid; Add the pH sensitive fluorescent probe that 1～2 microlitre mass concentration is 1 mg/ml then, mixing, connecting in circulation that to disconnect 8 second effective time in 5 seconds be to carry out under 0～4 ℃ of water-bath ultrasonicly under 3 minutes the condition, is that the phosphate buffer of 10 mMs fills test tube with concentration afterwards; Under 4 ℃, 12000 rev/mins condition centrifugal 30 minutes then, damping fluid suspension precipitation with pH8.0～8.5, repeat centrifugal, suspension process 4 times, the centrifugation time that the back is three times is 15 minutes, other conditions are constant, the final pH sensitive fluorescent probe that dissociates of removing fully obtains the good chromatoplast of mark; Wherein, described ultrasonic damping fluid be pH value 5.0～6.0, concentration be 0.01 mM/liter TRIS buffer;
Catch the construction step of system: monoclonal antibody and the biotin of the β subunit of F0F1-ATP enzyme, the monoclonal antibody and the biotin that detect object all are connected the ratio mixing in 3:2, making the concentration of two kinds of antibody be is that 0.1 mg/ml, biotin concentration are 1 micromoles per liter, waits for half an hour under the room temperature condition; Then, with the β subunit monoclonal antibody-biotin complex of F0F1-ATP enzyme, detect object monoclonal antibody-the biotin complex pressed the volume ratio mixing of 1:1 after, add 1.1 times of volume 1 micromolar streptavidins, after 15～30 minutes, obtain β subunit monoclonal antibody-biotin-streptavidin-biotin-target detection thing monoclonal antibody and catch complex under the room temperature condition;
Biological dependent sensor generates step: the complex that adds the β monoclonal antibody-biotin-streptavidin with capturing function-biotin-target detection thing monoclonal antibody composition of 40 microlitres in each hole of ELISA Plate, and the good chromatoplast of 10 microlitre marks, beat mixing gently, under 40 rev/mins, 35～38 ℃ environment, hatched 1 hour, obtain can the Acquisition Detection object biological dependent sensor.
9. preparation method as claimed in claim 8, it is characterized in that, also comprise β subunit monoclonal antibody preparation process described before catching the system construction step: be template with the Thermophilic Bacteria genome, the gene order of the β subunit by polymerase chain reaction method amplification F0F1-ATP enzyme, the sequence of β subunit is carried out heterogenous expression, purifying, obtain the β subunit monoclonal antibody of F0F1-ATP enzyme through MONOCLONAL ANTIBODIES SPECIFIC FOR.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010150617 CN102221610B (en) | 2010-04-16 | 2010-04-16 | Method for rapidly detecting pathogenic bacteria at high efficiency, biological dependent sensor and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010150617 CN102221610B (en) | 2010-04-16 | 2010-04-16 | Method for rapidly detecting pathogenic bacteria at high efficiency, biological dependent sensor and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102221610A CN102221610A (en) | 2011-10-19 |
| CN102221610B true CN102221610B (en) | 2013-08-14 |
Family
ID=44778217
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010150617 Expired - Fee Related CN102221610B (en) | 2010-04-16 | 2010-04-16 | Method for rapidly detecting pathogenic bacteria at high efficiency, biological dependent sensor and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102221610B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107460119B (en) * | 2016-05-30 | 2020-10-23 | 华南农业大学 | Equipment and method for monitoring bacterial growth |
| CN110596375B (en) * | 2019-10-17 | 2022-12-27 | 清华大学深圳国际研究生院 | Microporous plate and high-sensitivity immunofluorescence detection method based on microporous plate |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005016533A2 (en) * | 2003-08-14 | 2005-02-24 | Arizona Board Of Regents | Method and apparatus for nanomotors in microfluidic devices |
| CN1789425A (en) * | 2004-12-16 | 2006-06-21 | 中国科学院生物物理研究所 | Micro-power biological sensor with adjustable molecular motor |
| JP2007151498A (en) * | 2005-12-07 | 2007-06-21 | Hamamatsu Photonics Kk | Linking molecule motor and atp sensor |
| CN101334361A (en) * | 2007-06-28 | 2008-12-31 | 中国科学院生物物理研究所 | ATP motor rotary type biosensor single molecule analysis and separation technology and method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6989235B2 (en) * | 2002-02-13 | 2006-01-24 | Motorola, Inc. | Single molecule detection of bio-agents using the F1-ATPase biomolecular motor |
-
2010
- 2010-04-16 CN CN 201010150617 patent/CN102221610B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005016533A2 (en) * | 2003-08-14 | 2005-02-24 | Arizona Board Of Regents | Method and apparatus for nanomotors in microfluidic devices |
| CN1789425A (en) * | 2004-12-16 | 2006-06-21 | 中国科学院生物物理研究所 | Micro-power biological sensor with adjustable molecular motor |
| JP2007151498A (en) * | 2005-12-07 | 2007-06-21 | Hamamatsu Photonics Kk | Linking molecule motor and atp sensor |
| CN101334361A (en) * | 2007-06-28 | 2008-12-31 | 中国科学院生物物理研究所 | ATP motor rotary type biosensor single molecule analysis and separation technology and method |
Non-Patent Citations (6)
| Title |
|---|
| F0F1-ATP合酶的纯化和应用研究;李宁;《中国优秀硕士学位论文全文数据库》;20090922 * |
| 光驱动F0F1-ATP合酶复合物顺时针旋转的观察;崔元波等;《科学通报》;20040531;第49卷(第10期);971-976 * |
| 吕会田等.旋转生物传感器高灵敏检测盐酸克伦特罗方法研究.《食品科学》.2007,第28卷(第8期),446-450. |
| 崔元波等.光驱动F0F1-ATP合酶复合物顺时针旋转的观察.《科学通报》.2004,第49卷(第10期),971-976. |
| 旋转生物传感器高灵敏检测盐酸克伦特罗方法研究;吕会田等;《食品科学》;20070430;第28卷(第8期);446-450 * |
| 李宁.F0F1-ATP合酶的纯化和应用研究.《中国优秀硕士学位论文全文数据库》.2009, |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102221610A (en) | 2011-10-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Medlin et al. | Molecular techniques for the detection of organisms in aquatic environments, with emphasis on harmful algal bloom species | |
| Wang et al. | Past, present and future applications of flow cytometry in aquatic microbiology | |
| JP5903492B2 (en) | Molecular diagnostic assay device and method of use | |
| Stokes et al. | Detection of E. coli using a microfluidics-based antibody biochip detection system | |
| CN109207567B (en) | Method for determining staphylococcus aureus based on aptamer and strand displacement amplification reaction | |
| CN104379760A (en) | Sample preparation for flow cytometry | |
| CN103436608B (en) | Rapid detection method based on nucleic acid aptamers and kit | |
| Spatola Rossi et al. | Microfluidics for rapid detection of live pathogens | |
| CN103725686A (en) | Aptamer AFB1-20 of aflatoxin B1 and application thereof | |
| CN102221610B (en) | Method for rapidly detecting pathogenic bacteria at high efficiency, biological dependent sensor and preparation method thereof | |
| CN111197110A (en) | RPA-FLD method for detecting feline panleukopenia virus | |
| Li et al. | A CRISPR/dCas9‐enabled, on‐site, visual, and bimodal biosensing strategy for ultrasensitive and self‐validating detection of foodborne pathogenic bacteria | |
| Papkovsky et al. | Oxygen sensor-based respirometry and the landscape of microbial testing methods as applicable to food and beverage matrices | |
| Singh et al. | Evaluation of biomass | |
| EP0441469A1 (en) | Immunospecific and bioluminescent assay of cellular ATP | |
| US11479801B2 (en) | Biologic machines for the detection of biomolecules | |
| CN102879565B (en) | Microorganism sample rapid detection method and detection device thereof | |
| CN202870095U (en) | Device for rapid detection of microorganism samples | |
| VARSHNEY et al. | A chemiluminescence biosensor coupled with immunomagnetic separation for rapid detection of Salmonella typhimurium | |
| CN101498733A (en) | Protein suspending chip for composite detection of multiple kinds of pathogens, its production method and detection method | |
| CN106636474A (en) | Primer group, kit and method for detecting six mouse viruses by multiple immunity fluorescence | |
| Xia et al. | Combination of RCA and DNAzyme for dual-signal isothermal amplification of exosome RNA | |
| Zhang et al. | Point‐of‐care CRISPR/Cas biosensing technology: A promising tool for preventing the possible COVID‐19 resurgence caused by contaminated cold‐chain food and packaging | |
| Logue et al. | Rapid microbiological methods in food diagnostics | |
| CN112251493B (en) | Substance detection method based on fluorescence resonance energy transfer and exonuclease-assisted cyclic amplification strategy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130814 Termination date: 20160416 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |