CN102220419B - Nested PCR (Polymerase Chain Reaction) detection and fluorescence PCR detection kit for universal type malaria and subtypes thereof - Google Patents
Nested PCR (Polymerase Chain Reaction) detection and fluorescence PCR detection kit for universal type malaria and subtypes thereof Download PDFInfo
- Publication number
- CN102220419B CN102220419B CN2011101055722A CN201110105572A CN102220419B CN 102220419 B CN102220419 B CN 102220419B CN 2011101055722 A CN2011101055722 A CN 2011101055722A CN 201110105572 A CN201110105572 A CN 201110105572A CN 102220419 B CN102220419 B CN 102220419B
- Authority
- CN
- China
- Prior art keywords
- malaria
- primer
- pcr
- detects
- nest
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides a nested PCR (Polymerase Chain Reaction) detection and fluorescence PCR detection kit for universal type malaria and subtypes thereof. The kit comprises a PCR buffer solution and a Taq DNA (Deoxyribonucleic Acid) polymerase mixture, and primers and probes shown as SEQ ID NO:1-26. The kit can be used for detecting plasmodium specificity and plasmodium subtypes such as malignant malaria, tertian malaria, ovale malaria, quartan malaria and the like. A domestic rare imported ovale malaria case is found with the help of the kit. The kit can be applied to the malarious detection in clinic and port.
Description
Technical field
The invention belongs to the molecular Biological Detection field, the nest-type PRC that is particularly related to the universal and somatotype of a kind of malaria detects and fluorescence PCR detection reagent kit, and this test kit can detect four kinds of plasmodium species specificity such as plasmodium specificity and subtertian malaria, vivax malaria, ovale malaria, quartan malaria.
Background technology
The malaria diagnosis gold standard is microscopy, and it not only needs the operator to have rich experience, and when parasitemia densities was low, failing to pinpoint a disease in diagnosis easily appearred in microscopy; Even experienced professional microscopy person detects protozoon low density sample, the susceptibility of microscopy and specificity also can significantly descend.For domestic rare ovale malaria and quartan malaria, easily misjudge.The limitation of tradition Microscopical Method For Detection and skilled microscopy personnel's shortage cause making a definite diagnosis of case survey of malaria and defficulty in diagnosing, become challenge new in Surveillance On Malaria.And when plasmodium polyinfection occurs, microscopy is difficult for the ring bodies of the ring bodies of subtertian malaria or early stage trophont and vivax malaria is distinguished, and particularly after medication, the polypide form changes, and it is more difficult that the worm kind is differentiated, mistaken diagnosis easily occurs, affected like this treatment after the Infected With Plasmodium.Therefore, use traditional Microscopical Method For Detection to make " gold " standard and be difficult to the higher diagnostic method of assess effectiveness.
Recent domestic is applied to nest-type PRC and real-time fluorescence PCR technology rapid detection and the somatotype of malaria, it can judge accurately whether suspected case is infected with malaria or carries plasmodium, in order in time find and take necessary prevention and control measure, preventing this transmissible disease importing into and spreading out of in the frontier port.But, also lack at present method and the test kit of four kinds of plasmodium somatotypes such as can detecting plasmodium specificity and subtertian malaria, vivax malaria, ovale malaria, quartan malaria.
Summary of the invention
The invention provides nest-type PRC and the fluorescence PCR detection reagent kit of the universal and somatotype of a kind of malaria, this test kit can detect four kinds of plasmodium somatotypes such as plasmodium specificity and subtertian malaria, vivax malaria, ovale malaria, quartan malaria, detects with this test kit and has also found an avette case survey of malaria of the domestic rare Introduced cases of example.
The present invention adopts following technical scheme:
Malaria of the present invention nest-type PRC universal and somatotype detects and fluorescence PCR detection reagent kit, comprise PCR damping fluid and Taq archaeal dna polymerase mixture, also comprise primer as listed in table 1 and probe (as shown in SEQ ID NO:1-26), wherein, W represents A or T, Y represents C or T, and M represents base A or C, and R represents base A or G.Described somatotype comprises: subtertian malaria, vivax malaria, ovale malaria and four kinds of types of quartan malaria.Primer and the probe of described nucleotide sequence as shown in SEQ ID NO:1-3 is used for the universal fluorescent PCR detection of malaria.Primer and the probe fluorescent PCR that be used for subtertian malaria of described nucleotide sequence as shown in SEQ ID NO:4-6 detects, primer and the probe fluorescent PCR that be used for vivax malaria of described nucleotide sequence as shown in SEQ ID NO:7-9 detects, the fluorescent PCR that the primer of described nucleotide sequence as shown in SEQ ID NO:10-11 is used for ovale malaria detects, and primer and the probe fluorescent PCR that be used for quartan malaria of described nucleotide sequence as shown in SEQ IDNO:12-14 detects.The primer of described nucleotide sequence as shown in SEQ ID NO:15-18 is used for the universal nest-type PRC of malaria and detects, the primer of described nucleotide sequence as shown in SEQ ID NO:15-16 and 19-20 is used for the subtertian malaria nest-type PRC and detects, the primer of described nucleotide sequence as shown in SEQ ID NO:15-16 and 21-22 is used for the vivax malaria nest-type PRC and detects, the primer of described nucleotide sequence as shown in SEQ ID NO:15-16 and 23-24 is used for the ovale malaria nest-type PRC and detects, and the primer of described nucleotide sequence as shown in SEQ IDNO:15-16 and 25-26 is used for the quartan malaria nest-type PRC and detects.
Universal nest-type PRC detects with rPLUout-FP, rPLUout-RP, rPLUin-FP, rPLUin-RP primer; The somatotype nest-type PRC detects the Auele Specific Primer of using rPLUout-FP, rPLUout-RP and detecting subtertian malaria, vivax malaria, ovale malaria, quartan malaria; Fluorescent PCR detects to be used respectively universal or subtertian malaria, vivax malaria, the specific primer of quartan malaria and fluorescence labeling probe; Ovale malaria fluoroscopic examination OVA-FP and OVA-RP primer.Each primer probe sequence (being 5 '-3 ') is as shown in table 1 below, and table 1 is primer and the probe that plasmodium nest-type PRC and fluorescent PCR detect.
Table 1
Used following software to carry out the design of above-mentioned primer probe: to use the EditSeq of Lasergene software package and MegAlign instrument to carry out DNA sequence analysis and homology comparison.Detect required Auele Specific Primer and FAM fluorescent probe with Primer Express3.0 software design real-time fluorescence RT-PCR, with the general PCR primer of Primer Premier 5.0 software designs.
The using method of mentioned reagent box:
(1) universal nest-type PRC detects with rPLUout-FP, rPLUout-RP, rPLUin-FP, rPLUin-RP primer;
Carry out nest-type PRC when increasing for the first time, use rPLUout-FP, rPLUout-RP to carry out the PCR reaction, the PCR response procedures is: 94 ℃ of 2min; 94 ℃ of 1min, 52 ℃ of 1min, 72 ℃ of 2min, 35 circulations; 72 ℃ of 10min; 4 ℃.
Carry out nest-type PRC when increasing for the second time, use rPLUin-FP, rPLUin-RP primer, the PCR response procedures is: 94 ℃ of 2min; 94 ℃ of 1min, 58 ℃ of 1min, 72 ℃ of 1min, 35 circulations; 72 ℃ of 10min; 4 ℃.
(2) the somatotype nest-type PRC detects the Auele Specific Primer of using rPLUout-FP, rPLUout-RP and detecting subtertian malaria, vivax malaria, ovale malaria, quartan malaria;
Carry out nest-type PRC when increasing for the first time, use rPLUout-FP, rPLUout-RP to carry out the PCR reaction, the PCR response procedures is: 94 ℃ of 2min; 94 ℃ of 1min, 52 ℃ of 1min, 72 ℃ of 2min, 35 circulations; 72 ℃ of 10min; 4 ℃.
Carry out nest-type PRC when increasing for the second time, use subtertian malaria, vivax malaria, ovale malaria and quartan malaria Auele Specific Primer, the PCR response procedures is: 94 ℃ of 2min; 94 ℃ of 1min, 58 ℃ of 1min, 72 ℃ of 1min, 35 circulations; 72 ℃ of 10min; 4 ℃.
(3) fluorescent PCR detects and uses respectively universal or subtertian malaria, vivax malaria, the specific primer of quartan malaria and fluorescence labeling probe;
Use
Fast Universal PCR Master Mix carries out system configurations, and reaction cumulative volume 20 μ l comprise main reaction mixed solution 10 μ l, 10 μ M forward primer 1 μ l, 10 μ M reverse primer 1 μ l, 5 μ M probe 1 μ l, DNA 7 μ l, simultaneously respectively with DEPCH
2O and DNA positive template are as feminine gender and positive control.Amplification and detection are carried out on ABI 7900HTFast quantitative fluorescent PCR instrument, and response procedures is: 95 ℃ of 20s; 95 ℃ of 1s, 58 ℃ of 20s, 40 circulations are collected fluorescence at 58 ℃.
(4) ovale malaria fluoroscopic examination OVA-FP and OVA-RP primer
When carrying out the real-time fluorescence PCR detection of ovale malaria: the real-time fluorescence PCR that adopts the dyestuff method of mixing to carry out ovale malaria detects.The reaction primer is OVA-FP and OVA-RP, and the real-time fluorescence PCR response procedures is: 95 ℃ of 15min; 94 ℃ of 15s, 50 ℃ of 30s, 72 ℃ of 30s (collection fluorescence), 40 circulations; At last the PCR product is carried out melting curve analysis.
That the mentioned reagent box can be applied in is clinical, in Check and Examination of Port.
Test kit of the present invention can detect four kinds of plasmodium somatotypes such as plasmodium specificity and subtertian malaria, vivax malaria, ovale malaria, quartan malaria, and can also find an avette case survey of malaria of the domestic rare Introduced cases of example.That this test kit can be applied to is clinical, the check of malaria in the port.
Description of drawings
Fig. 1 is the figure as a result of a preferred embodiment of the universal nest-type PRC detection of plasmodium;
Fig. 2 is the figure as a result of a preferred embodiment of plasmodial specificity nest-type PRC detection;
Fig. 3 is the figure as a result of a preferred embodiment relatively detecting of plasmodial microscopy and fluorescent PCR;
Fig. 3-1 is the fluorescent PCR detected result figure of the sample of 40 parts of microscopy positives;
Fig. 3-2 are the fluorescent PCR detected result figure of the sample of 20 parts of microscopy feminine genders;
Fig. 4 is plasmodial fluorescent PCR somatotype detected result figure;
Fig. 4-1 is the fluorescent PCR detected result figure of the primer probe of quartan malaria;
Fig. 4-2 are the fluorescent PCR detected result figure of subtertian malaria;
Fig. 4-3 are the fluorescent PCR detected result figure of vivax malaria;
Fig. 4-4 are the fluorescent PCR detected result figure of Introduced cases ovale malaria;
Fig. 4-5 are the melting curve analysis figure of Introduced cases ovale malaria.
Embodiment
For making the present invention easier to understand, below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.
The extracting method of sample, reagent and plasmodium DNA that the present invention is used etc. is described as follows:
The sample source
30 parts of positive blood samples of malaria microscopy are provided by Yunnan Institute of Parasitic Diseases, and 10 parts of positive blood samples of malaria microscopy and 20 parts of negative blood samples of malaria microscopy are frontier port immigration fever patient's anticoagulation, by contriver's laboratory preservation.Sample collection is venous blood sampling, 2%EDTA-Na
2Anti-doubting ,-20 ℃ of cryopreservation.
Reagent
Whole blood DNA extracts test kit (QIAamp DNA Blood Extraction Minikit) and dyestuff mixes method fluorescent PCR reagent (QuantiTect SYBR Green PCR Kit) available from Qiagen company, probe method fluorescent PCR reagent (
Fast Universal PCRMaster Mix) available from ABI company, the Taq archaeal dna polymerase is available from Roche company, and 100bpDNA Ladder Marker, DL2000DNA Marker and agarose are available from TaKaRa company.
The plasmodium DNA extraction
Extract test kit (QIAamp DNA Blood ExtractionMinikit) specification sheets with reference to whole blood DNA and carry out, total DNA of extraction is in-20 ℃ of cryopreservation.
(1) add 20 μ l Proteinase Ks at the bottom of the 1.5ml centrifuge tube.
(2) add 200 μ l blood samples to centrifuge tube, if sample less than 200 μ l use the PBS polishing.
(3) add 200 μ l buffer A L to centrifuge tube, impulse hunting 15s mixing.
Hatch 10min for (4) 56 ℃.
(5) of short duration centrifugal.
(6) add 200 μ l dehydrated alcohols, impulse hunting 15s mixing.Of short duration centrifugal.
(7) mixed solution with the 6th step is drawn on Filter column, the centrifugal 1min of 6000g.Filter column is placed on clean collection tube.
(8) open the Filter column lid, add 500 μ l washing lotion AW1, cover lid, the centrifugal 1min of 6000g.Filter column is placed on clean collection tube.
(9) open the Filter column lid, add 500 μ l washing lotion AW2, cover lid, the centrifugal 3min of 20000g.Filter column is placed on clean collection tube.
(10) the centrifugal 1min. of 20000g
(11) Filter column is placed on the 1.5ml centrifuge tube, uncap adds 200 μ l buffer A E or aseptic double-distilled waters, and room temperature is placed 1min, the centrifugal 1min of 6000g.
(12) liquid that elutes is the DNA of malaria.
The amplified production electrophoretic analysis
Get 5 μ l amplified productions through 1.5% agarose gel electrophoresis, GelGreen dyeing, the gel imaging system observations is also taken pictures.
Determined dna sequence
The PCR fragment of amplification is carried out sequencing by Shanghai Ying Jun Bioisystech Co., Ltd, then the BLAST comparative analysis is carried out in based composition.
Embodiment 1: test kit of the present invention and a preferred embodiment of using in the universal nest-type PRC of malaria detects
The nest-type PRC of the universal and somatotype of malaria of the present invention detects and a preferred embodiment of fluorescence PCR detection reagent kit, comprise PCR damping fluid and Taq archaeal dna polymerase mixture, also comprise primer as listed in table 1 and probe (as shown in SEQ ID NO:1-26), wherein, W represents A or T, Y represents C or T, and M represents base A or C, and R represents base A or G.
During the universal nest-type PRC of malaria detects, the universal inner primer of available outer primer and malaria, primer sequence (being 5 '-3 ') is as follows:
Outer primer:
rPLUout-FP TCAAAGATTAAGCCATGCAAGTGA
rPLUout-RP CCTGTTGTTGCCTTAAACTTCC
Detect the universal inner primer of malaria:
rPLUin-FP AAGGATAACTACGGAAAAGCTGT
rPLUin-RP TACCCGTCATAGCCATGTTAGGCCAATACC。
Embodiment 2: test kit of the present invention and a preferred embodiment of using in the universal nest-type PRC of malaria detects
The nest-type PRC of the universal and somatotype of malaria of the present invention detects and a preferred embodiment of fluorescence PCR detection reagent kit, comprise PCR damping fluid and Taq archaeal dna polymerase mixture, also comprise primer as listed in table 1 and probe (as shown in SEQ ID NO:1-26), wherein, W represents A or T, Y represents C or T, and M represents base A or C, and R represents base A or G.
During the universal nest-type PRC of malaria detects, the Auele Specific Primer of available outer primer and detection subtertian malaria, vivax malaria, ovale malaria, quartan malaria, primer sequence (being 5 '-3 ') is as follows:
Outer primer:
rPLUout-FP TCAAAGATTAAGCCATGCAAGTGA
rPLUout-RP CCTGTTGTTGCCTTAAACTTCC
Detect the primer of subtertian malaria:
rFAL-FP TTAAACTGGTTTGGGAAAAC
rFAL-RP ACAATGAACTCAATCATGACTACC
Detect the primer of vivax malaria:
rVIV-FP CTTCTAGCTTAATCCACATAACTG
rVIV-RP ACTTCCAAGCCRAAGCAAAGAAAGTCC
Detect the primer of ovale malaria:
rOVA-FP CGGGGAAATTTCTTAGATTGC
rOVA-RP GAGAAACAGCATGAATTGCG
Detect the primer of quartan malaria:
rMAL-FP AACAWAGTTGTACRTTAAGAATAAACGC
rMAL-RP AATTCCCATGCATAAAAAATTAYACAAA。
M represents base A or C, and R represents base A or G, and W represents A or T, and Y represents C or T.
Embodiment 3: test kit of the present invention and a preferred embodiment of using in the ovale malaria real-time fluorescence PCR detects
The nest-type PRC of the universal and somatotype of malaria of the present invention detects and a preferred embodiment of fluorescence PCR detection reagent kit, comprise PCR damping fluid and Taq archaeal dna polymerase mixture, also comprise primer as listed in table 1 and probe (as shown in SEQ ID NO:1-26), wherein, W represents A or T, Y represents C or T, and M represents base A or C, and R represents base A or G.
During the ovale malaria real-time fluorescence PCR detects, the primer that available ovale malaria real-time fluorescence PCR detects, primer sequence (being 5 '-3 ') is as follows:
The primer that the ovale malaria real-time fluorescence PCR detects:
OVA-FP ATTAATGTGTCCTTTTCCCTATTCT
OVA-RP GCTTTACAATCAAACGAATACATTC。
Embodiment 4: test kit of the present invention reaches universal at fluorescent PCR and somatotype detects a preferred embodiment of using in malaria
The nest-type PRC of the universal and somatotype of malaria of the present invention detects and a preferred embodiment of fluorescence PCR detection reagent kit, comprise PCR damping fluid and Taq archaeal dna polymerase mixture, also comprise primer as listed in table 1 and probe (as shown in SEQ ID NO:1-26), wherein, W represents A or T, Y represents C or T, and M represents base A or C, and R represents base A or G.
During the ovale malaria real-time fluorescence PCR detects, available universal primer probe or subtertian malaria, vivax malaria, the specific primer of quartan malaria and fluorescence labeling probe.Primer probe sequence (being 5 '-3 ') is as follows:
Universal fluoroscopic examination primer and probe are as follows:
Plas-FP AGTTAAGGGAGTGAAGACGATCAGA
Plas-RP TCATCCAAMRCCTAGTCGGCATAGTTTAT
Plas-Pro FAM-ACCGTCGTAATCTT-MGB
M represents base A or C, and R represents base A or G.
Fluoroscopic examination primer and the probe of subtertian malaria are as follows:
FAL-FP CTTTTGAGAGGTTTTGTTACTTTGAGTAA
FAL-RP TATTCCATGCTGTAGTATTCAAACACAA
FAL-Pro：
FAM-TGTTCATAACAGACGGGTAGTCATGATTGAGTTCA-BHQ1
Fluoroscopic examination primer and the probe of vivax malaria are as follows:
VIV-FP ACGCTTCTAGCTTAATCCACATAACT
VIV-RP ACTTCCAAGCCRAAGCAAAGAAAGTCC
VIV-Pro FAM-TTCGTATCGACTTTGTGCGCATTTTGC-BHQ1
R represents base A or G.
Fluoroscopic examination primer and the probe of quartan malaria are as follows:
MAL-FP CCGACTAGGTGTTGGATGATAGAGTAAA
MAL-RP AACCCAAAGACTTTGATTTCTCATAA
MAL-Pro FAM-CTATCTAAAAGAAACACTCAT-MGB。
Embodiment 5: the application that the universal nest-type PRC of plasmodium detects
The system of twice amplification of nest-type PRC and condition are slightly different.When increasing for the first time, PCR damping fluid 2.5 μ l, 10mM dNTP 0.5 μ l, each 0.5 μ l of 10mM rPLUout-FP and rPLUout-RP primer, Taq archaeal dna polymerase 0.25 μ l, distilled water 15.75 μ l, DNA profiling 5 μ l, total system 25 μ l, the laggard performing PCR reaction of mixing.The PCR response procedures is: 94 ℃ of 2min; 94 ℃ of 1min, 52 ℃ of 1min, 72 ℃ of 2min, 35 circulations; 72 ℃ of 10min; 4 ℃.When increasing for the second time, get the product of PCR for the first time of 2 μ l as template, the upstream and downstream primer is changed to the upstream and downstream primer of rPLUin-FP and rPLUin-RP, and distilled water increases to 18.75 μ l, all the other same pcr amplifications for the first time; The PCR response procedures is also slightly different: 94 ℃ of 2min; 94 ℃ of 1min, 58 ℃ of 1min, 72 ℃ of 1min, 35 circulations; 72 ℃ of 10min; 4 ℃.
The universal nest-type PRC amplification of plasmodium as shown in Figure 1, swimming lane 1 is the 100bpDNA mark; Swimming lane 2 is the positive blood sample PCR of malaria result; Swimming lane 3 is the PCR positive control; Swimming lane 4 is the PCR negative control, and negative control uses sterilized water, and positive control uses synthetic malaria DNA fragmentation.60 parts of blood samples detect through universal nest-type PRC, have 40 parts of blood samples to amplify the 240bp specific amplification band of expection size, are the plasmodium positive; 20 increments are the amplified band of not expection size originally, is the plasmodium feminine gender.
Embodiment 6: the application that plasmodial somatotype nest-type PRC detects
The system of twice amplification of nest-type PRC and condition are slightly different.When increasing for the first time, PCR damping fluid 2.5 μ l, 10mM dNTP 0.5 μ l, each 0.5 μ l of 10mM rPLUout-FP and rPLUout-RP primer, Taq archaeal dna polymerase 0.25 μ l, distilled water 15.75 μ l, DNA profiling 5 μ l, total system 25 μ l, the laggard performing PCR reaction of mixing.The PCR response procedures is: 94 ℃ of 2min; 94 ℃ of 1min, 52 ℃ of 1min, 72 ℃ of 2min, 35 circulations; 72 ℃ of 10min; 4 ℃.When increasing for the second time, get the product of PCR for the first time of 2 μ l as template, the upstream and downstream primer is the upstream and downstream primer of detection and genotyping, and distilled water increases to 18.75 μ l, all the other same pcr amplifications for the first time; The PCR response procedures is also slightly different: 94 ℃ of 2min; 94 ℃ of 1min, 58 ℃ of 1min, 72 ℃ of 1min, 35 circulations; 72 ℃ of 10min; 4 ℃.
Use species-specific primer to carry out the nest-type PRC amplification to the blood sample of the plasmodium positive and see Fig. 2, Fig. 2 is plasmodial specificity nest-type PRC detected result figure, swimming lane 1:100bpDNA mark; Swimming lane 2: positive blood sample subtertian malaria pcr amplification; Swimming lane 3: negative control subtertian malaria pcr amplification; Swimming lane 4: positive control subtertian malaria pcr amplification; Swimming lane 5: negative control vivax malaria pcr amplification; Swimming lane 6: positive blood sample vivax malaria pcr amplification; Swimming lane 7: positive control vivax malaria pcr amplification; Swimming lane 8: negative control quartan malaria pcr amplification; Swimming lane 9: positive control quartan malaria pcr amplification; The positive blood sample ovale malaria of swimming lane 10. pcr amplification; Swimming lane 11: positive control ovale malaria pcr amplification; Swimming lane 12: negative control ovale malaria pcr amplification.The expectation amplified band of the positive blood sample of subtertian malaria, vivax malaria, ovale malaria and quartan malaria is respectively 204bp, 119bp, 456bp and 141bp.Result has 22 parts for subtertian malaria infects, and 13 parts are the vivax malaria infection, and 1 part is that ovale malaria infects; 3 parts is subtertian malaria/vivax malaria polyinfection.Negative control uses sterilized water, and positive control uses synthetic malaria DNA fragmentation.
Embodiment 7: the application of the universal detection of fluorescent PCR
Use
Fast Universal PCR Master Mix carries out system configurations, reaction cumulative volume 20 μ l, comprise Master Mix 10 μ l, 10 μ M forward primer 1 μ l, 10 μ M reverse primer 1 μ l, 5 μ M probe 1 μ l, DNA 7 μ l, simultaneously respectively with DEPC H2O and DNA positive template as feminine gender and positive control.Amplification and detection are carried out on ABI 7900HT Fast quantitative fluorescent PCR instrument, and response procedures is: 95 ℃ of 20s; 95 ℃ of 1s, 58 ℃ of 20s, 40 circulations are collected fluorescence at 58 ℃.
Universal fluoroscopic examination primer and probe are as follows:
Plas-FP AGTTAAGGGAGTGAAGACGATCAGA
Plas-RP TCATCCAAMRCCTAGTCGGCATAGTTTAT
Plas-Pro FAM-ACCGTCGTAATCTT-MGB。
M represents base A or C, and R represents base A or G.
60 increments are originally carried out the malaria universal real time fluorescent PCR detect, approximately need 20min detection time.Fig. 3 is the figure as a result of a preferred embodiment relatively detecting of plasmodial microscopy and fluorescent PCR, and wherein, Fig. 3-1 is the fluorescent PCR detected result of the sample of 40 parts of microscopy positives, and result shows that the fluorescent PCR of 39 parts of microscopy positive sample detects all positive; Fig. 3-2 are the fluorescent PCR detected result of the sample of 20 parts of microscopy feminine genders; Swimming lane 1: positive control; Swimming lane 2,3 and 4 is respectively sample fluorescent PCR detected result 55,45 and No. 58; In the sample of 20 parts of microscopy feminine genders, 3 increments are arranged, and this is positive for real-time fluorescence PCR, and this is that real-time fluorescence PCR is negative for all the other 17 increments.
Embodiment 8: the application that the fluorescent PCR somatotype detects
Use
Fast Universal PCR Master Mix carries out system configurations, reaction cumulative volume 20 μ l, comprise Master Mix 10 μ l, 10 μ M forward primer 1 μ l, 10 μ M reverse primer 1 μ l, 5 μ M probe 1 μ l, DNA 7 μ l, simultaneously respectively with DEPC H2O and DNA positive template as feminine gender and positive control.Amplification and detection are carried out on ABI 7900HT Fast quantitative fluorescent PCR instrument, and response procedures is: 95 ℃ of 20s; 95 ℃ of 1s, 58 ℃ of 20s, 40 circulations are collected fluorescence at 58 ℃.
Specific primer and fluorescence labeling probe.Primer probe sequence (being 5 '-3 ') respectively is as follows:
Fluoroscopic examination primer and the probe of subtertian malaria are as follows:
FAL-FP CTTTTGAGAGGTTTTGTTACTTTGAGTAA
FAL-RP TATTCCATGCTGTAGTATTCAAACACAA
FAL-Pro：
FAM-TGTTCATAACAGACGGGTAGTCATGATTGAGTTCA-BHQ1
Fluoroscopic examination primer and the probe of vivax malaria are as follows:
VIV-FP ACGCTTCTAGCTTAATCCACATAACT
VIV-RP ACTTCCAAGCCRAAGCAAAGAAAGTCC
VIV-Pro FAM-TTCGTATCGACTTTGTGCGCATTTTGC-BHQ1
Fluoroscopic examination primer and the probe of quartan malaria are as follows:
MAL-FP CCGACTAGGTGTTGGATGATAGAGTAAA
MAL-RP AACCCAAAGACTTTGATTTCTCATAA
MAL-Pro FAM-CTATCTAAAAGAAACACTCAT-MGB。
The real-time fluorescence PCR that adopts the dyestuff method of mixing to carry out ovale malaria detects.Reaction system is 25 μ l, comprises 2 * PCR damping fluid, 12.5 μ l, 10mM upstream and downstream primer OVA-FP and OVA-RP each 0.75 μ l, aseptic double-distilled water 9 μ l and plasmodium template DNA 2 μ l.The real-time fluorescence PCR response procedures is: 95 ℃ of 15min; 94 ℃ of 15s, 50 ℃ of 30s, 72 ℃ of 30s (collection fluorescence), 40 circulations; At last the PCR product is carried out melting curve analysis, program is 94 ℃ of 15s, 60 ℃ of 60s, 95 ℃ of 15s.
Fig. 4 is plasmodial fluorescent PCR somatotype detected result figure; Fig. 4-1 is the fluorescent PCR detected result figure of the primer probe of quartan malaria, and the fluorescent PCR that swimming lane 1 and 2 is respectively subtertian malaria and quartan malaria system detects; Swimming lane 3 and 4 is respectively subtertian malaria and quartan malaria negative control.Fig. 4-2 are the fluorescent PCR detected result figure of subtertian malaria, and Fig. 4-3 are the fluorescent PCR detected result figure of vivax malaria, and Fig. 4-4 are the fluorescent PCR detected result figure of Introduced cases ovale malaria, and Fig. 4-5 are the melting curve analysis figure of Introduced cases ovale malaria.Found that 24 parts of subtertian malarias (Fig. 4-2), 11 parts of vivax malarias (Fig. 4-3), 1 part of subtertian malaria/vivax malaria polyinfection, 1 part of ovale malaria infect (Fig. 4-4), 3 parts fail somatotype.
Nest-type PRC by blood sample detects and the fluorescent PCR detection, has found a routine Introduced cases ovale malaria case.Its nest-type PRC amplification size is about 450bp; Fig. 4-4 are the fluorescent PCR detected result figure of Introduced cases ovale malaria; The fluorescent PCR amplification is obvious sigmoid curve, and the ovale malaria fluorescent PCR of swimming lane 1:58 blood sample detects; Swimming lane 2: the positive control fluorescent PCR detects; Swimming lane 3: the negative control fluorescent PCR detects.Fig. 4-5 are the melting curve analysis of Introduced cases ovale malaria, the melting curve of swimming lane 1:58 blood sample amplified fragments; Swimming lane 2: the melting curve of positive control amplified fragments; Swimming lane 3: the melting curve of negative control amplified fragments; As seen from the figure, the melting curve Tm value of amplified fragments is 72.5 ℃; The nest-type PRC amplified fragments of Introduced cases ovale malaria is sent to order-checking, and sequential analysis shows, expanding fragment length is 434bp, and the based composition of sequence is as follows:
CGGGGAAATTTCTTAGATTGCTTCCTTCAGTACCTTATGAGAAATCAAAGTCTTTGGGTTCTGGGGCGAGTATTCGCGCAAGCGAGAAAGTTAAAAGAATTGACGGAAGGGCACCACCAGGCGTGGAGCTTGCGGCTTAATTTGACTCAACACGGGGAAACTCACTAGTTTAAGACAAGAGTAGGATTGACAGATTAATAGCTCTTTCTTGATTTCTTGGATGGTGATGCATGGCCGTTTTTAGTTCGTGAATATGATTTGTCTGGTTAATTCCGATAACGAACGAGATCTTAACCTGCTAATTAGCGGCGAATACGTTATATTCCTACTTGAAATTGAATATAGCTGAATTTGCTTATTTTGAAGAATATATTAGGATGCATTATAGTGTCCTTTTCCCTTTTCTACTTAATT
CGCAATTCATGCTGTTTCTC
The underscore base is the upstream and downstream primer position of amplification.This sequence is delivered on GenBank, and the GenBank accession number is JF505386.
Embodiment 9: the comparison of plasmodium microscopy and nest-type PRC amplification method
plasmodium microscopy and nest-type PRC amplification method are compared (table 2), 18 parts of subtertian malarias, two kinds of detected results of 11 parts of vivax malarias and 17 parts of negative blood samples are consistent, 2 parts of microscopies are that vivax malaria and 2 parts of negative samples of microscopy are shown as subtertian malaria through the nest-type PRC amplification, the sample that 2 parts of microscopies are subtertian malaria is shown as vivax malaria through the nest-type PRC amplification, 1 part of negative sample of microscopy is shown as ovale malaria through the nest-type PRC amplification, 2 parts of microscopies are that the sample that subtertian malaria and 1 part of microscopy are vivax malaria is shown as subtertian malaria/vivax malaria polyinfection through the nest-type PRC amplification, the positive blood sample of 1 part of microscopy vivax malaria is failed somatotype through nest-type PRC, 2 parts of microscopies are that the sample that subtertian malaria and 1 part of microscopy are vivax malaria is shown as feminine gender through the nest-type PRC amplification.
The plasmodium nest-type PRC of table 2 blood sample and microscopy result are relatively
To carry out sequencing with the specificity nest-type PRC amplified band of the inconsistent blood sample of microscopy result, the blast that sequencing result is carried out ncbi database analyzes, found that sequence is the corresponding plasmodial SSU rDNA gene order of amplification, confirm that the nest-type PRC amplification is correct.
Last institute should be noted that; above embodiment is only in order to illustrate technical scheme of the present invention but not limiting the scope of the invention; although with reference to preferred embodiment, the present invention has been done detailed description; those of ordinary skill in the art is to be understood that; can modify or be equal to replacement technical scheme of the present invention, and not break away from essence and the scope of technical solution of the present invention.
Sequence table
＜120〉a kind of malaria nest-type PRC universal and somatotype detects and fluorescence PCR detection reagent kit
<160>26
<170>PatentIn version 3.2
<210>1
<211>25
<212>DNA
＜213〉artificial sequence Plas-FP
<400>1
<210>1
<211>29
<212>DNA
＜213〉artificial sequence Plas-RP
<400>2
TCATCCAAMR CCTAGTCGGC ATAGTTTAT 29
<210>1
<211>14
<212>DNA
＜213〉artificial sequence Plas-Pro
<400>3
ACCGTCGTAA TCTT 14
<210>1
<211>29
<212>DNA
＜213〉artificial sequence FAL-FP
<400>4
CTTTTGAGAG GTTTTGTTAC TTTGAGTAA 29
<210>1
<211>28
<212>DNA
＜213〉artificial sequence FAL-RP
<400>5
TATTCCATGC TGTAGTATTC AAACACAA 28
<210>1
<211>35
<212>DNA
＜213〉artificial sequence FAL-Pro
<400>6
TGTTCATAAC AGACGGGTAG TCATGATTGA GTTCA 35
<210>1
<211>26
<212>DNA
＜213〉artificial sequence VIV-FP
<400>7
ACGCTTCTAG CTTAATCCAC ATAACT 26
<210>1
<211>27
<212>DNA
＜213〉artificial sequence VIV-RP
<400>8
ACTTCCAAGC CRAAGCAAAG AAAGTCC 27
<210>1
<211>27
<212>DNA
＜213〉artificial sequence VIV-Pro
<400>9
TTCGTATCGA CTTTGTGCGC ATTTTGC 27
<210>1
<211>25
<212>DNA
＜213〉artificial sequence OVA-FP
<400>10
<210>1
<211>25
<212>DNA
＜213〉artificial sequence OVA-RP
<400>11
<210>1
<211>28
<212>DNA
＜213〉artificial sequence MAL-FP
<400>12
CCGACTAGGT GTTGGATGAT AGAGTAAA 28
<210>1
<211>26
<212>DNA
＜213〉artificial sequence MAL-RP
<400>13
AACCCAAAGA CTTTGATTTC TCATAA 26
<210>1
<211>21
<212>DNA
＜213〉artificial sequence MAL-Pro
<400>14
CTATCTAAAA GAAACACTCAT 21
<210>1
<211>24
<212>DNA
＜213〉artificial sequence rPLUout-FP
<400>15
TCAAAGATTA AGCCATGCAA GTGA 24
<210>1
<211>22
<212>DNA
＜213〉artificial sequence rPLUout-RP
<400>16
CCTGTTGTTG CCTTAAACTT CC 22
<210>1
<211>23
<212>DNA
＜213〉artificial sequence rPLUin-FP
<400>17
AAGGATAACT ACGGAAAAGC TGT 23
<210>1
<211>30
<212>DNA
＜213〉artificial sequence rPLUin-RP
<400>18
TACCCGTCAT AGCCATGTTA GGCCAATACC 30
<210>1
<211>20
<212>DNA
＜213〉artificial sequence rFAL-FP
<400>19
<210>1
<211>24
<212>DNA
＜213〉artificial sequence rFAL-RP
<400>20
ACAATGAACT CAATCATGAC TACC 24
<210>1
<211>24
<212>DNA
＜213〉artificial sequence rVIV-FP
<400>21
CTTCTAGCTT AATCCACATA ACTG 24
<210>1
<211>27
<212>DNA
＜213〉artificial sequence rVIV-RP
<400>22
ACTTCCAAGC CRAAGCAAAG AAAGTCC 22
<210>1
<211>21
<212>DNA
＜213〉artificial sequence rOVA-FP
<400>23
CGGGGAAATT TCTTAGATTG C 21
<210>1
<211>20
<212>DNA
＜213〉artificial sequence rOVA-RP
<400>24
<210>1
<211>28
<212>DNA
＜213〉artificial sequence rMAL-FP
<400>25
AACAWAGTTG TACRTTAAGA ATAAACGC 28
<210>1
<211>28
<212>DNA
＜213〉artificial sequence rMAL-RP
<400>26
AATTCCCATG CATAAAAAAT TAYACAAA 28
Claims (1)
1. a malaria nest-type PRC universal and somatotype detects and fluorescence PCR detection reagent kit, comprise PCR damping fluid and Taq archaeal dna polymerase mixture, it is characterized in that, also comprise primer and the probe of nucleotide sequence as shown in SEQ ID NO:1-26, wherein, W represents base A or T, and Y represents base C or T, M represents base A or C, and R represents base A or G;
Described somatotype comprises: subtertian malaria, vivax malaria, ovale malaria and four kinds of types of quartan malaria;
Primer and the probe of described nucleotide sequence as shown in SEQ ID NO:1-3 is used for the universal fluorescent PCR detection of malaria;
Primer and the probe fluorescent PCR that be used for subtertian malaria of described nucleotide sequence as shown in SEQ ID NO:4-6 detects;
Primer and the probe fluorescent PCR that be used for vivax malaria of described nucleotide sequence as shown in SEQ ID NO:7-9 detects;
The fluorescent PCR that the primer of described nucleotide sequence as shown in SEQ ID NO:10-11 is used for ovale malaria detects;
Primer and the probe fluorescent PCR that be used for quartan malaria of described nucleotide sequence as shown in SEQ ID NO:12-14 detects;
The primer of described nucleotide sequence as shown in SEQ ID NO:15-18 is used for the universal nest-type PRC of malaria and detects;
The primer of described nucleotide sequence as shown in SEQ ID NO:15-16 and 19-20 is used for the subtertian malaria nest-type PRC and detects;
The primer of described nucleotide sequence as shown in SEQ ID NO:15-16 and 21-22 is used for the vivax malaria nest-type PRC and detects;
The primer of described nucleotide sequence as shown in SEQ ID NO:15-16 and 23-24 is used for the ovale malaria nest-type PRC and detects;
The primer of described nucleotide sequence as shown in SEQ ID NO:15-16 and 25-26 is used for the quartan malaria nest-type PRC and detects.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101055722A CN102220419B (en) | 2011-04-26 | 2011-04-26 | Nested PCR (Polymerase Chain Reaction) detection and fluorescence PCR detection kit for universal type malaria and subtypes thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101055722A CN102220419B (en) | 2011-04-26 | 2011-04-26 | Nested PCR (Polymerase Chain Reaction) detection and fluorescence PCR detection kit for universal type malaria and subtypes thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102220419A CN102220419A (en) | 2011-10-19 |
| CN102220419B true CN102220419B (en) | 2013-06-12 |
Family
ID=44777119
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011101055722A Expired - Fee Related CN102220419B (en) | 2011-04-26 | 2011-04-26 | Nested PCR (Polymerase Chain Reaction) detection and fluorescence PCR detection kit for universal type malaria and subtypes thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102220419B (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676651B (en) * | 2012-03-09 | 2014-07-09 | 广西壮族自治区疾病预防控制中心 | Quickly-nested PCR (polymerase chain reaction) malaria molecular diagnosis reagent kit and detection method |
| CN105002266A (en) * | 2014-04-23 | 2015-10-28 | 江苏奇天基因生物科技有限公司 | Universal method for carrying out malaria detection by adopting recombinase mediated isothermal nucleic acid amplification technology |
| GB201417372D0 (en) * | 2014-10-01 | 2014-11-12 | Arcis Biotechnology Holdings Ltd | Methods and kits |
| CN104531840A (en) * | 2014-11-26 | 2015-04-22 | 中华人民共和国上海出入境检验检疫局 | Rapid and sensitive plasmodium falciparum detection method |
| CN104561269B (en) * | 2014-11-26 | 2018-09-18 | 中华人民共和国上海出入境检验检疫局 | A kind of plasmodium vivax detecting method of rapid sensitive |
| CN104561268A (en) * | 2014-11-26 | 2015-04-29 | 中华人民共和国上海出入境检验检疫局 | Rapid and high-throughput plasmodium detection method |
| CN104450903B (en) * | 2014-12-01 | 2017-04-12 | 中检国研(北京)科技有限公司 | Probe for classificatory detection of four plasmodia infecting human, kit and using method thereof |
| CN104762379A (en) * | 2015-03-30 | 2015-07-08 | 湖南圣湘生物科技有限公司 | Plasmodium detection kit |
| TW202030333A (en) * | 2018-12-20 | 2020-08-16 | 美商簡 探針公司 | Compositions and methods for detecting plasmodium species nucleic acid |
| CN116377100A (en) * | 2022-09-16 | 2023-07-04 | 深圳生科原生物有限公司 | Plasmodium typing detection kit and detection method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010080616A1 (en) * | 2008-12-19 | 2010-07-15 | Abbott Laboratories | Molecular assay for diagnosis of malaria |
-
2011
- 2011-04-26 CN CN2011101055722A patent/CN102220419B/en not_active Expired - Fee Related
Non-Patent Citations (9)
| Title |
|---|
| A. Calderaro等.Genetic Polymorphisms Influence Plasmodium ovale PCR Detection Accuracy.《JOURNAL OF CLINICAL MICROBIOLOGY》.2007,第45卷(第5期),1624-1627. |
| Abdulsalam MQ Al-Mekhlafi1等.Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA.《Parasites & Vectors》.2010,第3卷110. |
| Abdulsalam MQ Al-Mekhlafi1等.Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA.《Parasites & * |
| Genetic Polymorphisms Influence Plasmodium ovale PCR Detection Accuracy;A. Calderaro等;《JOURNAL OF CLINICAL MICROBIOLOGY》;20070531;第45卷(第5期);1624-1627 * |
| Multiplexed Real-Time PCR Assay for Discrimination of Plasmodium Species with Improved Sensitivity for Mixed Infections;Sandra E. Shokoples等;《JOURNAL OF CLINICAL MICROBIOLOGY》;20090430;第47卷(第4期);975-980 * |
| Sandra E. Shokoples等.Multiplexed Real-Time PCR Assay for Discrimination of Plasmodium Species with Improved Sensitivity for Mixed Infections.《JOURNAL OF CLINICAL MICROBIOLOGY》.2009,第47卷(第4期),975-980. |
| Vectors》.2010,第3卷110. * |
| 师永霞等.疟疾的实时荧光PCR 快速检测方法.《中国卫生检验杂志》.2011,第21卷(第3期),625-627. |
| 疟疾的实时荧光PCR 快速检测方法;师永霞等;《中国卫生检验杂志》;20110331;第21卷(第3期);625-627 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102220419A (en) | 2011-10-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102220419B (en) | Nested PCR (Polymerase Chain Reaction) detection and fluorescence PCR detection kit for universal type malaria and subtypes thereof | |
| CN104726570B (en) | The kit of lncRNA NEAT1 and its application in liver cancer serum diagnosis in a kind of detection serum | |
| CN105002283B (en) | A kind of QPCR compositions and kit for detecting people's c-kit gene mutations | |
| KR101707992B1 (en) | Composition for diagnosing porcine reproductive and respiratory syndrome virus and method for diagnosing the same | |
| CN104031992A (en) | V600 mutation detection kit for human B-raf gene | |
| CN102719540A (en) | Detection kit for detecting relative expression level of PML-RAR (alpha) fusion gene by use of fluorescent quantitative PCR (polymerase chain reaction) technology | |
| CN102676663A (en) | Nucleic acid detection kit for detecting BRCA1mRNA | |
| CN104152551A (en) | Composition for detecting hot-spot mutation gene of lung cancer and application method thereof | |
| CN112739833A (en) | Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof | |
| CN102816857A (en) | Treponema pallidum (TP) nucleic acid testing kit | |
| CN102337334A (en) | Special primer and kit for detecting human leucocyte antigen-B27 (HLA-B27) gene | |
| Gal et al. | Application of a polymerase chain reaction to detect Burkholderia pseudomallei in clinical specimens from patients with suspected melioidosis | |
| Akiyoshi et al. | Reevaluation of laboratory methods for diagnosis of measles | |
| CN103820575B (en) | Newcastle disease virus and avian pneumovirus duplex RT-PCR test kit and application thereof | |
| CN101665834B (en) | Ki67mRNA real-time fluorescence quantitative RT-PCR detection reagent kit | |
| CN107574261A (en) | For detecting the detection primer, detection kit and detection method of Hantaan virus | |
| CN103757118A (en) | Primer for detecting human heart microvascular injury marker miRNA (Ribose Nucleic Acid) 21 and application of primer | |
| CN104774918A (en) | Real-time fluorescent PCR-based IL28B gene polymorphism detection kit | |
| CN105177152B (en) | Detect the method and primer of HLA-B*51 allele | |
| CN102154487A (en) | Reagent for detecting francisella tularensis and complex probe and fluorescent quantitative polymerase chain reaction (PCR) method for detecting francisella tularensis | |
| CN106048051B (en) | A kind of candida krusei fluorescence PCR detection reagent kit | |
| WO2018143574A1 (en) | Composition for diagnosing obesity and use thereof | |
| CN107460249A (en) | A kind of primer, probe and kit for being used to detect methicillin-resistant staphylococcus aureus drug resistant gene | |
| CN103805702B (en) | A kind of for detecting the primer of ancylostome nucleic acid, fluorescent probe and test kit | |
| JP2007124970A (en) | Method for detecting bordetella pertussis gene using lamp method and primer set therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130612 Termination date: 20150426 |
|
| EXPY | Termination of patent right or utility model |