CN102206713A - Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof - Google Patents
Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof Download PDFInfo
- Publication number
- CN102206713A CN102206713A CN 201110085320 CN201110085320A CN102206713A CN 102206713 A CN102206713 A CN 102206713A CN 201110085320 CN201110085320 CN 201110085320 CN 201110085320 A CN201110085320 A CN 201110085320A CN 102206713 A CN102206713 A CN 102206713A
- Authority
- CN
- China
- Prior art keywords
- astrovirus
- letter
- pcr
- virus
- adenovirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention provides a triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit, which comprises quantitative RT-PCR reaction liquid, standard substances and reference substances. A kit body is provided with container holes in which quantitative RT-PCR reaction liquid tubes, a Sapovirus standard substance tube, an astrovirus standard substance tube, an adenovirus standard substance tube, a positive reference substance tube and a negative reference substance tube are arranged respectively, wherein the quantitative RT-PCR reaction liquid tubes are separately arranged and arrayed in a matrix; the standard substances are standard substances for Sapovirus, astrovirus and adenovirus; and the reference substances are positive and negative reference substances. By a real-time fluorescence quantitative RT-PCR technology, three kinds of virus specific primers and specific fluorescent probes are adopted, the design is reasonable, the kit can detect the Sapovirus, astrovirus and adenovirus from a sample through PCR reaction, and the detection method is simpler, quicker and more accurate.
Description
Technical field
The invention belongs to biological technical field, relate to fluorescence quantitative RT-PCR detecting kit, be specifically related to a kind of triple (three kinds of probes) real-time fluorescence quantitative RT-PCR and in a reaction tubes, detect in the fecal sample of gastro-enteritis diarrhea patient letter simultaneously, can be applicable to letter and cause as virus, Astrovirus and adenovirus that the laboratory of breaking out epidemic situation is emergent and detect as virus, Astrovirus and adenoviral nucleic acid and detection method.
Background technology
Dysentery is common disease and the frequently-occurring disease that influences human health in the world wide, causes that particularly the infant falls ill and one of main causes of death.Studies show that annual 2000000 infants of surpassing die from diarrhoea diseases related and complication thereof, wherein next in less developed country above 80% patient.Though at least 25 kinds of different bacteriums and pathogenic micro-organism can cause gastro-enteritis, surpassing 75% case is to be drawn by virus.Along with the raising of molecular biosciences detection technique, the dysentery that is caused by virus infection more and more is subjected to people's attention.Particularly infantile diarrhea is caused by virus more than 80% autumn and winter season.
Viral gastroenteritis (virus diarrhea of pretending illness again) is one group of acute infectious intestinal disease that is caused by multiple virus, clinical characters be onset anxious, feel sick, vomiting, stomachache, diarrhoea, passage of watery stools or just rare, symptoms such as morbidity or general malaise also can be arranged, and the course of disease is short, and mortality ratio is low.Viral gastroenteritis is to cause the whole world particularly one of the children of developing country morbidity and main causes of death.Rotavirus (Rotavirus), norovirus (Norovirus), letter are considered to the encountered pathogenic of acute gastroenteritis as virus (Human Calicivirus), adenovirus (Adenovirus) 40 types and 41 types and Astrovirus (Astrovirus).
Rotavirus is the main pathogen that causes infant's severe diarrhoea.Almost each children infected rotavirus in the past at 5 years old, primary infection causes acute diarrhea usually, symptom is heavier, the children below 5 years old in the whole world annual nearly more than 100,000,000 suffer from rotavirus diarrhea, wherein 2,500 ten thousand children need treat-and-release, 2,000,000 children need hospital care, and have 350,000～590,000 children to die from rotavirus diarrhea every year approximately, 82% dead children occur in developing country, the methodological study comparative maturity of present rotavirus is as methods such as RT-PCR, ELISA and latex agglutination analyses.
Human astrovirus virus (Astrovirus, AstV) in 1975 first by Appleton etc. in the ight soil of acute gastroenteritis infant with electron microscopic observation to, after this, in the ight soil of animals such as cat, duck, sheep, pig, also found this viroid in succession.Although find that AstV early, does not draw attention to its pathogenic effects and status thereof, especially with the pass of diarrhoea tie up to think in a very long time its can cause distribute, slighter diarrhoea.Along with the development of Protocols in Molecular Biology, every research of AstV is progressively goed deep into, infection rate, the sickness rate be familiar with to UAstV all exceed expected results, especially in infant crowd.It is quite general that the similar investigation of some countries finds that all AstV infects, and it is pathogenic more and more to can not be ignored.Confirm that now AstV is one of major reason that causes infant, the elderly and immunologic hypofunction person diarrhoea, the AstV acute gastroenteritis both can have been distributed infection also can cause outbreak of epidemic, also is the important cause of disease of nosocomial infection simultaneously.Astrovirus accounts for the suffer from diarrhoea 2.5%-9% of case of children in hospital.
Early 1950s, Rowe etc. are in the spontaneous degeneration of children's gland cell culture of excision, find adenovirus (Adenovirus first, AdV), first Application electron microscopies such as Flewett in 1975 are found the adenovirus directly related with infant's gastro-enteritis from acute gastroenteritis infant ight soil.These are observed most of adenovirus under Electronic Speculum, all can not in the adenovirus cell culture system that routine is used, cultivate, these adenovirus be referred to as EAd (Enteric Adenovirus, EAdv).EAd is a kind of new main pathogen that causes infantile diarrhea, mainly infect the infant below 5 years old, particularly below 3 years old.Adenovirus infection is global distribution, and report is all arranged all over the world, and the report of outbreak of epidemic also more to be seen.EAd can pass through person to person's contact transmission, also can be by fecal oral route and respiratory infectious.Enteron aisle adenopathy 40/41 type causes the children's diarrhae case above 7.9%.The domestic report that does not have outbreak of epidemic, ground such as Beijing, Tianjin, Zhengzhou have and distribute report on a small quantity in recent years.Along with deepening continuously that AstV is studied, its epidemiological significance comes into one's own day by day.The report that external relevant AstV infects has had a lot, and China's relevant report is also fewer at present.Clinical and the epidemiology characteristics of wanting full appreciation China AstV to infect are still waiting to further investigate.Nineteen ninety-five Cheng Xujie etc. are separated to EAd in China first from diarrhoea infant ight soil.EAdv infects and is global distribution, and report is all arranged all over the world, and the report of outbreak of epidemic also more to be seen.The domestic Cao Wei medium report Chongming county infectious diarrhea that rises of EAdv bow l together breaks out.
Human Calicivirus comprises norovirus (Norovirus) and letter as viral (Sapovirus), be cause main diseases that the non-bacterial acute gastroenteritis breaks out because of, also be to be only second to rotavirus to cause one of encountered pathogenic of infant's acute diarrhea.Norovirus can cause and break out in all age brackets, different places (kindergarten, school, restaurant, summer camp, hospital, protect baby chamber, nursing house, navigation fleet and unit etc.).Because this viral infectivity is very strong, often can cause sudden public health event, the U.S. has classified it as the Class B bio-terrorism factor.National capital eruption and prevalences such as the U.S., Japan, France are crossed norovirus, and this virus has caused the great attention of countries in the world, China Ministry of Health tailor-make in 2007 about the scheme of preventing and treating of norovirus infectious diarrhea.Nineteen ninety-five Fang Zhaoyin etc. detects Calicivirus first in China's infantile diarrhea stool sample, henceforth areas such as China Beijing, Guangzhou are reported successively and detected Calicivirus.Studies show that in recent years not only has promise as infecting in the Chinese children, letter is also arranged as infecting.Though the recall rate of letter such as virus is lower than norovirus, existingly studies show that it has been global distribution, often causes outbreak of epidemic.Abroad early for the research of letter such as virus, 1977 sapporo of Japan detect by Electronic Speculum be found since, the worlds such as the U.S., Britain, Canada, Japan, Kenya, South Africa and China have carried out epidemiological study in most of countries and regions successively, proved worldwide ubiquity of letter such as virus, and pointed out it to become and suffer from diarrhoea Sporadic cases and cause the important cause of disease of breaking out epidemic situation.
Viral diarrhea influence worldwide can not be ignored, and infant's viral diarrhea is brought heavy economy and burden on society to countries in the world.Because infant's age is too little, can't well exchange with father and mother with the doctor, therefore the infant patient who suffers from diarrhoea is diagnosed fast to seem particularly important.
In view of comprising that human rotavirus, letter grow with each passing day as virus, adenovirus, Astrovirus and the norovirus importance in public health, so will carry out the detection of multiple diarrhea virus in diarrhoea simultaneously in the monitoring, waste time and energy and waste clinical samples and reagent.The relative PCR method of virus culture relatively wastes time and energy and spends greatlyyer, and letter is not also set up sophisticated cultural method in the world as virus and norovirus are present.At present since the detection method research of rotavirus and norovirus relatively more than and also comparative maturity, and letter is fewer as the method research of virus, adenovirus, Astrovirus, particularly the method for multiple fluorescence quantitative PCR.
Along with the develop rapidly of Protocols in Molecular Biology and the widespread use in medical research thereof, the fluorescent quantitative PCR technique that rises recent years particularly, this method has characteristics such as accuracy height, favorable reproducibility, has been widely used in numerous areas such as gene expression research, pathogen detection, snp analysis and gene type.This method adopts complete stopped pipe to detect, and has saved the product postprocessing to PCR, has avoided crossed contamination, and result's judgement is finished by computer, has simplified operation steps, and has strengthened result's reliability.Development along with fluorescent quantitation technology, instrument and Materials science, the fluorescent quantitation technology is its advantage of performance on quantitatively not only, and different fluorescence dye (FAM, HEX etc.) technology can be carried out aspect researchs such as gene type, detection in Gene Mutation and snp analysis on the 5` end mark of utilization TaqMan or TaqMan-MGB probe.Therefore it is particularly important to set up, sensitive gene diagnosis method quick, special, accurate as the molecular biology of the multiple fluorescence quantitative RT-PCR of virus, adenovirus, Astrovirus about letter and diagnostic kit.
Summary of the invention
The object of the invention provides a kind of triple real-time fluorescence quantitative RT-PCR detection reagent kit, comprise quantitative RT-PCR reaction solution, letter such as viral standard substance, Astrovirus standard substance, adenovirus standard substance, reference substance, box body 7 is provided with container hole, places quantitative RT-PCR reaction solution pipe, letter such as viral standard QC, Astrovirus standard QC, adenovirus standard QC, positive control QC, negative control QC respectively.
Wherein fluorescence quantitative RT-RCR reaction solution pipe comprises RT-PCR reaction buffer pipe (containing magnesium chloride and triphosphate deoxyribose nucleotide mixture etc.), three kinds of viral universal primer pipes (the upstream and downstream primer is with the pipe dress), corresponding three kinds of fluorescent probe pipes and enzyme mixture pipe (containing RNA enzyme inhibitors, moloneys mouse leukemia virus reverse transcriptase and hot resistant DNA polymerase etc.).
Triple fluorescent quantitative RT-PCR detects with upstream primer and downstream primer and the specificity fluorescent probe sequence is as follows accordingly:
Upstream primer letter such as virus-FP:5 '-CAACTATGACCAGGCTCTCGC-3 '
Downstream primer letter such as virus-RP:5 '-GCCCTCCATYTCRAACACTA-3 '
Specific probe letter such as virus-P:5 '-FAM-CTTGGTTYATAGGYGGTACA-BHQ1-3 '
Upstream primer Astrovirus-FP:5 '-AATACGGACGCAACAAACGTC-3 '
Downstream primer Astrovirus-RP:5 '-GTCCTGTGACACCCTGTTTCC-3 '
Specific probe Astrovirus-P: 5 '-VIC-AGTCTAATCAACGTGTCCGTAACATTGTC-BHQ1-3 '
Upstream primer adenovirus-FP:5 '-CCCTGCTTTATCTTCTTTTCGAAG-3 '
Downstream primer adenovirus-RP:5 '-GAGAACGGTGTGCGCAGG-3 '
Specific probe adenovirus-P: 5 '-ROX-CACCAGCCACACCGCGGC-BHQ1-3 '
Above-mentioned standard substance comprise letter as virus, Astrovirus and adenoviral gene standard substance, and its sequence is as follows:
Letter such as viral standard substance sequence are:
CAACTATGAC?CAGGCTCTCG?CCACCTACGA?ATCTTGGTTC?ATAGGTGGTA?CAGGCCTGGT?ACAAGGTAGC?CCCAGTGAAG?AGACCACCAA?A
Astrovirus standard substance sequence is:
aatacggacg?caacaaacgt?cagtctaatc?aacgtgtccg?taacattgtc?aataagcaac tcaggaaaca gggtgtcaca ggac
Adenovirus standard substance sequence is:
CCCTGCTTTA?TCTTCTTTTC?GAAGTCTTCG?ACGTGGTCAG?AGTGCACCAG?CCACACCGCG GCGTCATCGA GGCCGTCTAC CTGCGCACAC CGTTCTC
Negative control is a DEPC(diethylpyrocarbonate behind the high pressure of autoclave sterilization) treating water, positive control is the positive plasmid sample of letter as virus, Astrovirus and adenovirus.
Quantification kit provided by the invention is stored in-20 ℃, reduces multigelation as far as possible.
Another object of the present invention provides described triple fluorescent quantitative RT-PCR detection kit and is detecting letter as the application in virus, Astrovirus and the EAd.
The using method of test kit of the present invention:
Each detection all should be set up positive control and negative control.Standard substance are 1 * 10 with the aseptic deionized water dilution
2-1 * 10
7Copy/ml.
Faecal samples nucleic acid RNA/DNA extracts:This gets 0.2 gram or the 200ul fecal sample is added in the EP pipe, the physiological saline that adds 1.5ml, concussion mixing 3 times, each 10 seconds, left standstill then 10 minutes, centrifugal 5 minutes with 8000 rev/mins, drawing the 200ul-400ul supernatant is added in the EP pipe, adopt the RNeasy Mini Kit of German QIAGEN company or the Viral Nucleic Acid Extraction Kit II test kit of Geneaid company, extract according to the test kit specification sheets, getting the extractive testing sample nucleic acid of 5ul RNA/DNA is template.
The detection of nucleic acid:Getting the extractive testing sample nucleic acid of 5ul RNA/DNA is template, the RT-PCR damping fluid is single stage method RT-PCR(one stepRT-PCR) damping fluid, its final concentration is 1 *, be meant that the final concentration of each component of damping fluid in reaction system is identical with each component concentrations in 1 * one step RT-PCR damping fluid.Usually adopt 2 * one stepRT-PCR damping fluid of reaction system 1/2 volume.The composition of 1 * one step RT-PCR Master Mix damping fluid is numbered (Code): HR-RT04-100 referring to the single stage method RT-PCR standard mixed solution (one step RT-PCR Master Mix) of the farsighted bio tech ltd of Shanghai brightness.
The reaction cumulative volume is 50
, 2 * One Step RT-PCR Reaction Buffer, 25 ul wherein, Enzyme Mix 5 ul, three kinds of primers (20 μ mol/L) each 1
, three kinds of probes (20 μ mol/L) each 1
, template ribonucleic acid/DNA 2 ~ 5
, DEPC water supplies 50
) on three looks (or more than) quantitative real time PCR Instrument, detect, reaction parameter is: reaction conditions is 50 ℃ of 30min, and 95 ℃ of 5min carry out reverse transcription, 95 ℃ of 10s then, and 55 ℃ of 40s carry out triple fluorescent at 55 ℃ and detect, and carry out 45 circulations altogether.
Fluorescent quantitation result report: 1. letter is as virus, Astrovirus and EAd probe CT value (threshold cycle separately, the cycle number that fluorescent signal in each reaction tubes is experienced when reaching the thresholding of setting) it is negative to be equal to 40.0 sample, 2. letter is as the sample of virus, Astrovirus and each probe CT value≤35 of EAd, detected result is that the nucleic acid of this corresponding virus is positive, then testing sample contains letter as virus, Astrovirus and adenovirus, the fluoroscopic examination result occurs as one of them and be positive, contain the target virus of positive fluorescence correspondence in the sample then to be checked.3. the CT value is ash value zone between 35～40, and the back of reforming is negative greater than 37 values.According to the typical curve that is obtained, calculate sample to be measured and respectively remove from office blue positive and negative bacterium value (copy number/ml).
Usefulness of the present invention is: utilization real-time fluorescence quantitative RT-PCR technology, adopt three kinds of viruses (letter is as virus, Astrovirus and adenovirus) special primer and specific fluorescence probe, development is used for letter as virus, Astrovirus and adenovirus triple fluorescent quantitative detection kit.This invention is by a PCR reaction, can from sample, detect the existence of letter as virus, Astrovirus and adenovirus, easier than traditional regular-PCR and substance fluorescence quantifying PCR method, quick and accurate, and the virus that detects is carried out accurately quantitative in real time, the infant of doubtful viral infection clinically provided in early days clarify a diagnosis, distinguish the titre quantity levels that positive-virus infects and infects, so that the early stage treatment plan of in time formulating reduces mortality ratio and sequela.
Description of drawings
Fig. 1 is the test kit structural representation.
Fig. 2 is that three samples mix the example that carries out triple RT-PCR detections simultaneously.
Fig. 3 is that the fluorescence RT-PCR method detects the sensitivity of letter such as virus, and 6 to 1(from left to right) be followed successively by: 10000000,1000000,100000,10000,1000,100copy.
Fig. 4 is letter such as viral standard substance fluorescence quantitative RT-RCR typical curve.
Fig. 5 detects the sensitivity of Astrovirus for the fluorescence RT-PCR method; 5 to 1(from left to right) be followed successively by: 1000000,100000,10000,1000,100copy.
Fig. 6 is an Astrovirus standard substance fluorescence quantitative RT-RCR typical curve.
Fig. 7 detects the sensitivity of adenovirus for the fluorescence RT-PCR method; 5 to 1(from left to right) be followed successively by: 1000000,100000,10000,1000,100copy.
Fig. 8 is an adenovirus standard substance fluorescence quantitative RT-RCR typical curve.
Embodiment
The invention will be further described below in conjunction with the drawings and specific embodiments, but protection scope of the present invention is not limited in this.
Referring to Fig. 1, a kind of triple real-time fluorescence quantitative RT-PCR detection reagent kit, comprise: the quantitative RT-PCR reaction solution, letter such as viral standard substance, the Astrovirus standard substance, the adenovirus standard substance, positive reference substance, the negative control product, box body 7 is provided with container hole, place quantitative RT-PCR reaction solution pipe 1 respectively, letter such as viral standard QC 2, Astrovirus standard QC 3, adenovirus standard substance 4, positive control QC 5, negative control QC 6, wherein quantitative RT-PCR reaction solution single tube packing, arranged, standard substance are letter such as virus, Astrovirus and adenoviral gene standard substance, wherein the fluorescence quantitative RT-RCR reaction solution comprises RT-PCR reaction buffer (containing magnesium chloride and triphosphate deoxyribose nucleotide mixture etc.) 3 pipe and (is labeled as
), three kinds of viral universal primers (the upstream and downstream primer is with the pipe dress) are that 3 pipes (are labeled as
), corresponding three kinds of fluorescent probes be 3 the pipe (be labeled as
), enzyme mixture (containing RNA enzyme inhibitors, moloneys mouse leukemia virus reverse transcriptase and hot resistant DNA polymerase etc.) be 3 the pipe (be labeled as
).
1 materials and methods
Virus strain and clinical samples:
The positive nucleic acid of EAd 40/41, Astrovirus and letter such as virus (all identifying by gene sequencing) derives from Zhejiang University Medical College The First Affiliated Hospital.Clinical sample derives from patient's stool sample, and band ice is transported to the laboratory after the sample collection.
1.2 primer and probe
Downloaded letter all over the world as virus, Astrovirus, adenoviral gene sequence from the NCBI gene pool of the U.S..It has been carried out homology relatively, and at the virus genomic conservative gene of correspondence district design Auele Specific Primer and Taqman probe, sequence is as follows:
Upstream primer letter such as virus-FP:5 '-CAACTATGACCAGGCTCTCGC-3 '
Downstream primer letter such as virus-RP:5 '-GCCCTCCATYTCRAACACTA-3 '
Specific probe letter such as virus-P:5 '-
FAM-CTTGGTTYATAGGYGGTACA-
BHQ1-3 '
Upstream primer Astrovirus-FP:5 '-AATACGGACGCAACAAACGTC-3 '
Downstream primer Astrovirus-RP:5 '-GTCCTGTGACACCCTGTTTCC-3 '
Specific probe Astrovirus-P: 5 '-
VIC-AGTCTAATCAACGTGTCCGTAACATTGTC-
BHQ1-3 '
Upstream primer adenovirus-FP:5 '-CCCTGCTTTATCTTCTTTTCGAAG-3 '
Downstream primer adenovirus-RP:5 '-GAGAACGGTGTGCGCAGG-3 '
Specific probe adenovirus-P: 5 '-
ROX-CACCAGCCACACCGCGGC-
BHQ1-3 '
Primer and probe entrust brightness farsighted bio tech ltd in Shanghai synthetic.
1.3 the extraction of viral quantitative criterion and viral RNA:
The Reansy Mini Kit of German QIAGEN company is adopted in the extraction of viral RNA, pressing the test kit specification sheets extracts, obtain viral RNA (102ng/ μ L), and RNA is carried out reverse transcription according to the process specifications of TranscriptAidTM T7 High Yield Transcription Kit, utilize the concentration of NanoDrop ND-1000 Spectrophotometer, thereby the copy number of definite RNA is with standby at 260nm measurement reverse transcription product.
1.4 the optimization of fluorescence RT-PCR reaction system and condition:
Test kit: select the one step RT-PCR Master Mix of the farsighted bio tech ltd of Shanghai brightness for use, Code:HR-RT04-100, the by specification operation, the reaction cumulative volume is 50
, 2 * One Step RT-PCR Reaction Buffer, 25 ul wherein, Enzyme Mix 5 ul, three kinds of primers (20 μ mol/L) each 1
, three kinds of probes (20 μ mol/L) each 1
, template ribonucleic acid/DNA 2 ~ 5
, DEPC water supplies 50
) reaction conditions is 50 ℃ of 30min, 95 ℃ of 5min carry out reverse transcription, 95 ℃ of 10s then, 55 ℃ of 40s carry out triple fluorescent at 55 ℃ and detect, carry out 45 circulations altogether, the result judges: select fluoroscopic examination model F AM, VIC, ROX, the fluorescence baseline adjustment is got 3-15 round-robin fluorescent signal mean value, and threshold setting is with the vertex of threshold line just above normal negative control product, sample is typical amplification curve, is judged as the positive.Do not have typical amplification curve, be judged as feminine gender.The optimization Test of system, be in the reaction system of template with the positive nucleic acid of same concentrations, primer concentration is from 0.10～1.00 μ M, concentration and probe concentration is from 0.10～0.50 μ M, adopt the optimum concn of preferred primer of matrix method and probe, according to minimum Ct value and high fluorescent increased value (Δ Rn) best primer of selection and concentration and probe concentration.
1.5 fluorescence RT-PCR specificity, susceptibility and replica test
Select the positive nucleic acid (all identifying) of EAd, Astrovirus and letter such as virus and derive from the clinical stool sample that comes from recent Zhejiang Province diarrhea patient in the recent period by gene sequencing, above-mentioned clinical sample is extracted nucleic acid, detect the specificity of verification method with EAd, Astrovirus and letter such as virus multiple fluorescence RT-PCR method; To demarcating the EAd (2 * 10 of copy number (Copies/ml)
8Copies/ml), Astrovirus (2 * 10
8Copies/ml) and letter as virus (2 * 10
8Copies/ml) respectively after the dilution, parallelly carry out fluorescence RT-PCR and RT-PCR reaction, its sensitivity of comparison.In addition, the viral dilution liquid of each concentration is made 5 duplicate detection, the Ct value base of calculation that obtains is poor, the repeatability of verification method.
2 results
2.1 fluorescence RT-PCR reaction system and condition
Select the one step RT-PCR Master Mix of the farsighted bio tech ltd of Shanghai brightness for use, Code:HR-RT04-100, the by specification operation, the reaction cumulative volume is 50
, 2 * One Step RT-PCR Reaction Buffer, 25 ul wherein, Enzyme Mix 5 ul, three kinds of primers (20 μ mol/L) each 1
, three kinds of probes (20 μ mol/L) each 1
, template ribonucleic acid/DNA 2 ~ 5
, DEPC water supplies 50
）。Detect with the Rotor-Gene6000 fluorescence detecting system, reaction parameter is: reaction conditions is 50 ℃ of 30min, 95 ℃ of 5min carry out reverse transcription, 95 ℃ of 10s then, 55 ℃ of 40s, carry out triple fluorescent at 55 ℃ and detect, carry out 45 circulations altogether, can obtain minimum Ct value and high fluorescent.
2.2 specificity test
The multi-fluorescence RT-PCR method that the present invention sets up has specificity preferably to EAd, Astrovirus and letter such as virus, and the stool sample of the first diarrhea patient of gathering also detects positive reaction in the recent period.And with the equal no cross reaction of other enteroviruses such as rotavirus, norovirus (I type and II type), enterovirus EV 71 and CoxA16 virus etc., the result is referring to Fig. 2, A is that letter such as viral sample, B are that adenovirus sample, C are the Astrovirus sample among the figure.
2.3 sensitivity test
To EAd, Astrovirus and letter such as virus, to demarcating the EAd (2 * 10 of copy number (Copies/ml)
8Copies/ml), Astrovirus (2 * 10
7Copies/ml) and letter as virus (4 * 10
7Copies/ml) dilute 100000,10000,1000,100,10 times respectively after, detect with the fluorescence RT-PCR method, fluorescence RT-PCR method detection sensitivity as a result, EAd is 2 * 10 Copies/ml, the result is referring to Fig. 3, and its typical curve is referring to Fig. 4; Astrovirus is 2 * 10 Copies/ml, and the result is referring to Fig. 5, and its typical curve is referring to Fig. 6; Letter such as virus are 4 * 10 Copies/ml, and the result is referring to Fig. 7, and its typical curve is referring to Fig. 8.
2.4 replica test
Getting final concentration respectively is EAd (2 * 10
7Copies/ml), Astrovirus (2 * 10
7Copies/ml) and letter as virus (2 * 10
7Copies/ml) become 3 different concentration for mixing the back by 10 times of gradient dilutions, the sample of each concentration is made 5 duplicate detection, different IPs acid concentration detection Ct value standard deviation separately has better repeatability (table 1) between 0.10～0.31 as a result.
Table 1 fluorescence RT-PCR method detects the replica test of enterovirus
2.5 the detection of clinical sample
Adopt the diarrhoea syndrome questionnaire of the great special project of Eleventh Five-Year Plan-transmissible disease cause of disease Monitoring techniques platform, to 2020 parts of diarrhoea of outpatient service samples of collecting from Zhejiang University Medical College The First Affiliated Hospital year December in July, 2009 to 2010 (every day defecation 3 times or above and stool be rare just, watery stool, sticking purulence just or proterties such as pus and blood stool change).From the diarrhoea clinical sample of collecting, directly extract viral RNA and DNA, detect enterovirus simultaneously with enterovirus fluorescence RT-PCR method of the present invention and common RT-PCR method, enterovirus fluorescence RT-PCR method detects positive 82 parts of (22 parts of the adenovirus of enterovirus as a result, 25 parts of Astroviruss, letter is as 35 parts in virus), common RT-PCR method detects positive 66 parts of (18 parts of the adenovirus of enterovirus, 20 parts of Astroviruss, letter is as 28 parts in virus), enterovirus fluorescence RT-PCR method of the present invention detects the positive rate height of enterovirus than common RT-PCR method.Enterovirus fluorescence RT-PCR method of the present invention is used for the checking of clinical sample detection carries out 4 parallel laboratory test chambers, has all obtained satisfied result.
＜110〉Zhejiang University
＜120〉triple fluorescent quantitative RT-PCR detection kit and purposes
<160>?12
<210>?1
<211>?21
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to letter such as virus mRNA sequences Design detects the upstream primer sequence
<400>?1
CAACTATGACCAGGCTCTCGC?21
<210>2
<211>20
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to letter such as virus mRNA sequences Design detects the downstream primer sequence
<400>?2
GCCCTCCATYTCRAACACTA?20
<210>3
<211>20
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the TaqMan fluorescent quantitation detection probes sequence of letter such as virus mRNA sequences Design
<400>?3
CTTGGTTYATAGGYGGTACA?20
<210>4
<211>147
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the fluorescent quantitation examination criteria product sequence of letter such as virus mRNA sequences Design
<400>?4
CAACTATGAC?CAGGCTCTCG?CCACCTACGA?ATCTTGGTTC?ATAGGTGGTA?CAGGCCTGGT
ACAAGGTAGC?CCCAGTGAAG?AGACCACCAA?ATTAGTGTTT?GAAATGGAG GGC?133
<210>?5
<211>?21
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to Astrovirus mRNA sequences Design detects the upstream primer sequence
<400>?5
AATACGGACGCAACAAACGTC?21
<210>6
<211>21
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to Astrovirus mRNA sequences Design detects the downstream primer sequence
<400>?6
GTCCTGTGACACCCTGTTTCC?21
<210>7
<211>29
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the TaqMan fluorescent quantitation detection probes sequence of Astrovirus mRNA sequences Design
<400>?7
AGTCTAATCAACGTGTCCGTAACATTGTC?29
<210>8
<211>94
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the fluorescent quantitation examination criteria product sequence of letter such as virus mRNA sequences Design
<400>?8
AATACGGACG?CAACAAACGT?CAGTCTAATC?AACGTGTCCG?TAACATTGTC?AATAAGCAAC
TCAGGAAACA?GGGTGTCACA?GGAC?84
<210>?9
<211>?24
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to the adenovirus DNA sequences Design detects the upstream primer sequence
<400>?9
CCCTGCTTTATCTTCTTTTCGAAG?24
<210>10
<211>18
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to the adenovirus DNA sequences Design detects the downstream primer sequence
<400>?10
GAGAACGGTGTGCGCAGG?26
<210>11
<211>18
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the TaqMan fluorescent quantitation detection probes sequence of adenovirus DNA sequences Design
<400>?11
CACCAGCCACACCGCGGC?18
<210>12
<211>97
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the fluorescent quantitation examination criteria product sequence of adenovirus DNA sequences Design
<400>?12
CCCTGCTTTA?TCTTCTTTTC?GAAGTCTTCG?ACGTGGTCAG?AGTGCACCAG?CCACACCGCG
GCGTCATCGA?GGCCGTCTAC?CTGCGCACAC?CGTTCTC 97
Claims (4)
1. triple real-time fluorescence quantitative RT-PCR detection reagent kits, it is characterized in that, this test kit comprises: the quantitative RT-PCR reaction solution, letter such as viral standard substance, the Astrovirus standard substance, the adenovirus standard substance, positive reference substance, the negative control product, box body (7) is provided with container hole, place fluorescence quantitative RT-RCR reaction solution pipe (1) respectively, letter such as viral standard QC (2), Astrovirus standard QC (3), adenovirus standard substance (4), positive control QC (5), negative control QC (6), wherein fluorescence quantitative RT-RCR reaction solution pipe comprises RT-PCR reaction buffer pipe, the upstream and downstream primer is with three kinds of viral universal primer pipes of pipe dress, corresponding three kinds of fluorescent probe pipes and contain the RNA enzyme inhibitors, the enzyme mixture pipe of moloneys mouse leukemia virus reverse transcriptase and hot resistant DNA polymerase, RT-PCR reaction buffer pipe includes magnesium chloride and triphosphate deoxyribose nucleotide mixture
Triple fluorescent quantitative RT-PCR detects with upstream primer and downstream primer and the specificity fluorescent probe sequence is as follows accordingly:
Upstream primer letter such as virus-FP:5 '-CAACTATGACCAGGCTCTCGC-3 '
Downstream primer letter such as virus-RP:5 '-GCCCTCCATYTCRAACACTA-3 '
Specific probe letter such as virus-P:5 '-
FAM-CTTGGTTYATAGGYGGTACA-
BHQ1-3 '
Upstream primer Astrovirus-FP:5 '-AATACGGACGCAACAAACGTC-3 '
Downstream primer Astrovirus-RP:5 '-GTCCTGTGACACCCTGTTTCC-3 '
Specific probe Astrovirus-P: 5 '-
VIC-AGTCTAATCAACGTGTCCGTAACATTGTC-
BHQ1-3 '
Upstream primer adenovirus-FP:5 '-CCCTGCTTTATCTTCTTTTCGAAG-3 '
Downstream primer adenovirus-RP:5 '-GAGAACGGTGTGCGCAGG-3 '
Specific probe adenovirus-P: 5 '-
ROX-CACCAGCCACACCGCGGC-
BHQ1-3 '
Described letter is as follows as virus, Astrovirus and adenoviral gene standard substance sequence:
Letter such as viral standard substance sequence are:
CAACTATGAC?CAGGCTCTCG?CCACCTACGA?ATCTTGGTTC?ATAGGTGGTA?CAGGCCTGGT?ACAAGGTAGC?CCCAGTGAAG?AGACCACCAA?ATTAGTGTTT?GAAATGGAG GGC
Astrovirus standard substance sequence is:
aatacggacg?caacaaacgt?cagtctaatc?aacgtgtccg?taacattgtc?aataagcaac tcaggaaaca gggtgtcaca ggac
Adenovirus standard substance sequence is:
CCCTGCTTTA?TCTTCTTTTC?GAAGTCTTCG?ACGTGGTCAG?AGTGCACCAG?CCACACCGCG GCGTCATCGA GGCCGTCTAC CTGCGCACAC CGTTCTC。
2. a kind of triple real-time fluorescence quantitative RT-PCR detection reagent kits according to claim 1, it is characterized in that, described negative control is a diethylpyrocarbonate treating water behind the high pressure of autoclave sterilization, and positive control is the positive plasmid of letter as virus, Astrovirus and adenovirus.
3. a kind of triple real-time fluorescence quantitative RT-PCR detection reagent kits according to claim 1 is characterized in that, described test kit is stored in-20 ℃.
4. a kind of triple real-time fluorescence quantitative RT-PCR detection reagent kits according to claim 1 are detecting letter as the application in virus, Astrovirus and the EAd.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110085320 CN102206713B (en) | 2011-04-06 | 2011-04-06 | Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110085320 CN102206713B (en) | 2011-04-06 | 2011-04-06 | Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102206713A true CN102206713A (en) | 2011-10-05 |
| CN102206713B CN102206713B (en) | 2013-01-02 |
Family
ID=44695771
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110085320 Active CN102206713B (en) | 2011-04-06 | 2011-04-06 | Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102206713B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102787165A (en) * | 2012-07-13 | 2012-11-21 | 中国疾病预防控制中心传染病预防控制所 | Primer, probe set and kit for detecting AIDS-related mycoplasmas |
| CN103014180A (en) * | 2012-12-28 | 2013-04-03 | 华南理工大学 | Detection primer, probe and detection method of human astrovirus nucleotide |
| CN103031386A (en) * | 2012-12-10 | 2013-04-10 | 浙江大学 | Triple fluorescent quantitative RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) kit for detecting human calicivirus |
| CN103275862A (en) * | 2013-04-25 | 2013-09-04 | 浙江大学 | Fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR) kit for detecting influenza A virus subtype H7N9 |
| CN109593890A (en) * | 2018-12-29 | 2019-04-09 | 深圳市刚竹医疗科技有限公司 | Detect the nucleic acid compositions of diarrhea virus, the application method of kit and kit |
| TWI735433B (en) * | 2015-03-27 | 2021-08-11 | 美商再生元醫藥公司 | Compositions and methods for detecting a biological contaminant |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003014397A1 (en) * | 2001-08-09 | 2003-02-20 | Biomedlab Corporation | Probe for detection of enteric virus detection kit and method for enteric virus with the same |
| KR20090095751A (en) * | 2008-03-06 | 2009-09-10 | (주)바이오니아 | Method for rapid detection infectious microorganisms of unknown sample |
| CN101654713A (en) * | 2009-08-21 | 2010-02-24 | 山东省医药生物技术研究中心 | Oligonucleotide chip capable of detecting five enteroviruses simultaneously and application thereof |
-
2011
- 2011-04-06 CN CN 201110085320 patent/CN102206713B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003014397A1 (en) * | 2001-08-09 | 2003-02-20 | Biomedlab Corporation | Probe for detection of enteric virus detection kit and method for enteric virus with the same |
| KR20090095751A (en) * | 2008-03-06 | 2009-09-10 | (주)바이오니아 | Method for rapid detection infectious microorganisms of unknown sample |
| CN101654713A (en) * | 2009-08-21 | 2010-02-24 | 山东省医药生物技术研究中心 | Oligonucleotide chip capable of detecting five enteroviruses simultaneously and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| 《Journal of Clinical Virology》 20100909 Noortje M. van Maarseveen et al Diagnosis of viral gastroenteritis by simultaneous detection of Adenovirus group F, Astrovirus, Rotavirus group A, Norovirus genogroups I and II, and Sapovirus in two internally controlled multiplex real-time PCR assays 205-210 第49卷, * |
| 《Journal of Clinical Virology》 20110121 Jie Liu et al Multiplex reverse transcription PCR Luminex assay for detection and quantitation of viral agents of gastroenteritis 308-313 第50卷, * |
| 《日本医学介绍》 20031231 牛岛广治等 感染性胃肠炎的检验技术新进展 490-492 第24卷, 第11期 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102787165A (en) * | 2012-07-13 | 2012-11-21 | 中国疾病预防控制中心传染病预防控制所 | Primer, probe set and kit for detecting AIDS-related mycoplasmas |
| CN103031386A (en) * | 2012-12-10 | 2013-04-10 | 浙江大学 | Triple fluorescent quantitative RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) kit for detecting human calicivirus |
| CN103031386B (en) * | 2012-12-10 | 2014-01-08 | 浙江大学 | Triple fluorescent quantitative RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) kit for detecting human calicivirus |
| CN103014180A (en) * | 2012-12-28 | 2013-04-03 | 华南理工大学 | Detection primer, probe and detection method of human astrovirus nucleotide |
| CN103275862A (en) * | 2013-04-25 | 2013-09-04 | 浙江大学 | Fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR) kit for detecting influenza A virus subtype H7N9 |
| CN103275862B (en) * | 2013-04-25 | 2014-10-01 | 浙江大学 | Fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR) kit for detecting influenza A virus subtype H7N9 |
| TWI735433B (en) * | 2015-03-27 | 2021-08-11 | 美商再生元醫藥公司 | Compositions and methods for detecting a biological contaminant |
| US11549154B2 (en) | 2015-03-27 | 2023-01-10 | Regeneron Pharmaceuticals, Inc. | Compositions and methods for detecting a biological contaminant |
| CN109593890A (en) * | 2018-12-29 | 2019-04-09 | 深圳市刚竹医疗科技有限公司 | Detect the nucleic acid compositions of diarrhea virus, the application method of kit and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102206713B (en) | 2013-01-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Antona et al. | Surveillance of enteroviruses in France, 2000–2004 | |
| CN102206713B (en) | Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof | |
| CN103484565B (en) | The test kit of a kind of real-time fluorescence RT-PCR detection coronavirus and application thereof | |
| CN103789451B (en) | A kind of fluorescence quantitative kit detecting CA 6, A10 type | |
| CN103045755B (en) | A kind of fluorescent quantitative PCR detection method detecting Ebola virus and primer thereof and test kit | |
| Tao et al. | Cocirculation of two transmission lineages of echovirus 6 in Jinan, China, as revealed by environmental surveillance and sequence analysis | |
| CN103275862A (en) | Fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR) kit for detecting influenza A virus subtype H7N9 | |
| CN103031386B (en) | Triple fluorescent quantitative RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) kit for detecting human calicivirus | |
| CN104846122A (en) | Nucleic acid detection kit of enterovirus type 71 (EV71) and coxsackievirus type A16 (CA16) (fluorescent polymerase chain reaction (PCR) method) | |
| CN102337351A (en) | Typing detection kit for influenza virus | |
| CN103255232B (en) | Dual fluorescence RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) detection kit and method for avian influenza H7N9 virus | |
| CN102534051B (en) | Kit for detecting enterovirus | |
| Tao et al. | Detection of enteroviruses in urban sewage by next generation sequencing and its application in environmental surveillance | |
| CN102586473A (en) | Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit | |
| CN102367488B (en) | Enterovirus triple real-time fluorescent quantitative RT-PCR detection kit | |
| CN102212618B (en) | Fourfold fluorescence quantitative PCR (Polymerase Chain Reaction) kit and application | |
| CN101550452B (en) | Human bocavirus real-time fluorescence PCR detection reagent kit | |
| CN102559930A (en) | Kit of detecting hepahtis C virus by fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) | |
| Weil et al. | Human enterovirus D68 in clinical and sewage samples in Israel | |
| CN105483283A (en) | Real-time fluorescence nucleic acid isothermal amplification detection kit for HCV (hepatitis C virus) | |
| Geng et al. | Genetic characteristics and pathogenicity of human hepatitis E virus in Nanjing, China | |
| CN103789450B (en) | A kind of fluorescence quantitative kit detecting CA 2, A5 type | |
| CN101392299B (en) | Equine influenza detection kit and detection method | |
| CN104593357A (en) | Nucleic acid for enterovirus detection, and applications thereof | |
| CN101122563A (en) | Hepatitis E virus fluorescent quantitative PCR detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |