CN102206671A - Method for changing characteristics of plants - Google Patents
Method for changing characteristics of plants Download PDFInfo
- Publication number
- CN102206671A CN102206671A CN2011100765531A CN201110076553A CN102206671A CN 102206671 A CN102206671 A CN 102206671A CN 2011100765531 A CN2011100765531 A CN 2011100765531A CN 201110076553 A CN201110076553 A CN 201110076553A CN 102206671 A CN102206671 A CN 102206671A
- Authority
- CN
- China
- Prior art keywords
- plant
- root nodule
- gene
- nodule bacterium
- reorganization
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H3/00—Processes for modifying phenotypes, e.g. symbiosis with bacteria
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a method for changing characteristics of plants. According to the invention, a special property is adopted, that plants which permit root nodules can realize a symbiosis relation with rhizobium; exogenous genes are expressed in the rhizobium colonized in plant root nodule cells; through existing transporting systems in the plants, gene expression products or components are transferred to other tissue organs of the plants. With the method provided by the present invention, characteristics or phenotypes of the plants are changed.
Description
Technical field
The invention belongs to biotechnology and phytology field; More specifically, the present invention relates to a kind of method that changes plant trait.
Background technology
In the prior art, generally adopt transgenic technology to change proterties or the phenotype of plant, obtain the new variety of plant.Although the transgenic technology of plant is studied widely and is used in the prior art, the classical Agrobacterium that for example utilizes is carried goal gene, callus with it conversion plant, this technology all is useful for the plant of numerous species, for example model plant Arabidopis thaliana, cash crop paddy rice, wheat, cotton, tobacco or the like.People but find, adopt conventional transgenic technology (as agrobacterium co-cultivation) to obtain very difficulty of transgenic plant to some other plants such as leguminous crops.Also not have at present especially efficiently at the transgenic technology of leguminous crop, this has limited the breed improvement of leguminous crop greatly.In addition, owing to may exist health affected, some transgenic plant can't be accepted by a lot of people at present.
Leguminous crop is very big in a spermatophyte section, and it is very wide to distribute.For example, a kind of as leguminous crop, alfalfa is a kind of widely distributed leguminous forage, can also be as feed and green manure and the daily edible vegetables of people.Arid is one of principal element that influences leguminous crop normal growth and output.Therefore, press for the drought-resistant ability that improves leguminous crop at present, thereby enlarge the cultivated area of leguminous crop, improve output.
Therefore, this area presses for a kind of method that makes things convenient for, changes plant trait or phenotype effectively of research.
Summary of the invention
The object of the present invention is to provide a kind of method that changes plant trait.
A kind of method that changes plant or crop character or phenotype, described method comprises:
(1) provides a kind of reorganization root nodule bacterium, contain expression of exogenous gene box (be free on outside the genome, also can be incorporated in the genome) in the described reorganization root nodule bacterium cell; Described foreign gene is to change the plant trait genes involved, or can form the gene that changes the relevant composition of plant trait after being expressed; With
(2) will recombinate root nodule bacterium and plant contact symbiosis, thus described foreign gene (in plant materials, particularly root nodule Inner) is expressed and is transported in cell, tissue or the organ of plant; Perhaps described foreign gene (in plant materials, particularly root nodule Inner) is expressed and formed changes the relevant composition (as hormone, growth hormone, phytokinin etc.) of plant trait, and this composition is transported in cell, tissue or the organ of plant.
In a preference, the starting strain of described reorganization root nodule bacterium is selected from (but being not limited to): Sinorhizobium meliloti (Sinorhizobium meliloti), slowly give birth to type rihizobium japonicum (Bradyrhizobium japonicum), Sinorhizobium fredii (Sinorhizobium fredii), rhizobium leguminosarum (Rhizobium leguminosarum bv.viciae), peanut rhizobium (Bradyrhizobium sp.arachis), stem knurl nitrogen-fixing rhizobia (sesbania (stem knurl) root nodule bacterium) (Azorhizobium caulinodans), the living slowly root nodule bacterium of Erichsen (slow raw soybean root nodule bacterium) (Bradyrhizobium elkanii), the living slowly root nodule bacterium in Liaoning (Bradyrhizobium liaoningense), China living root nodule bacterium (Herba Astragali Melilotoidis (Herba Astragali Sinici)) (Mesorhizobium huakuii) in the last of the ten Heavenly stems, living root nodule bacterium in the Root or stem of Littleleaf Indianmulberry (Mesorhizobium loti), root nodule bacterium in the Etta (Kidney bean) (Rhizobium etli), rhizobium leguminosarum (Kidney bean biotype) (Rhizobium leguminosarum biovar phaseoli), rhizobium leguminosarum (trifolium biotype) (Rhizobium leguminosarum biovar trifolii), Radix Glycyrrhizae root nodule bacterium (Mesorhizobium glycyrrhiza) or Radix Astragali root nodule bacterium (Mesorhizobium astragalus).
In another preference, described plant be can with the symbiotic plant of root nodule bacterium.
In another preference, described plant is selected from: leguminous plants (leguminous crop).
In another preference, described leguminous plants is selected from: clover, soybean, pea, peanut, Kidney bean, mung bean, red bean, broad bean, cowpea, Herba Astragali Melilotoidis (Herba Astragali Sinici), Radix Glycyrrhizae or the Radix Astragali.
In another preference, described foreign gene is selected from: isopentenyl transferase genes, γ-An Jidingsuan synthase gene, Plant hormones regulators,gibberellins 3 synthase genes, Cuba's pyrophosphate synthetase gene, Nei Gen-kaurene synthase gene, Nei Gen-kaurene 19-oxidase gene, Nei Gen-kaurenic acid 7 β '-hydroxylase genes, GA12-aldehyde synthase gene, the GA-7-oxidase gene, the GA-13-'-hydroxylase gene, the GA20-oxidase gene, GA3 β '-hydroxylase gene, GA2-oxidase gene or cytochrome P 450 monooxygenases gene.
In another preference, described foreign gene is selected from: isopentenyl transferase genes, γ-An Jidingsuan synthase gene.
In another aspect of this invention, provide a kind of reorganization root nodule bacterium, contain the expression of exogenous gene box in its cell; Described foreign gene is to change the plant trait genes involved, or can form the gene that changes the relevant composition (as phytocytomine) of plant trait after being expressed.
In another preference, described foreign gene is selected from: isopentenyl transferase genes, γ-An Jidingsuan synthase gene and Plant hormones regulators,gibberellins 3 synthase genes, Cuba's pyrophosphate synthetase gene, Nei Gen-kaurene synthase gene, Nei Gen-kaurene 19-oxidase gene, Nei Gen-kaurenic acid 7 β '-hydroxylase genes, GA12-aldehyde synthase gene, the GA-7-oxidase gene, the GA-13-'-hydroxylase gene, the GA20-oxidase gene, GA3 β '-hydroxylase gene, GA2-oxidase gene or cytochrome P 450 monooxygenases gene.
In another preference, described reorganization root nodule bacterium are expressed prenyltransferase, and described prenyltransferase can synthesize phytocytomine.
In another preference, described phytocytomine is trans zeatin.
In another preference, described reorganization root nodule bacterium are expressed the γ-An Jidingsuan synthetic enzyme, and described γ-An Jidingsuan synthetic enzyme can synthesize γ-An Jidingsuan.
In another aspect of this invention, provide the preparation method of described reorganization root nodule bacterium, described method comprises: expression vector is transferred in the root nodule bacterium; Wherein, contain the expression of exogenous gene box in the described expression vector, described foreign gene is the gene that changes the plant trait genes involved or can be formed the relevant composition of change plant trait after expressing.
In a preference, adopt auxiliary bacterium (being preferably selected from intestinal bacteria (Escherichia coli) MT616/pRK600 and MM294/pRK2013) to carry out assist in engagement, thereby expression vector is transferred in the root nodule bacterium.
In another preference, described expression vector is selected from (but being not limited to): pSRK-km, pMB393 and pPHU231.
In another aspect of this invention, provide the purposes of a kind of described reorganization root nodule bacterium, be used to change plant (or crop) proterties.
In another preference, described reorganization root nodule bacterium are expressed prenyltransferase or γ-An Jidingsuan synthetic enzyme, these reorganization root nodule bacterium are used to improve the drought-resistant ability of plant (preferred leguminous crop), improve the nitrogenase vigor of plant, promote the growth of plant, improve the biomass of plant, improve cell fission cellulose content in the plant tissue, improve the water content of plant tissue, reduce the content of superoxide in the plant tissue (as blade), improve antioxidant reductase expression of gene or raising plant disease-resistant insect pest (bell noctuid in the plant tissue (as blade), salix monogolica wood noth and tomato leaf mould) ability.
In another aspect of this invention, provide a kind of composition of change plant (or crop) proterties, comprising:
(1) the described reorganization root nodule bacterium of significant quantity; With
(2) acceptable carrier on the Pesticide Science.
In a preference, described composition is a fertilizer.
In another preference, described composition is the formulation that is selected from down group: wettable powder, emulsifiable concentrate, the aqueous solution, emulsion, but spray solution, oil-or-water-based dispersion, suspension agent, pulvis, granule, or microcapsule.
In another preference, described composition also contains the material that is selected from down group: tensio-active agent, spreader-sticker, filler or root nodule bacterium accelerative activator.
In another aspect of this invention, provide a kind of preparation to change the method for compositions of plant (or crop) proterties, described method comprises: acceptable carrier on the Pesticide Science of the described reorganization root nodule bacterium of significant quantity and significant quantity is mixed.
Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1. the structure schematic flow sheet of rhizobium melioti engineering strain.
Fig. 2. the biomass and the nodulation and nitrogen fixation ability of the alfalfa of inoculation engineering root nodule bacterium.
A, Shoot, the biomass of the alfalfa over-ground part of inoculation root nodule bacterium (grow to stem and leaf around the, ordinate zou unit is gram); Plant, the biomass (ordinate zou unit is gram) that the alfalfa of inoculation root nodule bacterium is total;
B, the total knurl number that forms on the alfalfa of inoculation root nodule bacterium;
C, the nitrogenase activity of the root nodule that forms on the alfalfa of inoculation root nodule bacterium (unit is [nmol ethene]/nmol[acetylene]/total biomass of g plant).WT, empty carrier rhizobium melioti (Sinorhizobium meliloti Rm 1021/pvector) is carried in inoculation; LMG202, inoculation rhizobium melioti engineering strain.
Fig. 3. the alfalfa of inoculation engineering root nodule bacterium is to the tolerance test of arid.
A handles the alfalfa (growing to for the 4th week) of inoculation root nodule bacterium without arid;
B handles the alfalfa of 4 days inoculation root nodule bacterium through arid;
C handles the alfalfa of 6 days inoculation root nodule bacterium through arid;
D handles the alfalfa of the 2nd day the inoculation root nodule bacterium in back of watering again again in 6 days through arid.WT, empty carrier rhizobium melioti (Sinorhizobium meliloti Rm 1021/pvector) is carried in inoculation; LMG202, inoculation rhizobium melioti engineering strain.
Fig. 4. the structure schematic flow sheet of rihizobium japonicum engineering strain.
Fig. 5. inoculation engineering rihizobium japonicum LMG102 has strengthened the drought resistance of the cultivated soybean.The left side plant is the soybean plant strain of inoculation engineering rihizobium japonicum LMG102; The right side plant is the soybean plant strain of inoculation wild-type rihizobium japonicum (giving birth to type rihizobium japonicum Bradyrhizobium japonicum/pvector slowly).
Fig. 6. phytokinin (CK) content in the alfalfa blade that Sinorhizobium meliloti is handled.CK content is inoculated the CK content that carries the empty carrier rhizobium melioti in the alfalfa blade of inoculation engineering Sinorhizobium meliloti LMG202 obviously increases.
Fig. 7. the moisture content of the alfalfa of inoculation engineering rhizobium melioti.
A. arid does not have notable difference before handling;
B. after arid is handled, produce difference.
Shoot, the water content of alfalfa over-ground part; Whole, the total water content of alfalfa of inoculation root nodule bacterium; Root, the water content of roots of alfalfa.Ordinate zou unit: percentage ratio (%).CK refers to that adjoining tree promptly inoculates the alfalfa plant of carrying the empty carrier rhizobium melioti among the figure.
Fig. 8 .PCR detects IPT gene expression in root nodule bacterium.With the expression of rpsF (Sinorhizobium meliloti ribosomal protein S6 gene) as positive control.CK refers to carry the wild-type Sinorhizobium meliloti of empty carrier among the figure.
A. the root nodule bacterium under the spontaneous state;
B. root nodule bacterium under the commensalism.
Fig. 9. the superoxide DAB dyeing of the alfalfa blade of handling through arid.Peroxide level obviously reduces in the alfalfa blade of inoculation engineering Sinorhizobium meliloti LMG202.
The expression of the antioxidase of Figure 10, alfalfa blade.
Embodiment
The inventor is through extensive studies, be surprised to find that the special property that to use some plants and root nodule bacterium formation symbiotic relationship, expression alien gene is (as isopentenyl transferase genes in the root nodule bacterium that the plant root nodule cell interior is grown surely, it can synthesize phytocytomine (as trans zeatin)), be transported to other tissue or the organ of plant by the haulage system that has existed in the plant materials with the expression of exogenous gene product or by the composition that this expression of exogenous gene forms then, thereby change proterties or the phenotype of plant.
Plant
As used herein, described " plant " be can with the symbiotic plant of root nodule bacterium.Those skilled in the art know which plant is can be symbiotic with root nodule bacterium.Various plants all can form the root nodule structure, and this root nodule structure is same or analogous, and can both with the root nodule bacterium symbiosis.
As one embodiment of the present invention, described plant is selected from: leguminous plants (leguminous crop).Wherein the leguminous plants kind is a lot, and method of the present invention is applicable to any leguminous crop that the root nodule structure maybe can form the root nodule structure and can form symbiotic relationship with root nodule bacterium that has.For example, described leguminous plants comprises as follows: edible class such as soybean, broad bean, pea, mung bean, red bean, cowpea, Kidney bean, Bian beans, pigeonpea, Semen arachidis hypogaeae etc.; Feed class such as Herba Astragali Melilotoidis (Herba Astragali Sinici), clover, broad bean, Astragalus sinicus etc.; Material usefulness class such as silk tree, yellow wingceltis, Chinese honey locust, erythrophloeum ferdii, red bean, Chinese scholartree etc.; Dye class such as horse sour jujube, sophora flower, wood indigo plant, bush etc.; Natural gum etc.; Resene such as gum arabic, wooden tragacanth, uncle Ke glue etc.; Fiber-like such as Benares hemp, kudzu etc.; Oil plant class such as soybean, Semen arachidis hypogaeae etc.Should be understood that under the prompting of technical scheme of the present invention those skilled in the art are easy to expect the kind of the various leguminous crops of conversion and realize same or analogous technique effect that these variations also are contained in the present invention.
Foreign gene
The present invention has no particular limits for foreign gene, and needing only it can be expressed by root nodule bacterium, and self can change proterties or the phenotype of plant, or can form the relevant composition of change plant trait after expressing.Described foreign gene can be a structure gene.Suitable foreign gene is such as but not limited to isopentenyl transferase genes, γ-An Jidingsuan synthase gene and Plant hormones regulators,gibberellins 3 synthase genes etc.
In addition, foreign gene also comprises its variant, and the albumen of this variant expressed proteins and this exogenous gene expression has identical functions.It is by inserting or the deletion base, carries out at random or rite-directed mutagenesis waits and obtains.
Described expression of exogenous gene box also can comprise the elements such as promotor that operability links to each other with described foreign gene.
As one embodiment of the present invention, described source gene is an isopentenyl transferase genes.Prenyltransferase (IPT) is a kind of phytokinin synthetic katalaze enzyme that instructs, and participates in regulating development of plants, form and physiological process, and phytokinin has vital role aspect horizontal in the regulation and control plant tissue.Its aminoacid sequence is for example shown in the GenBank accession number AAK90970.2; The sequence of its encoding gene is for example shown in the GenBank accession number AE007871.2.
Described prenyltransferase can synthesize phytocytomine in root nodule bacterium, particularly trans zeatin, described trans zeatin (for small molecules) is a kind of phytokinin, adjustable cell fission and influence multiple growth incident, for example growth of branch (shoot), storehouse are strong, control, the growth of leaf of the branch of root, branch apical dominance, chloroplast(id) is grown and leaf senile etc.
Other available foreign gene includes but not limited to: the γ-An Jidingsuan synthetic enzyme, Plant hormones regulators,gibberellins 3 synthetic enzyme Cuba pyrophosphate synthetases, Nei Gen-kaurene synthetic enzyme, Nei Gen-kaurene 19-oxydase, Nei Gen-kaurenic acid 7 β hydroxylases, GA12-aldehyde synthetic enzyme, the GA-7-oxydase, GA-13-hydroxylase, GA20-oxydase, GA3 β hydroxylase, the encoding gene of GA2-oxydase or cytochrome P 450 monooxygenases etc.
The γ-An Jidingsuan synthetic enzyme is a kind of L-Glutamic decarboxylase, is to be substrate with L-glutamic acid, the key enzyme of synthetic γ-An Jidingsuan, the information interchange between involved in plant and the environment.Its aminoacid sequence is for example shown in the GenBank accession number AAB18493.1; The sequence of its encoding gene is for example shown in the GenBank accession number M84024.1.
Plant hormones regulators,gibberellins 3 synthetic enzyme are a kind of involved in plant growth regulators---the biosynthetic key enzyme of Plant hormones regulators,gibberellins.Its aminoacid sequence is for example shown in the GenBank accession number AAC39506.1; The sequence of its encoding gene is for example shown in GenBank accession number AF047720.1.
Cuba's pyrophosphate synthase (entcopalyl pyrophosphate synthase, CPS) and Nei Gen-kaurene synthase (ent-kaurene synthase, KS) also be the biosynthetic key enzyme of Plant hormones regulators,gibberellins, CPS and KS exist with bifunctional protein complex body form in gibberella, its aminoacid sequence is GenBank accession number CAA75244.1 for example, shown in Q9UVY5.1 or the ABC46413.1; In higher plant, its aminoacid sequence is GenBank accession number AAA73960.1 for example, Q0E088.1, and BAH56558.1, BAH56559.1, BAH56560.1 is shown in BAD91286.1 or the Q947C4.1 etc.
In addition, Nei Gen-kaurene 19-oxydase, Nei Gen-kaurenic acid 7 β hydroxylases, GA12-aldehyde synthetic enzyme, GA-7-oxydase, the GA-13-hydroxylase, GA20-oxydase, GA3 β hydroxylase, GA2-oxydase or cytochrome P 450 monooxygenases etc. also are that the enzyme in the Plant hormones regulators,gibberellins biosynthetic process (is used and environmental organism journal 2008,14 (4): 571～577, Plant hormones regulators,gibberellins biosynthetic pathway and correlative study progress thereof; BULLETIN OF BOTANY Vol. 2002,19 (2): the molecular biology of 137～149 plant Plant hormones regulators,gibberellins biosynthesizing and signal conduction), also can be used for the present invention.
Phytokinin, γ-An Jidingsuan, Plant hormones regulators,gibberellins are micromolecular compound, are the plant-growth mediator agent.With 3-indolyl acetic acid active transport machine-processed different in plant, they are passive transportation in plant.And root nodule bacterium itself can't the synthetic cell mitogen, γ-An Jidingsuan and Plant hormones regulators,gibberellins.
The gene of above each albumen (enzyme) of coding all can be used for the present invention.Described albumen comprises albumen or its bioactive fragment (or being called active fragments) of total length.For example, the aminoacid sequence of described prenyltransferase can be substantially the same with the sequence shown in the GenBank accession number AAK90970.2.
The albumen that passes through replacement, disappearance or the interpolation of one or more amino-acid residues and form is also included among the present invention.Above albumen or their bioactive fragment comprise the alternative sequence of a part of conserved amino acid, and described sequence of replacing through amino acid does not influence the active of them or kept the activity of their part.Suitably replacing amino acid is technology well known in the art, and described technology can be implemented at an easy rate, and guarantees not change the biological activity of gained molecule.These technology are recognized those skilled in the art, in general, can not change biological activity basically at the inessential area change single amino acids of a peptide species.
Any above proteic bioactive fragment can be applied among the present invention.Here, the implication of proteic bioactive fragment is meant that as a peptide species it still can keep all or part of function of full-length proteins.Generally, described bioactive fragment keeps the activity of 50% full-length proteins at least.Under preferred condition, described active fragments can keep 60%, 70%, 80%, 90%, 95%, 99% or 100% activity of full-length proteins.
The present invention also can adopt above-mentioned albumen modified or improvement, such as, can adopt the albumen of being modified or improveing in order to promote its transformation period, validity, metabolism and/or proteic effectiveness.Described can be a kind of proteic conjugate through the albumen of modifying or improve, or it can comprise substituted or artificial amino acid.Described can be to have less common ground with naturally occurring albumen through the albumen of modifying or improve, and changes the relevant composition (as phytokinin) of plant trait but also can synthesize in root nodule bacterium, and can not bring other detrimentally affect or toxicity.That is to say, anyly do not influence above-mentioned proteic bioactive version and all can be used among the present invention.
The present invention has also comprised the isolating nucleic acid of the above-mentioned proteic bioactive fragment of encoding, and also can be its complementary strand.The dna sequence dna of encoding human active fragments can the complete sequence synthetic, and also the method for available pcr amplification obtains.
The present invention has also comprised the carrier of the nucleic acid molecule that comprises encoding said proteins or its bioactive fragment.Described carrier also can comprise the expression regulation sequence that links to each other with the series of operations of described nucleic acid molecule, so that proteic expression.Described " operability links to each other " or " operationally being connected in " refer to a kind of like this situation, and promptly the activity of same linear DNA sequence other parts can be regulated or control to some part of linear DNA sequence.For example, if the transcribing of promotor control sequence, it is exactly operationally to be connected in encoding sequence so.
Root nodule bacterium
Root nodule bacterium (rhizobia) are and the plant symbiosis that can form the root nodule structure that the nitrogen in formation root nodule and the fixed air is for a class rod-shaped bacterium of plant nutrition.This syntaxial system has very strong nitrogen fixing capacity.Root nodule bacterium are to invade by plant root hair, lateral root wooden fork mouth (as peanut) or other positions, form infection thread, enter the cortex of root, the division of stimulation of host tegumental cell, form root nodule, root nodule bacterium enter the root nodule cell from infection thread, continue breeding, and the cell mass formation that contains root nodule bacterium in the root nodule contains hyphostroma.For example, in the root nodule of leguminous crop, the root nodule bacterium symbiosis with it of energy fixed nitrogen is arranged.Root nodule bacterium are the absorbent nitrogenous substances of plant with airborne nitrogen transformation, and as ammonia, and plant provides organism for root nodule bacterium.
Although root nodule bacterium are by the tissue of invaded plants, with plant symbiosis, yet it is not as Agrobacterium, can any foreign gene that carries is transformed in the plant well.At present but those skilled in the art also have no way of understanding whether expression alien gene (as isopentenyl transferase genes) and whether can form influence for plant (as synthetic phytocytomine and phytocytomine is transferred in the tissue or organ of plant) of root nodule bacterium.And the inventor disclosed for the first time root nodule bacterium with plant symbiosis after, but expression alien gene and effectively synthetic and carry exogenous gene expression product or composition to enter in the tissue or organ of plant.
Based on the inventor's new discovery, the invention provides a kind of reorganization root nodule bacterium, contain the expression cassette of foreign gene (as isopentenyl transferase genes) in its cell, thus can expression alien gene.When described foreign gene is isopentenyl transferase genes, described prenyltransferase can be in root nodule bacterium synthetic cell mitogen such as zeatin (particularly trans zeatin), zeatin can be flowed to symbiotic with it plant by root nodule bacterium, and change plant trait, particularly enhanced stress resistance of plant.When described foreign gene was the γ-An Jidingsuan synthase gene, described γ-An Jidingsuan synthetic enzyme can synthesize γ-An Jidingsuan in root nodule bacterium, can strengthen the resistance against diseases of plant.
As used herein, described " reorganization root nodule bacterium " can exchange with " root nodule bacterium engineering strain " or " engineering root nodule bacterium " and use, and all are the root nodule bacterium that contain the expression of exogenous gene box in the phalangeal cell.The starting strain (the preoperative original strain of promptly recombinating) of described reorganization root nodule bacterium can be multiple root nodule bacterium, for example be selected from but be not limited to: Sinorhizobium meliloti (Sinorhizobium meliloti), slowly give birth to type rihizobium japonicum (Bradyrhizobium japonicum), Sinorhizobium fredii (Sinorhizobium fredii), rhizobium leguminosarum (Rhizobium leguminosarum bv.viciae), peanut rhizobium (Bradyrhizobium sp.arachis), stem knurl nitrogen-fixing rhizobia (Azorhizobium caulinodans), the living slowly root nodule bacterium of Erichsen (slow raw soybean root nodule bacterium) (Bradyrhizobium elkanii), the living slowly root nodule bacterium in Liaoning (Bradyrhizobium liaoningense), China living root nodule bacterium (Mesorhizobium huakuii) in the last of the ten Heavenly stems, living root nodule bacterium in the Root or stem of Littleleaf Indianmulberry (Mesorhizobium loti), root nodule bacterium in the Etta (Rhizobium etli), rhizobium leguminosarum (Rhizobium leguminosarum biovar phaseoli), rhizobium leguminosarum (Rhizobium leguminosarum biovar trifolii), Radix Glycyrrhizae root nodule bacterium (Mesorhizobium glycyrrhiza) or Radix Astragali root nodule bacterium (Mesorhizobium astragalus).Also can select suitable root nodule bacterium according to the concrete kind of plant, this is that those skilled in the art are known.
The present invention also provides the purposes of described reorganization root nodule bacterium, is used to change proterties or the phenotype of plant.
The present invention also provides the purposes of described a kind of root nodule bacterium of recombinating, these reorganization root nodule bacterium contain the isopentenyl transferase genes of external source, it can be used for improving plant drought ability, nitrogenase vigor, promote plant-growth, improve the biomass of plant, improve cell fission cellulose content in the plant tissue, improve the water content of plant tissue, reduce the content of superoxide in the plant tissue (as blade), improve antioxidant reductase expression of gene or raising plant disease-resistant insect pest (as bell noctuid, salix monogolica wood noth and tomato leaf mould) ability in the plant tissue (as blade).
After with reference to method of the present invention, those skilled in the art can produce or turn out described reorganization root nodule bacterium in large quantities by the cytobiology technology of routine.The method of producing the reorganization root nodule bacterium is normally: expression vector is transferred in the root nodule bacterium, contains the expression of exogenous gene box in the described expression vector.Preferably, in order to improve the efficient of transfer, adopt auxiliary bacterium to carry out assist in engagement, thereby expression vector is transferred in the root nodule bacterium.Described auxiliary bacterium is optional from intestinal bacteria (Escherichia coli) MT616 and MM294/pRK2013 etc.
Method well-known to those having ordinary skill in the art can be used to make up the expression vector that contains the expression of exogenous gene box.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.The transcript of described foreign gene can effectively be connected on the suitable promotor in the carrier.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary kantlex or amicillin resistance.Persons skilled in the art all know how to select appropriate carriers, promotor or enhanser.
Change the method for plant trait
The invention provides a kind of method that changes plant trait, comprise, thereby described foreign gene is expressed and is transported in cell, tissue or the organ of plant reorganization root nodule bacterium and plant contact symbiosis; Perhaps described foreign gene is expressed and formed changes the relevant composition of plant trait, and this composition is transported in cell, tissue or the organ of plant.
As an embodiment of the invention, a kind of method that improves leguminous crop drought-resistant ability, nitrogenase vigor or promote the leguminous crop growth is provided, comprise: leguminous crop is contacted with the reorganization root nodule bacterium of the expressed prenyltransferase of significant quantity, thereby phytocytomine (particularly trans zeatin) is transported in cell, tissue or the organ of leguminous crop.
The various tissues of plant all can contact (thereby root nodule bacterium are inoculated up) with described reorganization root nodule bacterium with cell, for example seed of plant and root system.
In a preference of the present invention, described reorganization root nodule bacterium are mixed with bacterium liquid (physiological saline on the medium) form, be inoculated on the seed of plant by the method for soaking.
Fertilizer formulations
The invention provides a kind of composition that changes plant trait, wherein contain the described reorganization root nodule bacterium of significant quantity, and acceptable carrier on the Pesticide Science of surplus.Preferably, described composition is a fertilizer.
Among the present invention, term " contains " the various compositions of expression and can be applied to together in mixture of the present invention or the composition.Therefore, term " mainly by ... form " and " by ... composition " be included in during term " contains ".
Among the present invention, the composition of " acceptable on the Pesticide Science " is applicable to agricultural use and people or other animal, plant is not had excessive bad side reaction (as toxicity, stimulation and transformation reactions), the material of rational benefit/risk ratio is promptly arranged.
Among the present invention, " acceptable carrier on the Pesticide Science " is acceptable solvent, suspension agent or the vehicle etc. that are used for reorganization root nodule bacterium of the present invention are sent to plant.Carrier can be a liquid or solid, preferably can keep the bioactive carrier of reorganization root nodule bacterium by higher degree.
The formulation of described composition can be diversified, includes but not limited to: wettable powder, emulsifiable concentrate, the aqueous solution, emulsion, but spray solution, oil-or-water-based dispersion, suspension agent, pulvis, granule, or microcapsule.As long as should be understood that can all be desirable in the formulation that keeps all or part of active prerequisite to be delivered on plant plant or the seed with reorganization root nodule bacterium of the present invention.Preferred those formulations that are easy to send, as optimal way of the present invention, described composition is solution, spray liquid agent or sprays.
In the present invention, acceptable carrier also can comprise assistant agent on the described Pesticide Science.Described assistant agent is a kind of ancillary component, plays the auxiliary adjustment function in composition, can be a kind of tensio-active agent, adhere to auxiliary agent or other type auxiliary agent such as it.
The content of activeconstituents is higher in the composition of concentrated type, and as 20-90wt%, and active component content is lower in dilution type composition and the actual composition that uses, and is generally 0.00005-0.5wt%.In addition, can also comprise usual component such as other suitable chemical agents, synergistic agent, trace element, stablizer, tackiness agent, wetting agent, dispersion agent, emulsifying agent, permeate agent, solvent, filling agent.Can also contain other activeconstituents in the present composition, as sterilant or other fertilizer.
Composition of the present invention can contain 10
4-10
12Individual reorganization root nodule bacterium/gram (mL) composition; Preferred, contain 10
6-10
10Individual reorganization root nodule bacterium/gram (mL) composition.
When the preparation composition, suitable solid diluent includes but not limited to: diatomite, corn husk, tricalcium phosphate, dust cork, clays such as kaolin, wilkinite or attapulgite, and water-soluble polymers.
In addition, solids composition can also contain one or more consistency wetting agents, dispersion agent, and emulsifying agent or pigment, these compositions also can play thinner when solid-state.
Such solids composition can be a pulvis, the form of granule or wettable powder.Usually obtain pulvis by grinding, obtain granule, tablet or the agent of brick type by granulation or compressing tablet.
The form of liquid composition can be a solution, suspension and emulsion, also can wrap in it natural or synthetic polymer in, and can comprise wetting agent, dispersion agent or emulsifying agent.Such emulsion, suspension or solution can prepare water-soluble polymers (and mixture of above-mentioned thinner) with water-based, organic or water-organic thinner.In addition, can contain for example the above ionic or wetting agent, dispersion agent or the emulsifying agent of non-ionic type or their mixture in the described thinner.
The principle of various preparations all is known, and is for example describing to some extent in the following document: Winnacker-Kuchler, " Chemische Technologie "
Chemical technology, Vol.7, C.Hauser Verlag Munich, the 4th edition, 1986; Van Valkenburg, " pesticide formulation ", Marcel Dekker N.Y., the 2nd edition, 1972-73; K.Martens, " spraying drying handbook ", the 3rd edition, G.Goodwin Ltd.London.
The required preparation assistant agent that is used for the present composition, (inert substance for example, tensio-active agent, solvent and other additives), also be known, it is for example described: Watkins " insecticidal dust thinner and carrier handbook " the 2nd edition, Darland Books, Caldwell N.J.; H.v.Olphen, " guiding of clay colloid chemistry " the 2nd edition, J.Wiley; Sons, N.Y., Marsden, " solvent guide " the 2nd edition, Interscience, N.Y.1950; McCutcheon ' s, " scale remover and emulsifying agent annual ", MC Publ.Corp., Ridgewood N.J.; Sisley and Wood, " tensio-active agent encyclopedia ", Chem.Publ.Co.Inc., N.Y.1964; Schonfelt, " Grenzflachenaktive Athylenoxidaddukte " surfactivity oxirane additive product, Wiss.Verlagsgesell., Stuttgart 1976; Winnacker-Kuchler, " Chemische Technologie " chemical technology, Vol.7, C.Hauser Verlag Munich, the 4th edition, 1986.
Wettable powder can be dispersed in water.Except that active substance, wettable powder also can comprise wetting agent, dispersion agent, the material of no environment public hazards such as thinner.The preparation of pulvis can be: with active substance and pulverizing after talcum, kaolin, wilkinite and so on natural clay or solid matter such as diatomite together grind.The preparation of granule can be to be adsorbed in inert substance particle with the active substance spraying, or active substance solution put on carrier (for example sand, kaolin or inert substance particle) surface by tackiness agent (for example polyvinyl alcohol, sodium polyacrylate, or mineral oil).Use if desire to mix, then suitable actives matter can be resembled to prepare and be prepared into particle the chemical fertilizer granule with chemical fertilizer.
Major advantage of the present invention:
(1) the present invention proposes to utilize root nodule bacterium and the plant symbiosis that can form root nodule first, recombinant expressed exogenous gene expression product or the composition that forms because of exogenous gene expression are transported in the tissue or organ of plant, thereby change proterties or the phenotype of plant.
(2) the present invention disclose for the first time root nodule bacterium with plant symbiosis after, can express prenyltransferase and effectively synthetic and carry phytocytomine, particularly trans zeatin (micromolecular compound) enters in the tissue or organ of plant.Overcome the technical barrier that conventional plant transgenic technology is difficult to be applied to leguminous crop.
(3) owing to may exist health affected, transgenic plant can't be accepted by a lot of people at present.And the invention provides a kind of need not to prepare transgenic plant can this just novel method of plant trait or phenotype (as improving the plant drought ability), satisfied the requirement of people for environmental protection and food safety.
(4) breeding of the reorganization root nodule bacterium of invention is convenient, with low cost, can make bio-feritlizer, particularly plants the clothing agent, is applied on a large scale in the husbandry production.
(5) reorganization of the present invention root nodule bacterium can specificity and the plant symbiosis that can form root nodule, and does not all have visible to poison to other animal or plant, is a kind of product of safety and environmental protection.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
The structure of the rhizobium melioti engineering bacteria of embodiment 1, expression prenyltransferase
Design the oligonucleotide primer of a pair of target agrobacterium tumefaciens isopentenyl transferase genes reading frame, sequence is as follows: forward: 5 '-GCTCATATGTTACTCCATCTCATCTACGG-3 ' and reverse: 5 '-CAGTCTAGAGTGCAATACTTGTAACAGGATCCGTAG-3 '.
With Agrobacterium tumefaciens C58 pTiC58 (referring to Danhorn T, Hentzer M, Givskov M, Parsek MR, Fuqua C. Phosphorus limitation enhances biotilm formation of the plant pathogen Agrobacterium tumefaciens thr
The influence that embodiment 2, root nodule bacterium engineering bacteria LMG202 form the alfalfa nitrogen-fixing root nodule
Alfalfa (Medicago sativa Shangdong is available from the academy of agricultural sciences, Shandong) seed is carried out after the surface sterilization, and the root nodule bacterium LMG202 resuspended with physiological saline (concentration 0.85% (w/v)) (contains 10
8Individual root nodule bacterium/ml) mix immersion 0.5 hour reseed through in the sterilization De Zhi stone perlite artificial soil, place 4 weeks of phytotron germinating growth to the, outwell artificial soil, clean plant, observe and the statistics nodule number, measure nitrogenase activity.The alfalfa of carrying empty carrier rhizobium melioti (Sinorhizobium meliloti Rm 1021/pvector) with inoculation is contrast.
The nitrogenase activity determination method is as follows: collect 10 alfalfa root systems (cotyledon is following), place one 10 milliliters vial, cover tight bottle stopper, inject 1 milliliter of acetylene with syringe, 28 ℃, reacted 30 minutes, and drew 100 microliter, by the moiety of gas chromatograph (Gc961) analytical gas, wherein carrier gas is a nitrogen, it is 0.1 MPa that post is pressed, and column temperature is 60 ℃, uses the hydrogen ion flame monitor.By calculating the average content of ethene, determine the nitrogenase activity size.
Found that, the alfalfa of inoculation root nodule bacterium engineering strain LMG202, effective (redness) or the fixed nitrogen that form) the root nodule number obviously reduces and (descended 18.9%, Fig. 2 B), red root nodule carries empty carrier rhizobium melioti institute inductive than inoculation and slightly increases, the nitrogenase vigor of root nodule obviously improves (engineering bacteria is 2.2 times of WT, Fig. 2 C).
Therefore, root nodule bacterium engineering bacteria LMG202 can induce alfalfa to form less nitrogen-fixing root nodule, and the nitrogenase vigor obviously improves.
Embodiment 3, root nodule bacterium engineering bacteria LMG2 promote the alfalfa growth
After alfalfa seed carried out surface sterilization, the root nodule bacterium LMG202 resuspended with physiological saline (0.85% (w/v)) (contained 10
8Individual root nodule bacterium/ml) mix immersion 0.5 hour are sowed again.(Sinorhizobium meliloti Rm 1021/pvector, alfalfa WT) is contrast to carry the empty carrier rhizobium melioti with inoculation.After plantation 28 days, respectively the cauline leaf of alfalfa of empty carrier rhizobium melioti (WT) and the fresh weight of root system are carried in inoculation root nodule bacterium engineering bacteria LMG202 and inoculation, weighing and statistics have been carried out respectively, find that the plant biomass that LMG202 handles is higher than WT strain (cauline leaf and total fresh weight have increased by 5.8 and 10.9% respectively, Fig. 2 A).Therefore, engineering strain LMG202 has the ability that promotes the alfalfa growth.
Therefore, the alfalfa of inoculation root nodule bacterium engineering bacteria LMG202, the alfalfa that the biomass after 4 weeks carries the empty carrier rhizobium melioti than inoculation significantly improves.
The alfalfa drought-resistant ability of embodiment 4, inoculation root nodule bacterium engineering bacteria LMG202 significantly strengthens
After alfalfa seed carried out surface sterilization, the root nodule bacterium LMG202 resuspended with physiological saline (0.85% (w/v)) (contained 10
8Individual root nodule bacterium/ml) mix immersion 0.5 hour are sowed again.With the alfalfa of not inoculating root nodule bacterium is contrast.In the alfalfa process of growth, water the Jenson nutritive medium weekly 2 times, each 80ml.Since the 3rd week, carry out arid resistance test.After the arid resistance test begins, do not rewater or nutritive medium, till finding that plant is withered.After on-test the 3rd day, the plant that empty carrier rhizobium melioti (WT) is carried in inoculation begins to wither, and the 4th day is just all withered; And the alfalfa of inoculation engineering strain LMG202 slight withered phenomenon occurs to 4 talentes, and is most of withered up to the 6th talent.Again water back the 2nd day, the plant that the empty carrier rhizobium melioti is carried in inoculation is still all withered, can't recover, and the plant of inoculation engineering root nodule bacterium is then all or most of growth (see figure 3)s of recovering.
More than experiment all have two parallel and repeat more than 3 times.
The drought-resistant ability checking of the soybean of embodiment 5, inoculation root nodule bacterium engineering bacteria LMG102
Inventor's set of applications moulding lac promotor (Ptrp) drives the IPT expression of gene and also obtains similar drought resisting effect.
Express the structure of the rihizobium japonicum engineering bacteria of prenyltransferase: the method for embodiment 1 obtains recombinant plasmid pSSJ003 as described above; Change by electricity, be transferred to and give birth to type rihizobium japonicum Bradyrhizobium japonicum slowly (referring to Mesa S, Reutimann L, Fischer HM, Hennecke H.Posttranslational control of transcription factor FixK2, a key regulator for the Bradyrhizobium japonicum-soybean symbiosis.Proc Natl Acad Sci USA.2009,106 (51): 21860-5; Provide by doctor Hennecke) in, engineering strain LMG102 (Fig. 4) obtained.Embodiment 4 described methods contact these root nodule bacterium with soybean seeds as described above, and postvaccinal soybean seeds is planted in soil, carry out arid resistance test.
The treatment condition of arid resistance test are: water weekly once, each every basin plant watering 80ml does not rewater around the, and the extreme drought that continues is handled.23 ± 1 ℃ of the temperature in greenhouse, illumination every day 16 hours, dark 8 hours.Effect to arid processing making plant drought resisting after 5 days.
Result such as Fig. 5, LMG102 bacterial strain and rhizobium melioti engineering bacteria are similar, have the effect that promotes the host plant drought resisting.
Phytokinin (CK, zeatin) content in the alfalfa blade of embodiment 6, inoculation root nodule bacterium engineering bacteria LMG202
After alfalfa seed carried out surface sterilization, the root nodule bacterium LMG202 resuspended with physiological saline (0.85% (w/v)) (contained 10
8Individual root nodule bacterium/ml) mix immersion 0.5 hour reseed through in the sterilization De Zhi stone perlite artificial soil, place 4 weeks of phytotron germinating growth to the, outwell artificial soil, clean plant.The alfalfa of carrying empty carrier rhizobium melioti (Sinorhizobium meliloti Rm 1021/pvector) with inoculation is contrast.
The CK extracting method is as follows:
Get the bright sample of 0.4g plant grind into powder in liquid nitrogen, add extracting solution (methyl alcohol: water: formic acid=15: 4: 1, chromatographically pure, in-20 ℃ of precoolings) continue to grind to form homogenate, be transferred in the centrifuge tube, place-20 ℃ of lixiviates to spend the night, next day is centrifugal, collects supernatant, is settled to 2mL with extracting solution.Behind 0.22 μ m membrane filtration, be used for stratographic analysis (with reference to Journal of Chromatography A, 2002, (950): 21-29; Nature protocols, 2010,5 (6): 986-992).
CK measures:
Chromatographic column: Zorbax extend-C18 4.6*50mm 1.8um;
Sample size: 5ul;
Flow velocity: 0.2ml/min;
Moving phase: A=0.1%FA H
2O B=0.1%FA MeOH, from 0-2min B 30%＞20min100%＞22min 100%,＞25min 30%, finishes at 35min;
Detect wavelength: 210,254,280,320,360,226nm;
Scanning of the mass spectrum scope: 50-400;
Electric spray ion source parameter: Nebulizer pressure 40psig, drying gas N2 350C 9L/min, ESI;
Vcap?3500V；
Capillary voltage: fragmentor 160v, skimmer 65V, Oct RF Vpp750V;
Scan pattern: with negative ms scan mode 2GHzExt Dyn (1700).
Fig. 6 shows, with respect to contrast (alfalfa of empty carrier rhizobium melioti (Sinorhizobium meliloti Rm 1021/pvector) is carried in inoculation), the content of having inoculated phytokinin in the alfalfa blade of Sinorhizobium meliloti LMG202 increases by 18%.
The alfalfa water content of embodiment 7, inoculation root nodule bacterium engineering bacteria LMG202 changes
Method as embodiment 6 prepares the alfalfa of inoculating root nodule bacterium engineering bacteria LMG202, and the alfalfa of carrying empty carrier rhizobium melioti (Sinorhizobium meliloti Rm 1021/pvector) with inoculation is contrast.
The arid treating processes is: after alfalfa seed was carried out surface sterilization, the root nodule bacterium LMG202 resuspended with physiological saline (0.85% (w/v)) (contained 10
8Individual root nodule bacterium/ml) mix immersion 0.5 hour are sowed again.With the alfalfa of not inoculating root nodule bacterium is contrast.In the alfalfa process of growth, water the Jenson nutritive medium weekly 2 times, each 80ml.Since the 3rd week, do not rewater or nutritive medium, occur wilting until plant leaf.
To not carrying out inoculation plant and 5 days the inoculation plant of arid processing that arid is handled, elder generation is weighing plant fresh weight respectively, then plant is wrapped in 65 ℃ of oven dry of spending the night in the kraft bag, the weighing dry weight, and fresh weight deducts the water content that dry weight promptly is a plant.
The moisture content of the alfalfa of inoculation engineering rhizobium melioti is asked for an interview Fig. 7 with the difference that the plant of empty carrier rhizobium melioti is carried in inoculation.Arid does not have notable difference before handling; After arid is handled, the plant of inoculation engineering bacteria, moisture content is high by 40% than control plant; Wherein, the water content difference of over-ground part clearly reaches more than 70%, and underground part only differs about 20%.
Embodiment 8, IPT express in root nodule bacterium
Obtain the root nodule bacterium (inoculating root nodule bacterium (Sinorhizobium meliloti Rm 1021) in liquid nutrient medium, 28 ℃ of incubated overnight, centrifugal back collection thalline) under the spontaneous state, and genetically engineered root nodule bacterium LMG202 of the present invention.By extracting total RNA, reverse transcription becomes cDNA, and PCR detects expression (primer of employing: IPT:TTCGGACGCCTTTCTCAC (SEQ ID NO:1), the GCCGCCCTGCATCAATAT (SEQ ID NO:2) of the foreign gene IPT that imports; RpsF:CCTCGCTCGGCAGGACAT (SEQ ID NO:3), GCCTTGCGGTTCTTCTTGAT (SEQ ID NO:4)).
Result such as Fig. 8, discovery IPT gene spontaneous (Fig. 8 A) in genetically engineered root nodule bacterium LMG202 of the present invention is still all expressed under symbiosis (Fig. 8 B) state, no matter and all do not have any expression in the wild-type root nodule bacterium under spontaneous (Fig. 8 A) or symbiosis (Fig. 8 B) state.
The variation of the superoxide DAB of embodiment 9, alfalfa blade
Alfalfa seed behind the presoaking and germinating, soaks 10min with 25% chlorine bleach liquor's surface sterilization 10min in root nodule bacterium bacterium liquid, be sowed in the vermiculite perlite of aseptic no nitrogen, places the phytotron growth.
The superoxide DAB dyeing of the alfalfa blade that will handle through arid, be specially: per 5 days of vegetative period watered once, stopped to water after waiting to grow to 3 weeks, observed the plant phenotype.
DAB dyeing is used to detect endogenous activity oxygen (H
2O
2) content.After stopping to water 5 days the 3rd week, when the wilting phenomenon occurring, get on the plant 3-4 sheet blade from top to bottom, in 0.1%DAB solution (pH 5.8, now join), hatch 12h for 22 ℃, blade is transferred in 95% ethanol then, boiling water bath 5min, repeat 3 times clean to background, microscopy.
Result such as Fig. 9 contain more superoxide in the plant leaf of adjoining tree (the wild-type Sinorhizobium meliloti of empty carrier is carried in inoculation), and the plant of inoculation engineering root nodule bacterium LMG202 is then obviously less.
The expression of the antioxidase of embodiment 10, alfalfa blade changes
Embodiment 9 methods are cultivated alfalfa as described above, the inoculation root nodule bacterium, and arid is handled.
By extracting the total RNA of blade, reverse transcription becomes cDNA, and PCR detects the antioxidant reductase expression of gene that imports.
The PCR primer that adopts:
SOD superoxide-dismutase: AATGTCACCGTCGGTGATGATG (SEQ ID NO:5), GTTCATCCTTGCAAACCAATAATACC (SEQ ID NO:6);
CAT catalase: CCTATTTGATGATGTGGGTGTCC (SEQ ID NO:7), GTCTTGAGTAGCATGGCTGTGGT (SEQ ID NO:8);
SAPX chloroplast stroma ascorbate peroxidase enzyme: ACCAACCTCGTTCAGTGTCCAT (SEQ ID NO:9), AGAGCGCTGTCTGCGTTCTATT (SEQ ID NO:10);
ThylAPX thylakoid membrane ascorbate peroxidase enzyme: TCATCCTCTTTTGATTCGTTTGG (SEQ ID NO:11), CTTTGATTGGCTGGAGAAGTTTC (SEQ ID NO:12);
DHAR DHAR: GATTGGAGACTGCCCTTTTAGC (SEQ IDNO:13), CTGTAGCCTTTTCAGGTGGTGT (SEQ ID NO:14);
Single DHAR: the AGCGTTCGTTTACGTGATTCTTG (SEQID NO:15) of MDHAR, CATTTGGGAGTTAGCCTTTCCTC (SEQ ID NO:16);
GR glutathione reductase: TTTGAACAAAGGTGCAGAAGAAGG (SEQ ID NO:17), TGGGAACACAACCACGAATGAC (SEQ ID NO:18);
GPX Selenoperoxidase: TGGACAGGAGCCAGGATCTAGT (SEQ IDNO:19), ATTTTCAGAGGAGCGGTGGTAG (SEQ ID NO:20);
Actin2 Actin muscle (confidential reference items): TGGCATCACTCAGTACCTTTCAAG (SEQ ID NO:21), ACCCAAAGCATCAAATAATAAGTCAACC (SEQ ID NO:22);
Result such as Figure 10, before arid was handled, the difference of the expression amount of antioxidant reductase was not obvious in the plant leaf; After arid was handled, most antioxidase expression of gene obviously were less than the plant of inoculation engineering root nodule bacterium LMG202 in the plant leaf of adjoining tree (the wild-type Sinorhizobium meliloti of empty carrier is carried in inoculation).
Embodiment 11, engineering root nodule bacterium are to the influence of alfalfa disease resistance
Classify template as with intestinal bacteria E.coli genome sequence, with gctcatATGGACCAGAAGCTGTTAACGG (SEQ ID NO:23) and gcatctagaTCAGGTGTGTTTAAAGCTGTTCTGC (SEQ ID NO:24) is primer, obtain the γ-An Jidingsuan synthase gene (GAD) among the intestinal bacteria E.coli, be inserted in the corresponding site of expression vector pSRK-Km after cutting with Nde I/Xba I enzyme, obtain recombinant plasmid.With this recombinant plasmid transformed Sinorhizobium meliloti Rm1021, obtain engineering root nodule bacterium LMG206, inoculate the identical method of engineering bacteria LMG202 as described above with engineering root nodule bacterium LMG206 inoculation alfalfa.
The result of test shows that inoculation engineering root nodule bacterium LMG206 can strengthen the ability of the anti-bell noctuid of clover.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Claims (16)
1. a method that changes plant trait is characterized in that, described method comprises:
(1) provides a kind of reorganization root nodule bacterium, contain the expression of exogenous gene box in the described reorganization root nodule bacterium cell; Described foreign gene is to change the plant trait genes involved, or can form the gene that changes the relevant composition of plant trait after being expressed; With
(2) will recombinate root nodule bacterium and plant contact symbiosis, thus described foreign gene is expressed and is transported in cell, tissue or the organ of plant; Perhaps described foreign gene is expressed and formed changes the relevant composition of plant trait, and this composition is transported in cell, tissue or the organ of plant.
2. the method for claim 1, it is characterized in that, the starting strain of described reorganization root nodule bacterium is selected from: Sinorhizobium meliloti (Sinorhizobium meliloti), slowly give birth to type rihizobium japonicum (Bradyrhizobium japonicum), Sinorhizobium fredii (Sinorhizobium fredii), rhizobium leguminosarum (Rhizobium leguminosarum bv.viciae), peanut rhizobium (Bradyrhizobium sp.arachis), stem knurl nitrogen-fixing rhizobia (Azorhizobium caulinodans), the living slowly root nodule bacterium of Erichsen (slow raw soybean root nodule bacterium) (Bradyrhizobium elkanii), the living slowly root nodule bacterium in Liaoning (Bradyrhizobium liaoningense), China living root nodule bacterium (Mesorhizobium huakuii) in the last of the ten Heavenly stems, living root nodule bacterium in the Root or stem of Littleleaf Indianmulberry (Mesorhizobium loti), root nodule bacterium in the Etta (Rhizobium etli), rhizobium leguminosarum (Rhizobium leguminosarum biovar phaseoli), rhizobium leguminosarum (Rhizobium leguminosarum biovar trifolii), Radix Glycyrrhizae root nodule bacterium (Mesorhizobium glycyrrhiza) or Radix Astragali root nodule bacterium (Mesorhizobium astragalus).
3. the method for claim 1 is characterized in that, described plant be can with the symbiotic plant of root nodule bacterium.
4. method as claimed in claim 3 is characterized in that described plant is selected from: leguminous plants.
5. method as claimed in claim 4 is characterized in that, described leguminous plants is selected from: clover, soybean, pea, peanut, Kidney bean, mung bean, red bean, broad bean, cowpea, Herba Astragali Melilotoidis (Herba Astragali Sinici), Radix Glycyrrhizae or the Radix Astragali.
6. the method for claim 1, it is characterized in that, described foreign gene is selected from: isopentenyl transferase genes, the γ-An Jidingsuan synthase gene, Plant hormones regulators,gibberellins 3 synthase genes, Cuba's pyrophosphate synthetase gene, Nei Gen-kaurene synthase gene, Nei Gen-kaurene 19-oxidase gene, Nei Gen-kaurenic acid 7 β '-hydroxylase genes, GA12-aldehyde synthase gene, the GA-7-oxidase gene, the GA-13-'-hydroxylase gene, the GA20-oxidase gene, GA3 β '-hydroxylase gene, GA2-oxidase gene or cytochrome P 450 monooxygenases gene.
7. the method for claim 1 is characterized in that, described foreign gene is selected from: isopentenyl transferase genes, γ-An Jidingsuan synthase gene.
8. reorganization root nodule bacterium contain the expression of exogenous gene box in its cell; Described foreign gene is to change the plant trait genes involved, or can form the gene that changes the relevant composition of plant trait after being expressed.
9. reorganization root nodule bacterium as claimed in claim 8, it is characterized in that, described foreign gene is selected from: isopentenyl transferase genes, the gamma amino butyric acid synthase gene, Plant hormones regulators,gibberellins 3 synthase genes, Cuba's pyrophosphate synthetase gene, Nei Gen-kaurene synthase gene, Nei Gen-kaurene 19-oxidase gene, Nei Gen-kaurenic acid 7 β '-hydroxylase genes, GA12-aldehyde synthase gene, the GA-7-oxidase gene, the GA-13-'-hydroxylase gene, the GA20-oxidase gene, GA3 β '-hydroxylase gene, GA2-oxidase gene or cytochrome P 450 monooxygenases gene.
10. reorganization root nodule bacterium as claimed in claim 8 is characterized in that, described reorganization root nodule bacterium are expressed prenyltransferase, and described prenyltransferase can synthesize phytocytomine.
11. reorganization root nodule bacterium as claimed in claim 8 is characterized in that, described reorganization root nodule bacterium are expressed the γ-An Jidingsuan synthetic enzyme, and described γ-An Jidingsuan synthetic enzyme can synthesize γ-An Jidingsuan.
12. the preparation method of the described reorganization of claim 8 root nodule bacterium, described method comprises: expression vector is transferred in the root nodule bacterium; Wherein, contain the expression of exogenous gene box in the described expression vector, described foreign gene is the gene that changes the plant trait genes involved or can be formed the relevant composition of change plant trait after expressing.
13. the purposes of the arbitrary described reorganization root nodule bacterium of claim 8-11 is used to change plant trait.
14. purposes as claimed in claim 13, it is characterized in that, described reorganization root nodule bacterium are expressed prenyltransferase or γ-An Jidingsuan synthetic enzyme, these reorganization root nodule bacterium are used to improve the drought-resistant ability of plant, improve the nitrogenase vigor of plant, promote the growth of plant, improve the biomass of plant, improve cell fission cellulose content in the plant tissue, improve the water content of plant tissue, reduce the content of superoxide in the plant tissue, improve antioxidant reductase expression of gene or raising plant disease-resistant insect pest ability in the plant tissue.
15. a composition that changes plant trait comprises:
(1) the arbitrary described reorganization root nodule bacterium of the claim 8-11 of significant quantity; With
(2) acceptable carrier on the Pesticide Science.
16. one kind prepares the method for compositions that changes plant trait, it is characterized in that, described method comprises: acceptable carrier on the Pesticide Science of the arbitrary described reorganization root nodule bacterium of the claim 8-11 of significant quantity and significant quantity is mixed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100765531A CN102206671A (en) | 2010-03-26 | 2011-03-28 | Method for changing characteristics of plants |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010133089 | 2010-03-26 | ||
| CN201010133089.0 | 2010-03-26 | ||
| CN2011100765531A CN102206671A (en) | 2010-03-26 | 2011-03-28 | Method for changing characteristics of plants |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102206671A true CN102206671A (en) | 2011-10-05 |
Family
ID=44672472
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011100765531A Pending CN102206671A (en) | 2010-03-26 | 2011-03-28 | Method for changing characteristics of plants |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN102206671A (en) |
| WO (1) | WO2011116708A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110573605A (en) * | 2018-03-08 | 2019-12-13 | 华东理工大学 | Slow rhizobium monooxygenase and application thereof in preparation of chiral sulfoxide |
| CN117551792A (en) * | 2024-01-11 | 2024-02-13 | 中国农业科学院草原研究所 | Primer probe set, kit and detection method for detecting silverfish moth |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114176084B (en) * | 2021-12-06 | 2022-09-20 | 南京天秾生物技术有限公司 | Use of 2-amino-3-hydroxy-3-methylbutyric acid and/or 2-amino-3- (4-hydroxyphenyl) butyric acid |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101643746A (en) * | 2009-08-25 | 2010-02-10 | 浙江大学 | Hotness-resistant Lucerne transgenic culturing method |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2003033174A (en) * | 2001-07-10 | 2003-02-04 | Japan Science & Technology Corp | Rhizobium whose nitrogen-fixing ability is enhanced |
| WO2006004914A2 (en) * | 2004-06-28 | 2006-01-12 | Cambia | Biological gene transfer system for eukaryotic cells |
| EP2027275A2 (en) * | 2006-05-16 | 2009-02-25 | Monsanto Technology, LLC | Use of non-agrobacterium bacterial species for plant transformation |
-
2011
- 2011-03-28 CN CN2011100765531A patent/CN102206671A/en active Pending
- 2011-03-28 WO PCT/CN2011/072213 patent/WO2011116708A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101643746A (en) * | 2009-08-25 | 2010-02-10 | 浙江大学 | Hotness-resistant Lucerne transgenic culturing method |
Non-Patent Citations (3)
| Title |
|---|
| 《Journal of Applied Ecology》 19991231 KATHERINE K. DONEGAN等 A field study with genetically engineered alfalfa inoculated with recombinant Sinorhizobium meliloti: effects on the soil ecosystem 第920-936页 第36卷, * |
| 于志晶: "耐盐根瘤工程菌的获得及接种后对紫花苜蓿生长的影响", 《中国优秀硕士学位论文全文数据库农业科技辑》 * |
| 鲍平秋等: "ipt基因转化四季海棠及其抗旱性研究", 《湖北农业科学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110573605A (en) * | 2018-03-08 | 2019-12-13 | 华东理工大学 | Slow rhizobium monooxygenase and application thereof in preparation of chiral sulfoxide |
| CN110573605B (en) * | 2018-03-08 | 2021-11-19 | 华东理工大学 | Slow rhizobium monooxygenase and application thereof in preparation of chiral sulfoxide |
| CN117551792A (en) * | 2024-01-11 | 2024-02-13 | 中国农业科学院草原研究所 | Primer probe set, kit and detection method for detecting silverfish moth |
| CN117551792B (en) * | 2024-01-11 | 2024-03-08 | 中国农业科学院草原研究所 | Primer probe set, kit and detection method for detecting silverfish moth |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2011116708A1 (en) | 2011-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bano et al. | Effect of Azospirillum inoculation on maize (Zea mays L.) under drought stress | |
| Remans et al. | Effects of plant growth-promoting rhizobacteria on nodulation of Phaseolus vulgaris L. are dependent on plant P nutrition | |
| Iruthayathas et al. | Effect of combined inoculation of Azospirillum and Rhizobium on nodulation and N2-fixation of winged bean and soybean | |
| Sulieman et al. | The efficiency of nitrogen fixation of the model legume Medicago truncatula (Jemalong A17) is low compared to Medicago sativa | |
| EA009126B1 (en) | Micro-organisms for the treatment of soil and process for obtaining them | |
| US8252720B2 (en) | Use of Gluconacetobacter with reduced use of nitrogen fertilizer to improve beet crop production | |
| US7162834B2 (en) | Methods for enhancing plant growth using hydrogen gas | |
| Kamali et al. | Effects of Nitroxin and arbuscular mycorrhizal fungi on the agro-physiological traits and grain yield of sorghum (Sorghum bicolor L.) under drought stress conditions | |
| CN108291219A (en) | It is fixed using the nitrogen of reconstruct nif clusters | |
| Felker et al. | A survey of environmental and biological factors (Azospirillum spp, Agrobacterium rhizogenes, Pseudomonas aurantiaca) for their influence in rooting cuttings of Prosopis alba clones | |
| AU603560B2 (en) | Rhizobia transformants which symbiotically fixes nitrogen in non-legumes, a material for treating seeds of a non-legume plant, non-legume seeds, a non-legume plant and a method for producing rhizobia transconjugants | |
| CN102206671A (en) | Method for changing characteristics of plants | |
| CN100491529C (en) | HrpN gene for encoding plant multifunction activity and broad spectrum resistance cell signal factor and its expression product and use | |
| CN106749577A (en) | Stress tolerance correlation transcription factor albumen NAC and its application | |
| Sivasakthivelan et al. | Inoculant Production and Formulation of Azospirillum Species | |
| Scagel | Changes in cutting composition during early stages of adventitious rooting of miniature rose altered by inoculation with arbuscular mycorrhizal fungi | |
| Diouf et al. | Optimisation of inoculation of Leucaena leucocephala and Acacia mangium with rhizobium under greenhouse conditions | |
| Zaman-Allah et al. | Symbiotic response to low phosphorus supply in two common bean (Phaseolus vulgaris L.) genotypes | |
| Anyia et al. | Plant growth-promoting diazotrophs and productivity of wheat on the Canadian prairies | |
| RU2736340C9 (en) | Agricultural growth stimulant | |
| Siczek et al. | Nod factors improve the nitrogen content and rhizobial diversity of faba bean and alter soil dehydrogenase, protease, and acid phosphomonoesterase activities | |
| Sprent | Benefits of Rhizobium to agriculture | |
| Prisa | Myrtillocactus geometrizans fruit plant stimulated with Effective microorganisms | |
| Pascual et al. | Enhanced assimilation rate due to seaweed biostimulant improves growth and yield of rice bean (Vigna umbellata) | |
| Marx | Nitrogen fixation: Prospects for genetic manipulation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20111005 |