CN102206637A - Element for driving gene to be expressed in embryo and application thereof - Google Patents
Element for driving gene to be expressed in embryo and application thereof Download PDFInfo
- Publication number
- CN102206637A CN102206637A CN 201010134090 CN201010134090A CN102206637A CN 102206637 A CN102206637 A CN 102206637A CN 201010134090 CN201010134090 CN 201010134090 CN 201010134090 A CN201010134090 A CN 201010134090A CN 102206637 A CN102206637 A CN 102206637A
- Authority
- CN
- China
- Prior art keywords
- promotor
- polynucleotide
- gene
- construction
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to a tissue specific expression promoter as well as an obtaining method and application thereof. In the invention, a polynucleotide is obtained through screening and separating for the first time, can guide the downstream target gene to be specifically expressed in the embryo of the plant after being connected with the promoter and can be applied to regulate expression of the gene in the plant tissue, thus realizing plant breed improvement.
Description
Technical field
The invention belongs to biological technical field; More specifically, the present invention relates to organizing specific expression promotor and preparation method thereof and application.
Background technology
Promotor is meant one section dna sequence dna that energy accurate and effective initial gene is transcribed in the gene, is usually located at upstream region of gene.Promotor is the critical elements of gene expression regulation, and trans-acting factors (transcription factor) such as it and RNA polymerase and other albumen cofactors interact the level that regulatory gene transcribes and the specificity of spatial and temporal expression thereof.Present most popular constitutive promoter is tobacco mosaic virus (TMV) (CaMV) 35S promoter.Simultaneously, people pay much attention to from plant clone's constitutive promoter itself and win initial success, and Actin muscle (Actin) and the isogenic promotor of ubiquitin (Ubiquitin) are cloned.Mariani etc. successfully utilize tobacco flower pesticide tapetum specific expression gene promotor TA29 to drive nuclease Barnase, RnaseT1 gene specifically expressing in flower pesticide, destroy tapetum, obtain the male sterile rape, this is to create male sterile line by genetically engineered first.Express the ipt gene in the wheat leaf, improve the cell fission cellulose content, chlorophyll degradation is slowed down, the leaf aging is slack-off.Be rich in gluten (Glutelin) in the rice paddy seed, analyze and find GluB, GluD is specifically expressing in seed all.Detailed analysis to the GluB promoter region has also been identified the core parts such as GCN4 that determine its expression specificity.Utilize rice endosperm specific glutenin gene promoters driven phytoene synthase gene PS Y in the past, in paddy endosperm, successfully synthesized this non-existent beta carotene (provitamin A); Also utilize rice endosperm specific glutenin gene promoters driven soybean ferritin gene, the content of iron and zinc all increases to some extent in the render transgenic rice grain, and impels ferritin mainly in endosperm rather than the accumulation of original aleurone layer.Yet it is also few to separate the rice paddy seed specific promoter that obtains so far, and concentrates on glutenin gene family.
The method of traditional acquisition promoter element often exists flux low, specific aim is poor, shortcomings such as workload is big, and along with the development of sequencing technologies, the whole genome sequence of many plants has checked order and has finished, the perfect people of making of the progress of biochip technology and bioinformatic analysis method can have one comprehensively to understand to the expression pattern of plant gene from the genomics aspect, rather than picture can only be confined to limited gene in the past.Haberer etc. pass through sequential analysis between the kind of Arabidopis thaliana and rape genomic level homologous gene promoter region, utilize similar bioinformatics method to obtain 384 new cis elements, and detected the existence of most known transcription regulating nucleotide sequence, proved the feasibility of this method.And at present, Shang Weijian has the genome aspect to seek the report of rice paddy seed specific promoter (regulating and controlling sequence) or enhanser.
Summary of the invention
The object of the present invention is to provide organizing specific expression promotor and application thereof.
In a first aspect of the present invention, a kind of isolating polynucleotide are provided, its nucleotide sequence is shown in SEQ IDNO:5.
In another aspect of this invention, provide the purposes of described polynucleotide, be used for being connected with promotor or promoter fragment operability, the regulation and control goal gene is specific expressed in plant embryos;
Wherein, described promoter fragment has necessary site and the transcripting start point that the initiation of this promotor is transcribed.
In another preference, described plant is the plant with embryo, endosperm and/or kernel texture.
In another preference, described plant is an angiosperm; Preferably, described plant is a monocotyledons; More preferably, described plant is a grass, as paddy rice, wheat, barley, corn, Chinese sorghum etc.
In another aspect of this invention, provide a kind of and be used for regulating and control goal gene at the specific expressed construction of plant embryos, described construction has following element (5 ' → 3 ') successively: (polynucleotide-X)
n, promotor or its fragment;
Wherein, the nucleotide sequence of described polynucleotide is shown in SEQ ID NO:5;
Wherein, n is the positive integer of 1-100; Preferably, n is the positive integer of 1-50; It more preferably is the positive integer of 1-30; Can be 2,3,4,6,8,10,12,16,20 as n;
Wherein X is nothing, or length is at 1-100bp; 1-50bp preferably, 1-20bp more preferably, 1-10bp more preferably, 1-5bp more preferably is as 2, the nucleic acid of 3bp;
Wherein, the fragment of promotor has necessary site and the transcripting start point that the initiation of this promotor is transcribed.
In a preference, described promotor or its fragment contain TATA-box structure.
In another preference, described promotor is selected from (but being not limited to): tobacco mosaic virus (TMV) (CaMV) 35S promoter, or the basic promotor of tobacco mosaic virus (TMV) (CaMV) 35S (CAMV35S mini promoter).
In another preference, the basic promotor of described tobacco mosaic virus (TMV) 35S has the nucleotide sequence shown in the SEQ ID NO:27.
In another preference, the promotor of described construction or its fragment downstream also comprise a goal gene.
In another preference, described goal gene is a foreign gene.
In another preference, described goal gene is a structure gene.
In another preference, described target gene sequences is positioned at the downstream of described promoter sequence, and is and the direct sequence of contiguous encoding gene of described promoter sequence.Usually, the interval of described nucleotide sequence and target gene sequences less than 1000bp (preferred, less than 500bp; Preferred, less than 200bp; Preferred, less than 100bp; Most preferred, less than 50bp).
In another preference, described goal gene includes, but is not limited to: beta-glucosidase (GUS) gene, improve the relevant gene (as human lactoferrin gene, Methionin synthase gene, beta carotene synthetic gene, straight chain and amylopectin synthase gene etc.) of rice or seed quality.
In another preference, described polynucleotide, promotor, link to each other to the goal gene operability.
In another preference, described construction is an expression vector.
In another aspect of this invention, provide a kind of vegetable cell (being preferably non-reproductive material), contain described polynucleotide or described construction in the described cell.
In another aspect of this invention, provide the purposes of described construction, it is specific expressed in plant embryos to be used for regulating and control goal gene.
In another aspect of this invention, provide a kind of goal gene specific expressed method in plant embryos of regulating and control, described method comprises:
(1) provide a construction (expression vector), described construction has following element (5 ' → 3 ') successively: (polynucleotide-X)
n, promotor or its fragment; Wherein, the nucleotide sequence of described polynucleotide is shown in SEQ IDNO:5; N is the positive integer of 1-100; X is nothing, or length is at the nucleic acid of 1-100bp; Wherein the fragment of promotor has necessary site and the transcripting start point that the initiation of this promotor is transcribed;
(2) with the goal gene operability be inserted into the downstream of the construction of step (1);
(3) construction with step (2) insertion goal gene is transferred in vegetable cell or the tissue; With
(4) vegetable cell that has changed described polynucleotide over to or the tissue regeneration that step (3) is obtained becomes plant, thereby goal gene is specific expressed in the embryo of this plant.
Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 has shown the synoptic diagram of the expression vector that makes up.
Fig. 2 has shown that the basic promotor of 35S can not make GUS express in seed.
Fig. 3 has shown the tissue specific expression situation of endosperm specific motif (pES1,3,4).The picture first behavior seed, second behavior flower, the third line is a leaf, and fourth line is a stem, and fifth line is a root.The painted zone of GUS for taking place in the zone as shown by arrows.
Fig. 4 endosperm specific motif (pES2), the tissue specific expression situation of the special motif of embryo (pBY1), seed specific motif (pRS1).The picture first behavior seed, the second behavior leaf, the third line is flower, and fourth line is a stem, and fifth line is a root.The painted zone of GUS for taking place in the zone as shown by arrows.
Fig. 5 has shown the main flow process of cis-acting elements (cis-element) prediction.
Embodiment
The inventor is by extensive and deep research, first by screening and separating to a kind of gene specific expressed polynucleotide (motif) in the specified plant tissue that instruct, described polynucleotide can instruct the goal gene in downstream to be expressed in specifically in the embryo of plant with after promotor or promoter fragment (as basic promotor) are connected.Therefore, can use these polynucleotide and regulate and control expression of gene in the plant tissue, thereby realize plant species improvement etc.Finished the present invention on this basis.
As used herein, unless otherwise indicated, described " polynucleotide " or " motif (motif) " are meant one it can be used as a kind of cis element for the useful nucleotide sequence of the expression of regulatory gene (sequence unit), also can be used as a kind of enhanser.
As used herein, described " promotor " or " promoter region (territory) " is meant a kind of nucleotide sequence, and the upstream (5 ' end) that it is present in the goal gene encoding sequence usually can be transcribed into mRNA by the guiding nucleus acid sequence.Usually, promotor or promoter region provide RNA polymerase and correct initial recognition site of transcribing necessary other factor.In this article, described promotor or promoter region comprise the variant of promotor, and it is by inserting or deletion regulation and control zone, carry out at random or rite-directed mutagenesis waits and obtains.Genetic transcription under tissue or the organ Idiotype promoter regulation generally only occurs in some certain organs or the tissue.Described " promoter fragment " is meant the fragment of this promotor of necessary site that initiation with this promotor is transcribed and transcripting start point; Also promptly, be somebody's turn to do the basic function that " promoter fragment " kept its corresponding promotor.Preferably, described promoter fragment can be basic promotor or core promoter.
As used herein, " cis-regulating element " or " cis element " is meant the gene transcription initial sum transcribed the conservative property base sequence that efficient plays regulating effect.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, described " can operate (property) and connect " or " operability connection " are meant functional spatial disposition of two or more nucleic acid region or nucleotide sequence.For example: promoter region is placed in the specific position with respect to the goal gene nucleotide sequence, makes transcribing of nucleotide sequence be subjected to the guiding of this promoter region, thereby promoter region is " operably connected " on this nucleotide sequence.
As used herein, " goal gene " is meant and can instructs the gene of expressing by motif of the present invention and promotor.Suitable goal gene includes but not limited to: hormone synthesis related gene etc. in beta-glucosidase (GUS) gene, the gene (as human lactoferrin gene, Methionin synthase gene, beta carotene synthetic gene, straight chain and amylopectin synthase gene etc.) that improves plant quality or proterties or phenotypic correlation and the seed.
As used herein, " external source " or " allogenic " is meant from the relation between two of different sources or many nucleic acid or the protein sequence.For example, if the combination of promotor and target gene sequences is not naturally occurring usually, then promotor is an external source for this goal gene.Particular sequence is " external source " for cell or organism that it inserted.
As used herein, term " specific expressed " is meant that goal gene is at specific time and/or specific tissue expression." tissue specificity " claims " organ specificity " again, and under the regulation and control of some controlling elements, gene is often only expressed at some specific organ or tissue position, and shows the characteristic that its relevant growth is regulated.Among the present invention, described " tissue specific expression " is meant specifically expressing in albumen, embryo or seed.Usually, if mRNA is with than at least 5 times of height in other tissue or organ in certain tissue or organ, preferably high at least 10 times, more preferably high at least 100 times, most preferably high at least 1000 times of levels are expressed, and think that then Expression of Related Genes is a tissue or organ specific.
As used herein, described " plant " is the plant with embryo, endosperm structure.Those skilled in the art know, the moiety of plant embryos or endosperm is similar, plant with embryo or endosperm structure has the common characteristic, the gene or the regulatory element that exist many conservative regulatory genes to transcribe, express in its genome, for example a series of regulation and control plants form the element of embryo or endosperm.Therefore can determine: can regulate and control goal gene specific expressed motif (or motif-promotor) in the embryo of grass or endosperm or seed and also can regulate and control goal gene other plant beyond grass and produce same expression characterization with embryo or endosperm structure.As optimal way of the present invention, described plant is an angiosperm; Preferably, described plant is a monocotyledons; More preferably, described plant is a grass, as paddy rice, wheat, barley, corn, Chinese sorghum etc.
As used herein, described " non-reproductive material " is meant a kind of biomaterial, and it does not have by photosynthesis, maintains the characteristic of existence with inorganics synthetic carbohydrate, protein such as water, carbonic acid gas and inorganic salt.
The invention provides and a kind ofly regulate and control goal gene at the specific expressed motif of plant tissue, its nucleotide sequence is as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6 are arbitrary.Wherein, but specific expressed in the endosperm of grass as the motif driving purposes gene shown in SEQ ID NO:1, SEQ ID NO:2, SEQ IDNO:3 or SEQ ID NO:4 are arbitrary, its nucleotide sequence; But the motif driving purposes gene shown in SEQ ID NO:5 is specific expressed in the embryo of grass, its nucleotide sequence; But the motif driving purposes gene shown in SEQ ID NO:6 is specific expressed in the seed of grass.
The hybridization of polynucleotide is technology well known to those skilled in the art, the indication of hybridization characteristic their similarity or the identity of specific a pair of nucleic acid.Therefore, the invention still further relates to and aforementioned specified nucleotide sequence hybridization and two sequences between have at least 80%, preferably at least 90%, the polynucleotide of at least 95% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.
" stringent condition " or " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only the homogeny between two sequences at least 50%, preferred more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85% or more than 90%, be more preferably 95% and just hybridize when above.And, interfertile polynucleotide also have SEQ ID NO:1-6 arbitrary shown in the identical regulating and controlling effect of motif.
The present invention also comprises with any motif sequence of the present invention having more than 80%, more preferably more than 90%, the nucleic acid of 95% above homogeny most preferably, described nucleic acid also have SEQ ID NO:1-6 arbitrary shown in the identical regulating and controlling effect of motif." homogeny " be meant according to the identical per-cent in position, the similar level (being sequence homology, similarity or identity) between two or many nucleic acid.
The inventor finds, under the guidance of described motif-promotor, beta-glucosidase (GUS) gene specific ground expressed in endosperm, embryo or the seed of plant.Therefore as seen, motif of the present invention is a kind of tissue or organ specific regulating and controlling sequence.Its quality (by the driving purposes specific gene expression) for fixed point ground improvement plant is useful especially.The a series of beta-glucoside of beta-glucosidase (GUS) energy catalytic pyrolysis produces the material with chromophoric group or fluorescence, and methods such as available spectrophotometer, photofluorometer or histological chemistry are carried out quantitatively and the spatial positioning analysis the GUS activity.In the art, gus gene has been widely used as the reporter gene of transgenic plant, bacterium and fungi, and particularly it can be used to study the concrete cell and the tissue site of exogenous gene expression.
Having important use in resonable opinion research of the relevant motif of tissue specific expression of the present invention and the agronomy improvement is worth.These motifs can be applied to mark particular organization, guide specific functional gene to express in specific tissue, and grow research and the specific aim improvement that are applied to peculiar tissue.Described motif can be repeatedly to repeat (as 2-100 time), generally repeatedly repeat to make function to strengthen, the effect that is enhanser can add up, enhancer sequence lumps together, even insert some other sequences wherein, the effect of transcribing reinforcement also can strengthen greatly (referring to Zhu Yuxian, Li Yi, Zheng Xiaofeng; Modern molecular biology; Higher Education Publishing House; 2007).Usually, repeatedly in the tumor-necrosis factor glycoproteins, the length of inserting other sequence (intervening sequence) between two motifs is at 1-100bp, 1-50bp preferably, and 1-20bp more preferably, 1-10bp more preferably, 1-5bp more preferably is as 2,3bp.Described intervening sequence for example is a restriction enzyme site etc.Repeatedly tumor-necrosis factor glycoproteins also can be referring to Chen Jun for the reinforcement of Transcription, Yang Zhifan, Zhang Wenjuan; The clone of 4 * 35s enhanser and functional verification thereof; Central China University of Science and Technology's journal (natural science edition), 2006,02,118-121; Wu etc. also find, GCN4 motif for its endosperm expression specificity of decision in the promotor of paddy gene Glu-B1, make increasing of its multiplicity along with artificial constructed, also corresponding (the Wu CY that is enhanced of the expression level of the reporter gene of its driving, Suzuki A, Washida H, Takaiwa F.The GCN4 motif in a rice glutelingene is essential for endosperm-specific gene expression and is activated byOpaque-2 in transgenic rice plants.Plant J.1998,14,673-83).
Motif of the present invention is connected with promotor (as basic promotor) operability usually, be connected with the goal gene operability, thereby the driving purposes gene is specific expressed again.
Described promotor or its fragment have no particular limits, as long as it contains TATA-box structure, can cause and transcribe, and be useful is connected the back with described motif for the startup downstream gene expression.Described TATA-box structure sequence is conservative at the eukaryote camber, also ubiquity in prokaryotic organism, and be widely used in the promotor research by this area.On promotor, the TATA box generally is in very the position near transcripting start point (usually in 50 base pairs).
Promotor of the present invention contains TATA-box structure, as the basic promotor of tobacco mosaic virus (TMV) 35S (CAMV35S mini promoter).The basic promoter region of 35S mainly is a TATA-box structural area, and this structure sequence is conservative at the eukaryote camber, also ubiquity (Zhu Yuxian, Li Yi, Zheng Xiaofeng in prokaryotic organism; Modern molecular biology; Higher Education Publishing House; 2007), and be widely used in the promotor research, (Shen H such as Shen, Yang HJ, Wang ZY.Inducible Expression of OsEBP-89 Gene inRice.Journal Of Plant Physiology and Molecular Biology, 2004,30 (1): 87-93), (Wu CY such as Wu, Suzuki A, Washida H, Takaiwa F.The GCN4 motif in a rice glutelingene is essential for endosperm-specific gene expression and is activated byOpaque-2 in transgenic rice plants.Plant is J.1998,14,673-83; Wu C, Washida H, Onodera Y, Harada K, Takaiwa F.Quantitative nature of the Prolamin-box, ACGTand AACA motifs in a rice glutelin gene promoter:minimal cis-elementrequirements for endosperm-specific gene expression.Plant J.2000,23,415-21), (Yoshihara T such as Yoshihara, Washida H, Takaiwa F.A 45-bp proximal regioncontaining AACA and GCN4 motif is sufficient to confer endosperm-specificexpression of the rice storage protein glutelin gene, GluA-3.FEBS Lett.1996,383,213-8) people all merges different promoters (enhanser) and the basic promotor of 35S with the expression that starts goal gene under study for action.
As an example of the present invention, described promotor is the basic promotor (CAMV35S mini promoter) of tobacco mosaic virus (TMV) (CaMV) 35S, it contains TATA-box structural area, this structure sequence is conservative at the eukaryote camber, also ubiquity in prokaryotic organism, and be widely used in the promotor research.The sequence of the basic promotor of described 35S such as CGCAAGACCCTTCCTC
TATATAAGGAAGTTCATTTCATTTGG AGAG (SEQID NO:27).
Directly link to each other between described promotor and the motif, perhaps, also contain other nucleotide sequence between them, the length of described other nucleotide sequence is at 1-1000bp, 1-500bp preferably, and 1-200bp more preferably, as 100bp, 50bp, 20bp, 10bp.Certainly, the intervening sequence of other length (as longer) also can exist, and needs only it and exists the operability that does not influence between above-mentioned each element to link to each other, not the transcript and expression of suppressor gene.Described intervening sequence for example is restriction enzyme site or stochastic sequence etc.
Described goal gene can be external source (allos) for motif and promotor.Nucleotide sequence to described goal gene has no particular limits (as a kind of structural nucleotide sequence), and described goal gene optimized encoding has the albumen of specific function, and for example some has the albumen of key property or function in agricultural or plant improvement.Suitable goal gene includes but not limited to: improvement plant quality, proterties or the relevant gene of metabolism.
Described motif and promotor can also be operably connected with the target gene sequences that is modified, and this goal gene is external source (allos) with respect to promotor.Described goal gene can be modified and produce various desired characteristics.For example, goal gene can be modified increases contents of essential amino acids, improves the translation of aminoacid sequence, change the modification (as phosphorylation site) after translating, outside the translation product transporte to cells, improve proteic stability, insert or delete cell signal etc.
In addition, described motif and promotor can be designed to reduce specific gene.This generally is to realize that by motif and promotor are connected on the target gene sequences this sequence oppositely is directed with antisense.Those of ordinary skill in the art is familiar with this antisense technology.Any nucleotide sequence can be conditioned by this way.
Any aforesaid promotor and/or target gene sequences can be comprised in the recombination to construct thing (recombinant vectors).
As a kind of mode, described recombinant vectors comprises motif of the present invention, comprises promotor in the downstream of described motif, comprises multiple clone site or at least one restriction enzyme site in the downstream of described promotor.When needs are expressed goal gene, goal gene is connected in the suitable multiple clone site or restriction enzyme site, thereby goal gene is operably connected with motif-promotor.
As another kind of mode, described recombinant vectors comprises (from 5 ' to 3 ' direction): motif-promotor that the guiding goal gene is transcribed, and goal gene.If desired, described recombinant vectors can also comprise 3 ' transcription terminator, 3 ' polymerized nucleoside acidifying signal, other untranslated nucleotide sequence, transhipment and target nucleotide sequence, resistance selective marker, enhanser or operation.
The method that is used to prepare recombinant vectors is well known in the art.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus or other carriers.In a word, as long as it can duplicate in host and stablize, any plasmid and carrier all are can be adopted.
Method well-known to those having ordinary skill in the art can be used to make up the expression vector that contains promotor of the present invention and/or target gene sequences.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, as Tetrahydrofolate dehydrogenase, neomycin resistance, hygromycin resistance and green fluorescent protein (GFP) etc.
Except containing motif-promotor of the present invention, also can contain one or more other motif or promotors in the recombinant vectors.Described other promotor for example is: tissue-specific, composing type or induction type.For example the cauliflower mosaic virus 19S of mannosaminic acid synthetic enzyme and 35S (CaMV19S CaMV35S), enhanced CaMV, tobacco RB7 etc.
Comprise the above-mentioned suitable promotor and the carrier of goal gene, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as vegetable cell.Representative example has: intestinal bacteria, streptomyces, Agrobacterium; Fungal cell such as yeast; Vegetable cell etc.Persons skilled in the art all know how to select appropriate carriers and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be handled with the CaCl2 method in exponential growth after date results, and used step is well-known in this area.Another kind method is to use MgCl2.If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.Transform plant and also can use methods such as Agrobacterium-mediated Transformation or particle gun conversion, for example leaf dish method, rataria conversion method, bud infusion method etc.Can use ordinary method regeneration plant for plant transformed cell, tissue or organ, thereby obtain genetically modified plant.
As a kind of mode, the method for preparing transgenic plant is: the expression vector that will carry motif-promotor and goal gene (being operably connected) changes Agrobacterium over to, and the carrier segments that Agrobacterium will contain promotor and goal gene again is incorporated on the karyomit(e) of plant.The transgene receptor plant that relates to for example is paddy rice, wheat, barley and corn.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
The preliminary screening of the motif of embodiment 1, expression specificity
The present invention's nutritive issue (root, leaf, seedling) of drawing materials, and the rice paddy seed of different developmental phases and it is divided into embryo and endosperm are made the affymatrix chip.Utilize this chip, can isolate the gene of specifically expressing in rice paddy seed more accurately.The inventor with embryo (perhaps endosperm) as an analytical element, with nutritive issue as another analytical element, find out the gene of relative nutritive issue specifically expressing (significantly high expression level), it is carried out non-supervision cluster, obtain the close genome of expression pattern, each group gene promoter area is compared (according to the similarity of motif, the present position, and principle such as gibbs energy), what obtain the candidate may determine the specific motif (motif of genetic expression, may be cis element, also may belong to enhanser).To carry out the secondary filtration screening to this part candidate's motif inventor.At first, the calculated candidate motif is in the whole genome scope and the hypergeometric distribution in the seed specific expression gene, and whether high concentration is in the gene of seed specific high expression level to check it, selects the motif that there were significant differences and makes subsequent analysis; Secondly, according to the results of screening first time, known plants cis element in itself and PLACE (Plant cis-acting Regulatory DNAElements) and AGRIS (the The Arabidopsis Gene Regulatory Information Server) database is compared, remove well known elements, the member who obtains is last calculation result, is used for next step experimental verification.The main flow process of cis-acting elements prediction is seen Fig. 5.
Obtain before the filtering screening among the result, include most of known EMBRYO IN RICE or endosperm specific cis element, the hypergeometric distribution variance analysis shows its significantly intensive in the seed specific expression gene (p＜0.05), has proved the feasibility of these method of calculation.According to the statistics to well known elements length among PLACE and the AGRIS, the motif length that the inventor chooses analysis is in 6～31bp scope in addition.
Finally, calculate 13 of endosperm specific motifs, 18 of the special motifs of embryo see Table 1.
Table 1, p＜0.05 and in database, do not have the motif of matching sequence
Embryo (pBY) and seed (pRS)
| motif01 | GGCCTGG | 0.04924 | SEQ?ID?NO：5 |
| motif02 | AACCCTAG | 0.019805 | SEQ?ID?NO：28 |
| motif03 | TAGACTG | 0.000184 | SEQ?ID?NO：29 |
| motif04 | AGCTAGC | 0.006183 | SEQ?ID?NO：30 |
| motif05 | CGTCCGAT | 0.025469 | SEQ?ID?NO：31 |
| motif06 | TACATACA | 0.043309 | SEQ?ID?NO：32 |
| motif07 | GTGCGTGCG | 0.042511 | SEQ?ID?NO：33 |
| motif08 | AATAAGACGAATGGTC | 0.018682 | SEQ?ID?NO：34 |
| motif09 | TGTAATTACA | 0.012906 | SEQ?ID?NO：35 |
| motif10 | TAAGCCTAATT | 0.003255 | SEQ?ID?NO：36 |
| motif11 | TAATAGCTAA | 1.14E-06 | SEQ?ID?NO：37 |
| motif12 | CTGGTCTGACCGGC | 2.06E-19 | SEQ?ID?NO：38 |
| motif13 | GAAACGGAGGGAGTA | 0.048481 | SEQ?ID?NO：39 |
| motif14 | GTCCGTGCTGCAGCTGGCTACAA | 0.007973 | SEQ?ID?NO：6 |
| motif15 | CGCACGCA | 0.003825 | SEQ?ID?NO：40 |
| motif16 | ACGAATGAT | 1.98E-05 | SEQ?ID?NO：41 |
| motif17 | GCTCGA | 0.009138 | SEQ?ID?NO：42 |
| motif18 | GTCCTTGCC | 1.91E-09 | SEQ?ID?NO：43 |
Endosperm (pES)
| motif01 | CTACCT | 0.002866 | SEQ?ID?NO：44 |
| motif02 | GCTGTA | 0.000468 | SEQ?ID?NO：1 |
| motif03 | CGCTCGC | 0.006339 | SEQ?ID?NO：45 |
| motif04 | GCATGCGC | 0.013418 | SEQ?ID?NO：46 |
| motif05 | CGATTCGT | 0.035906 | SEQ?ID?NO：47 |
| motif06 | AGGGGAGGG | 0.0001 | SEQ?ID?NO：2 |
| motif07 | TGTGTGTGTG | 0.032963 | SEQ?ID?NO：48 |
| motif08 | CCTCCTCCTCCTC | 0.021831 | SEQ?ID?NO：49 |
| motif09 | TCGGACTATCTGA | 0.00642 | SEQ?ID?NO：50 |
| motif10 | ATATATATATATATAT | 0.022662 | SEQ?ID?NO：51 |
| motif11 | ACCTGATAGGTATCAT | 0.004162 | SEQ?ID?NO：52 |
| motif12 | TCACAAAACTACAGATTTA | 0.000129 | SEQ?ID?NO：3 |
| motif13 | TAGGCTTAAAAGATTCGTCTCGC | 0.00072 | SEQ?ID?NO：4 |
The motif of expression specificity is determined in embodiment 2, expression experiment
Make up 4 tumor-necrosis factor glycoproteinss respectively and start GUS and express, finish vector construction and Plant Transformation, expressive site in paddy rice and corresponding expression amount by examining report gene GUS detect motif to the specific decisive action of gene spatial and temporal expression.
The plasmid construction of rice transformation is according to following thinking: above-mentioned motif is made up 4 tumor-necrosis factor glycoproteinss, after connect the basic promotor of tobacco mosaic virus (TMV) 35S, link to each other (as shown in Figure 1) with reporter gene GUS again.By the detection at reporter gene expression position, the reflection motif is to the decisive action of genetic expression.
It is as follows to screen 4 endosperm specific motifs (pES1～4), 1 special motif of embryo (pBY1), 1 seed specific motif (pRS1) altogether:
pES1：GCTGTA(SEQ?ID?NO：1)；
pES2：AGGGGAGGG(SEQ?ID?NO：2)；
pES3：TCACAAAACTACAGATTTA(SEQ?ID?NO：3)；
pES4：TAGGCTTAAAAGATTCGTCTCGC(SEQ?ID?NO：4)；
pBY1：GGCCTGG(SEQ?ID?NO：5)；
pRS1：GTCCGTGCTGCAGCTGGCTACAA(SEQ?ID?NO：6)。
Material therefor:
The pCAMBIA1300+pBI101 plasmid is transformed by pCAMBIA1300 (available from CAMBIA company) and is formed, concrete remodeling method is as follows: the GUS-NOS coding region of pBI101 (available from Clontech company) is cut out with HindIII/EcoRI, be connected in the corresponding restriction enzyme site of pCAMBIA1300.Improved carrier tool Kan resistance (bacterial strain) and Hyg resistance (plant) are used to make up promoter-driven GUS reporter gene carrier, the expression pattern of research gene promoter.
Synthetic following dna sequence dna (DNA oligo):
The basic promotor of 35S:
Forward (SEQ ID NO:7):
CTAGACGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCC
Negative sense (SEQ ID NO:8):
GGGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCGT
pES1：
Forward (SEQ ID NO:9): agcttGCTGTAtcgaGCTGTAtcgaGCTGTAtcgaGCTGTA
Negative sense (SEQ ID NO:10): ctagTACAGCTCGATACAGCTCGATACAGCTCGATACAGCa
pES2：
Forward (SEQ ID NO:11): agctt AGGGGAGGG tcga AGGGGAGGG tcga AGGGGAGGGtcga AGGGGAGGG
Negative sense (SEQ ID NO:12):
ctag?CCCTCCCCTTCGACCCTCCCCTTCGACCCTCCCCTTCGACCCTCCCCT?a
pES3-1：
Forward (SEQ ID NO:13):
g?TCACAAAACTACAGATTTA?tcga?TCACAAAACTACAGATTTA
Negative sense (SEQ ID NO:14):
ctag?TAAATCTGTAGTTTTGTGATCGATAAATCTGTAGTTTTGTGA?ctgca
pES3-2：
Forward (SEQ ID NO:15):
Agctt?TCACAAAACTACAGATTTA?tcga?TCACAAAACTACAGATTTA?tgca
Negative sense (SEQ ID NO:16): TAAATCTGTAGTTTTGTGATCGATAAATCTGTAGTTTTGTGAa
pES4-1：
Forward (SEQ ID NO:17):
g?TAGGCTTAAAAGATTCGTCTCGC?tcga?TAGGCTTAAAAGATTCGTCTCGC
Negative sense (SEQ ID NO:18):
C?tag?GCGAGACGAATCTTTTAAGCCTATCGAGCGAGACGAATCTTTTAAGCCTA?ctgca
pES4-2：
Forward (SEQ ID NO:19):
Agctt?TAGGCTTAAAAGATTCGTCTCGC?tcga?TAGGCTTAAAAGATTCGTCTCGC?tgca
Negative sense (SEQ ID NO:20):
GCGAGACGAATCTTTTAAGCCTATCGAGCGAGACGAATCTTTTAAGCCTA?a
pBY1：
Forward (SEQ ID NO:21):
agctt?GGCCTGG?tcga?GGCCTGG?tcga?GGCCTGG?tcga?GGCCTGG
Negative sense (SEQ ID NO:22):
ctag?CCAGGCCTCGACCAGGCCTCGACCAGGCCTCGACCAGGCC?a
pRS1-1：
Forward (SEQ ID NO:23):
g?GTCCGTGCTGCAGCTGGCTACAA?TCGA?GTCCGTGCTGCAGCTGGCTACAA
Negative sense (SEQ ID NO:24):
ctag?TTGTAGCCAGCTGCAGCACGGACTCGATTGTAGCCAGCTGCAGCACGGAC?ctgca
pRS1-2：
Forward (SEQ ID NO:25):
agctt?GTCCGTGCTGCAGCTGGCTACAA?TCGA?GTCCGTGCTGCAGCTGGCTACAA?tgca
Negative sense (SEQ ID NO:26):
TTGTAGCCAGCTGCAGCACGGACTCGATTGTAGCCAGCTGCAGCACGGAC?a
Each is organized positive negative sense DNA annealing and forms duplex structure.The system of setting up is as follows:
| Remove the water of nuclease | 50μl |
| The annealing buffer of DNA Oligos (5 *) | 10μl |
| DNA?oligo?A(50μM) | 20μl |
| DNA?oligo?B(50μM) | 20μl |
| Cumulative volume | 100μl |
Wherein, annealing buffer: 1M NaCl; 100mM Tris-HCl, pH 7.4.
Treating that annealed DNA oligo uses MiliQ water or redistilled water through sterilization to be mixed with 50 μ M.The annealing buffer of dissolving DNA Oligos (10X), mixing is standby.
Add all ingredients, mixing successively according to said sequence.If used PCR instrument does not have the heat lid, drip mineral oil (mineral oil) to avoid evaporating.
The following PCR of setting instrument carries out annealing reaction:
| Step | Temperature | Time | Explanation |
| 1 | 95℃ | 2 minutes | Allow the abundant sex change of oligo |
| 2 | Descended 0.1 ℃ in per 8 seconds, and reduced to 25 ℃ (annotating 1) | About 90 minutes | Annealing |
| 3 | 4℃ | Keep for a long time | Deposit |
Annotate 1:, also can be set to 1 ℃ of decline in per 90 seconds if used PCR instrument does not possess the function of 0.1 ℃ of decline.
Annealing can be directly used in ligation after finishing, also can be frozen standby at-20 ℃.Wait other reaction if annealing end back plan carrying out enzyme is cut, the most handy purification kit carries out purifying, and the product volume in reaction system of perhaps guaranteeing to anneal is no more than 5%, to avoid the interference of annealing buffer to follow-up enzyme reaction system.
The pCAMBIA1300+pBI101 plasmid with the XbaI/SmaI double digestion, is connected the basic promotor of tobacco mosaic virus (TMV) (CaMV) 35S and enters, be built into the pCAMV46-GUS plasmid.
,, will take off fiery fragment and be connected with the HindIII/SmaI double digestion the pCAMV46-GUS plasmid with linearization plasmid to pES1, pES2, pBY1; To pES3, pES4, pRS1, two sections take off fiery fragment simultaneously do ligation with linearization plasmid behind the terminal phosphate mixings.Finishing pX-CAMV46-GUS makes up.
After plasmid construction is finished, utilize Agrobacterium EHA105 (referring to Hood, E.E. etc., 1993, NewAgrobacterium helper plasmids for gene transfer to plants.Transgen.Res.2:208-218) infects the method for conversion, spend 11 in the rice transformation kind; With the plant that transforms the pCAMV46-GUS plasmid in contrast.To T1 for transformed plant by the expression of dyeing process examining report gene GUS in each tissue, getting seed, Xiao Hua, blade herein is representative.
Gus gene detection of expression method:
Reagent: Gus substrate X-GlucA (X-glucronide, B-6650, Sigma company) makes solvent with dimethyl formamide (DMF), is made into the mother liquor of 5mg/ml ,-20 ℃ of preservations.Reaction buffer: 100mmol/L.
NaH
2PO
4/Na
2HPO
4(PH?7.0)，0.5mmol/L?K
3[Fe(CN)
6]，0.5mmol/LK
4[Fe(CN)
4]，10mmol/L?EDTA。
The Gus gene expression analysis:
Get the transgenic rice plant blade and put into the damping fluid that contains X-Gluc (final concentration is 0.5mg/ml) substrate, bleeding makes its back that sinks in 37 ℃ of insulations two hours.Observe GUS dyeing situation after the decolouring with 95% ethanol fast at 60 ℃, show blue positive.Result such as Fig. 2-4.
The GUS that transforms the plant of pCAMV46-GUS plasmid dyes situation as shown in Figure 2, and the visible basic promotor of 35S can not make GUS express in seed.
The tissue specific expression situation of endosperm specific motif (pES 1,3,4) as shown in Figure 3, the tissue specific expression situation of endosperm specific motif (pES2) is as shown in Figure 4.The picture first behavior seed, second behavior flower, the third line is a leaf, and fourth line is a stem, and fifth line is a root.The painted zone of GUS for taking place in the zone as shown by arrows, and visible GUS specificity is expressed in endosperm.
The tissue specific expression situation of the special motif of embryo (pBY1) as shown in Figure 4.The picture first behavior seed, second behavior flower, the third line is a leaf, and fourth line is a stem, and fifth line is a root.The painted zone of GUS for taking place in the zone as shown by arrows, and visible GUS specificity is expressed in embryo.
The tissue specific expression situation of seed specific motif (pRS1) as shown in Figure 4.The picture first behavior seed, second behavior flower, the third line is a leaf, and fourth line is a stem, and fifth line is a root.The painted zone of GUS for taking place in the zone as shown by arrows, and visible GUS specificity is expressed in seed.
To sum up, pES1～4 drive gene and express in endosperm, and pBY1 drives gene and expresses in embryo, and pRS1 drives gene and expresses in seed.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Shanghai Inst. of Life Science, CAS
＜120〉organizing specific expression promotor and preparation method thereof and application
<130>100619
<160>52
<170>PatentIn?version?3.3
<210>1
<211>6
<212>DNA
＜213〉polynucleotide
<400>1
gctgta 6
<210>2
<211>9
<212>DNA
＜213〉polynucleotide
<400>2
aggggaggg 9
<210>3
<211>19
<212>DNA
＜213〉polynucleotide
<400>3
tcacaaaact?acagattta 19
<210>4
<211>23
<212>DNA
＜213〉polynucleotide
<400>4
taggcttaaa?agattcgtct?cgc 23
<210>5
<211>7
<212>DNA
＜213〉polynucleotide
<400>5
ggcctgg 7
<210>6
<211>23
<212>DNA
＜213〉polynucleotide
<400>6
gtccgtgctg?cagctggcta?caa 23
<210>7
<211>56
<212>DNA
＜213〉polynucleotide
<400>7
ctagacgcaa?gacccttcct?ctatataagg?aagttcattt?catttggaga?ggaccc 56
<210>8
<211>52
<212>DNA
＜213〉polynucleotide
<400>8
gggtcctctc?caaatgaaat?gaacttcctt?atatagagga?agggtcttgc?gt 52
<210>9
<211>41
<212>DNA
＜213〉polynucleotide
<400>9
agcttgctgt?atcgagctgt?atcgagctgt?atcgagctgt?a 41
<210>10
<211>41
<212>DNA
＜213〉polynucleotide
<400>10
ctagtacagc?tcgatacagc?tcgatacagc?tcgatacagc?a 41
<210>11
<211>53
<212>DNA
＜213〉polynucleotide
<400>11
agcttagggg?agggtcgaag?gggagggtcg?aaggggaggg?tcgaagggga?ggg 53
<210>12
<211>63
<212>DNA
＜213〉polynucleotide
<400>12
ctagccctcc?ccttcgaccc?tccccttcga?ccctcccctt?cgaccctccc?cta 53
<210>13
<211>43
<212>DNA
＜213〉polynucleotide
<400>13
gtcacaaaac?tacagattta?tcgatcacaa?aactacagat?tta 43
<210>14
<211>51
<212>DNA
＜213〉polynucleotide
<400>14
ctagtaaatc?tgtagttttg?tgatcgataa?atctgtagtt?ttgtgactgc?a 51
<210>15
<211>51
<212>DNA
＜213〉polynucleotide
<400>15
agctttcaca?aaactacaga?tttatcgatc?acaaaactac?agatttatgc?a 51
<210>16
<211>43
<212>DNA
＜213〉polynucleotide
<400>16
taaatctgta?gttttgtgat?cgataaatct?gtagttttgt?gaa 43
<210>17
<211>51
<212>DNA
＜213〉polynucleotide
<400>17
gtaggcttaa?aagattcgtc?tcgctcgata?ggcttaaaag?attcgtctcg?c 51
<210>18
<211>59
<212>DNA
＜213〉polynucleotide
<400>18
ctaggcgaga?cgaatctttt?aagcctatcg?agcgagacga?atcttttaag?cctactgca 59
<210>19
<211>59
<212>DNA
＜213〉polynucleotide
<400>19
agctttaggc?ttaaaagatt?cgtctcgctc?gataggctta?aaagattcgt?ctcgctgca 59
<210>20
<211>51
<212>DNA
＜213〉polynucleotide
<400>20
gcgagacgaa?tcttttaagc?ctatcgagcg?agacgaatct?tttaagccta?a 51
<210>21
<211>45
<212>DNA
＜213〉polynucleotide
<400>21
agcttggcct?ggtcgaggcc?tggtcgaggc?ctggtcgagg?cctgg 45
<210>22
<211>45
<212>DNA
＜213〉polynucleotide
<400>22
ctagccaggc?ctcgaccagg?cctcgaccag?gcctcgacca?ggcca 45
<210>23
<211>51
<212>DNA
＜213〉polynucleotide
<400>23
ggtccgtgct?gcagctggct?acaatcgagt?ccgtgctgca?gctggctaca?a 51
<210>24
<211>59
<212>DNA
＜213〉polynucleotide
<400>24
ctagttgtag?ccagctgcag?cacggactcg?attgtagcca?gctgcagcac?ggacctgca 59
<210>25
<211>59
<212>DNA
＜213〉polynucleotide
<400>25
agcttgtccg?tgctgcagct?ggctacaatc?gagtccgtgc?tgcagctggc?tacaatgca 59
<210>26
<211>51
<212>DNA
＜213〉polynucleotide
<400>26
ttgtagccag?ctgcagcacg?gactcgattg?tagccagctg?cagcacggac?a 51
<210>27
<211>46
<212>DNA
＜213〉polynucleotide
<400>27
cgcaagaccc?ttcctctata?taaggaagtt?catttcattt?ggagag 46
<210>28
<211>8
<212>DNA
＜213〉polynucleotide
<400>28
aaccctag 8
<210>29
<211>7
<212>DNA
＜213〉polynucleotide
<400>29
tagactg 7
<210>30
<211>7
<212>DNA
＜213〉polynucleotide
<400>30
agctagc 7
<210>31
<211>8
<212>DNA
＜213〉polynucleotide
<400>31
cgtccgat 8
<210>32
<211>8
<212>DNA
＜213〉polynucleotide
<400>32
tacataca 8
<210>33
<211>9
<212>DNA
＜213〉polynucleotide
<400>33
gtgcgtgcg 9
<210>34
<211>16
<212>DNA
＜213〉polynucleotide
<400>34
aataagacga?atggtc 16
<210>35
<211>10
<212>DNA
＜213〉polynucleotide
<400>35
tgtaattaca 10
<210>36
<211>11
<212>DNA
＜213〉polynucleotide
<400>36
taagcctaat?t 11
<210>37
<211>10
<212>DNA
＜213〉polynucleotide
<400>37
taatagctaa 10
<210>38
<211>14
<212>DNA
＜213〉polynucleotide
<400>38
ctggtctgac?cggc 14
<210>39
<211>15
<212>DNA
＜213〉polynucleotide
<400>39
gaaacggagg?gagta 15
<210>40
<211>8
<212>DNA
＜213〉polynucleotide
<400>40
cgcacgca 8
<210>41
<211>9
<212>DNA
＜213〉polynucleotide
<400>41
acgaatgat 9
<210>42
<211>6
<212>DNA
＜213〉polynucleotide
<400>42
gctcga 6
<210>43
<211>9
<212>DNA
＜213〉polynucleotide
<400>43
gtccttgcc 9
<210>44
<211>6
<212>DNA
＜213〉polynucleotide
<400>44
ctacct 6
<210>45
<211>7
<212>DNA
＜213〉polynucleotide
<400>45
cgctcgc 7
<210>46
<211>8
<212>DNA
＜213〉many nucleic acids
<400>46
gcatgcgc 8
<210>47
<211>8
<212>DNA
＜213〉polynucleotide
<400>47
cgattcgt 8
<210>48
<211>10
<212>DNA
＜213〉polynucleotide
<400>48
tgtgtgtgtg 10
<210>49
<211>13
<212>DNA
＜213〉polynucleotide
<400>49
cctcctcctc?ctc 13
<210>50
<211>13
<212>DNA
＜213〉polynucleotide
<400>50
tcggactatc?tga 13
<210>51
<211>16
<212>DNA
＜213〉polynucleotide
<400>51
atatatatat?atatat 16
<210>52
<211>16
<212>DNA
＜213〉polynucleotide
<400>52
acctgatagg?tatcat 16
Claims (11)
1. isolating polynucleotide is characterized in that, its nucleotide sequence is shown in SEQ ID NO:5.
2. the purposes of the described polynucleotide of claim 1 is used for being connected with promotor or promoter fragment operability, and the regulation and control goal gene is specific expressed in plant embryos;
Wherein, described promoter fragment has necessary site and the transcripting start point that the initiation of this promotor is transcribed.
3. a construction is characterized in that, described construction has following element (5 ' → 3 ') successively: (polynucleotide-X)
n, promotor or its fragment;
Wherein, the nucleotide sequence of described polynucleotide is shown in SEQ ID NO:5;
Wherein, n is the positive integer of 1-100;
Wherein, X is nothing, or length is at the nucleic acid of 1-100bp;
Wherein, the fragment of promotor has necessary site and the transcripting start point that the initiation of this promotor is transcribed.
4. construction as claimed in claim 3 is characterized in that, described promotor or its fragment contain TATA-box structure.
5. as claim 3 or 4 described constructions, it is characterized in that described promotor or promoter fragment are selected from: tobacco mosaic virus (TMV) 35S promoter, or the basic promotor of tobacco mosaic virus (TMV) 35S.
6. construction as claimed in claim 5 is characterized in that, the basic promotor of described tobacco mosaic virus (TMV) 35S has the nucleotide sequence shown in the SEQ ID NO:27.
7. construction as claimed in claim 3 is characterized in that, the promotor of described construction or its fragment downstream also comprise a goal gene.
8. construction as claimed in claim 3 is characterized in that described construction is an expression vector.
9. a vegetable cell is characterized in that, contains the arbitrary described construction of described polynucleotide of claim 1 or claim 3-8 in the described cell.
10. the purposes of the arbitrary described construction of claim 3-8, it is specific expressed in plant embryos to be used for regulating and control goal gene.
11. regulate and control goal gene specific expressed method in plant embryos, it is characterized in that described method comprises for one kind:
(1) provide a construction, described construction has following element (5 ' → 3 ') successively: (polynucleotide-X)
n, promotor or its fragment; Wherein, the nucleotide sequence of described polynucleotide is shown in SEQ ID NO:5; N is the positive integer of 1-100; X is nothing, or length is at the nucleic acid of 1-100bp; Wherein the fragment of promotor has necessary site and the transcripting start point that the initiation of this promotor is transcribed;
(2) with the goal gene operability be inserted into the downstream of the construction of step (1);
(3) construction with step (2) insertion goal gene is transferred in vegetable cell or the tissue; With
(4) vegetable cell that has changed described polynucleotide over to or the tissue regeneration that step (3) is obtained becomes plant, thereby goal gene is specific expressed in the embryo of this plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010134090.5A CN102206637B (en) | 2010-03-29 | 2010-03-29 | Element for driving gene to be expressed in embryo and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010134090.5A CN102206637B (en) | 2010-03-29 | 2010-03-29 | Element for driving gene to be expressed in embryo and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102206637A true CN102206637A (en) | 2011-10-05 |
| CN102206637B CN102206637B (en) | 2014-03-05 |
Family
ID=44695700
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010134090.5A Expired - Fee Related CN102206637B (en) | 2010-03-29 | 2010-03-29 | Element for driving gene to be expressed in embryo and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102206637B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087589A (en) * | 2015-09-21 | 2015-11-25 | 安徽省农业科学院水稻研究所 | Promoter element OsEmb2 as well as method and application thereof in breeding transgenic rice |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6376750B1 (en) * | 2000-05-22 | 2002-04-23 | Academia Sinica | Plant seedling and embryo promoter |
| CN100999736A (en) * | 2006-11-03 | 2007-07-18 | 上海师范大学 | Rice high efficient expression starter and application thereof |
| CN101063136A (en) * | 2007-04-23 | 2007-10-31 | 中国科学院植物研究所 | Plant endosperm specificity promoter and its application |
-
2010
- 2010-03-29 CN CN201010134090.5A patent/CN102206637B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6376750B1 (en) * | 2000-05-22 | 2002-04-23 | Academia Sinica | Plant seedling and embryo promoter |
| CN100999736A (en) * | 2006-11-03 | 2007-07-18 | 上海师范大学 | Rice high efficient expression starter and application thereof |
| CN101063136A (en) * | 2007-04-23 | 2007-10-31 | 中国科学院植物研究所 | Plant endosperm specificity promoter and its application |
Non-Patent Citations (1)
| Title |
|---|
| 《大豆科学》 20100228 赵艳等 大豆种子特异性启动子研究进展 第151-156页 第29卷, 第1期 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087589A (en) * | 2015-09-21 | 2015-11-25 | 安徽省农业科学院水稻研究所 | Promoter element OsEmb2 as well as method and application thereof in breeding transgenic rice |
| CN105087589B (en) * | 2015-09-21 | 2017-11-03 | 安徽省农业科学院水稻研究所 | A kind of promoter element OsEmb2 and the methods and applications that transgenic paddy rice is cultivated using it |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102206637B (en) | 2014-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101838647B (en) | Promoter BgIosP587, and preparation method and application thereof | |
| AU2024202648A1 (en) | Plant regulatory elements and uses therefor | |
| CN102465128B (en) | Anther specific expression promoter and application thereof | |
| CN102206638B (en) | Tissue specific expression promoter as well as obtaining method and application thereof | |
| CN103667296B (en) | A composition type expression promoter and application thereof | |
| CN102206637B (en) | Element for driving gene to be expressed in embryo and application thereof | |
| CN101880664B (en) | Monocotyledon promoter as well as preparation method and application thereof | |
| CN102206636B (en) | Element for driving gene to express in seed and application thereof | |
| CN101864417B (en) | Promoter BgIosP582 and preparation method and application thereof | |
| CN103540595B (en) | Rice constitutive type promoter and application thereof | |
| CN101864418B (en) | Promoter BgIosP513 and preparation method and application thereof | |
| CN103757025B (en) | The promotor of an adverse circumstance abduction delivering and application thereof | |
| CN104073492B (en) | A kind of crop aleurone specific expression promoter PosAL1 and application thereof | |
| CN102115745B (en) | Promoter BgIosP556, and preparation method and application thereof | |
| CN102676457A (en) | Function and application of flower-specific expression promoter KT631P | |
| CN104845973A (en) | Cloning and applications of low-temperature strong inducible promoter POscold6 of rice | |
| CN104946650B (en) | A kind of special strong promoter OsSti1 of rice stigma | |
| CN101955937B (en) | Promoter BgIosP519 and preparation method and application thereof | |
| CN101955936B (en) | Promoter BgIosP586, and preparation method and use thereof | |
| US7750139B2 (en) | Nucleic acids from sesame plants | |
| CN101967482B (en) | Promoter BglosP536 and preparation method and application thereof | |
| US6783978B1 (en) | Isolation and characterization of the genomic DNA clones of ribosomal protein gene L25 in tobacco | |
| CN101955935B (en) | Promoter BgIosP548 and preparation method and application thereof | |
| CN102021168B (en) | Promoter BgIosP566 as well as preparation method and application thereof | |
| CN102206641B (en) | Promoter SbUbi1, its preparation method and use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140305 Termination date: 20190329 |