CN102206618A - Salicornia europaea SeVHA-A protein and encoding gene and application thereof - Google Patents

Abstract

The present invention discloses a Salicornia europaea SeVHA-A protein and an encoding gene and application thereof. The protein is selected from: a) a protein composed of the amino acid sequence shown in SEQ ID NO: 1; or b) a protein, which is associated with the plant adverse resistance and is derived from a) by the substitution and/or deletion and/or addition of the amino acid sequence shown in SEQ ID NO: 1 with one or more amino acid residues. Experiments prove that the gene of the Salicornia europaea SeVHA-A protein provided by the invention has a salt stress resisting function, therefore, the Salicornia europaea SeVHA-A protein provided by the invention has great significance and has broad application prospects in the fields of plant genetics and breeding.

Description

Salicornia europaeal SeVHA-A albumen and encoding gene thereof and application

Technical field

The present invention relates to salicornia europaeal SeVHA-A albumen and encoding gene thereof and application.

Background technology

According to Food and Argriculture OrganizationFAO's statistics in 2008, global solonchak was above 800,000,000 hectares.Inappropriate cultivation step is also in the aggravation soil salinization.Salt stress is the main abiotic stress that plant faces, and it has a strong impact on the growth of plant, and causes the underproduction, and therefore, the salt resistance that improves crop is even more important.

Growth and development of plant be unable to do without matter transportation and energy transformation, and ATPase is playing the part of important role between the two.V-ATPase (V-typeATPase, vacuolar ATPase) topmost function in vegetable cell is to utilize the energy of hydrolysising ATP generation with H ⁺Pump in the vacuole, form when regulating vacuolar pH and stride the membrane electrochemical potential gradient, and then drive the ionic transhipment, as Na ⁺, Ca ²⁺Deng.Ion transport, especially Na ⁺, can regulate cell turgor, keep the osmotic potential of cell, promoted the absorption of material again, in the plant responding salt stress, play an important role.

Studies show that in a large number under the salt stress, the V-ATPase activity can change, but slightly different in halophytes and non-halophytes.Under the salt stress, the V-ATPase increased activity of halophytess such as saltbush, Herba pegani harmalae, ice plant, Suaeda salsa, this has reacted the adaptation of halophytes to salt stress.But not the V-ATPase of halophytes then raises earlier to the reaction of salt stress and afterwards descends, and illustrates that salt stress has produced injury to salt-tolerant plant not.

The protein complexes that V-ATPae is made up of tens kinds of subunits comprises the V that is incorporated in the film _oThe V that part and outstanding film are outer ₁Part.V _oPart is H ⁺Passage is by a, c, c ', c ", d and e subunit form; V ₁Part is made up of A, B, C, D, E, F, G and eight kinds of subunits of H, is the structure of catalysis ATP hydrolysis.Has only V ₀And V ₁Combination correctly just can be formed with the complex body enzymatic structure of function.All found the gene family of the most subunits of coding V-ATPase in many Plant Genome, the kind of subunit and number have the specificity of kind, organ and etap, and the expression of indivedual subunits is relevant with adverse circumstance with assembling.

V-ATPase carries out important function like this in organism, be the indispensable enzymes of most eukaryotes.But therefore yeast (Saccharomyces cerevisiae) exception in the yeast system, identifies subunit and the function relatively easy (Nelson, 2003) of V-ATPase.A subunit catalytic subunit the most is the most conservative subunit, is the single-gene coding in most of plants, as yeast, and Arabidopis thaliana, paddy rice etc.Yeast V-ATPase A subunit is encoded by VMA1 (vacuoler membrane ATPase).The VMA1 sudden change, yeast can not tolerate high pH (7.5), but can grow under low pH environment.Find that in to Arabidopis thaliana V-ATPase functional study the A subunit deletion causes all microgametophytes and part megagametophyte to cause death, the obvious characteristics of mutant microgametophyte is the golgi body paramophia, and microgametophyte is degenerated can not develop into mature pollen.

Salicornia europaeal (Salicornia europaea) is the true halophytes of a kind of carnification that belongs to Chenopodiaceae, extensively is distributed near coastal and the inland brine lake, can accumulate high NaCl to dry weight 50%, is considered in the world a kind of higher plant of salt tolerant.

Summary of the invention

An object of the present invention is to provide a kind of albumen and encoding gene thereof.

Albumen provided by the invention, be following a) or b) protein:

A) protein of forming by the aminoacid sequence shown in the SEQ ID NO:1;

B) with the aminoacid sequence shown in the SEQ ID NO:1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with stress resistance of plant by a) deutero-protein.

Described encoding gene is following 1) or 2) or 3) or 4) shown in:

1) its nucleotide sequence is from dna molecular shown in 5 ' terminal 143-2014 position Nucleotide or the 2-2138 position Nucleotide among the SEQ ID NO:2;

2) its nucleotide sequence is a dna molecular shown in the SEQ ID NO:2;

3) under stringent condition with 1) or 2) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins; Described stringent condition can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS,, and wash film with this solution 65 ℃ of hybridization down.

4) with 1) or 2) dna sequence dna that limits has the homology more than 90% and the dna molecular of encoding said proteins.

Albumen in above-mentioned in order to make (a) is convenient to purifying, can connect label as shown in table 1 at proteinic N-terminal of being made up of the aminoacid sequence shown in the SEQ ID NO:1 or C-terminal.

The sequence of table 1 label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag?II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned (a) but or the albumen synthetic (b), also can synthesize its encoding gene earlier, carry out biology again and express and to obtain.Proteic encoding gene in above-mentioned (b) can be by the codon with one or several amino-acid residue of disappearance in the dna sequence dna shown in the SEQ ID NO:2 in the sequence table, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

The above-mentioned described encoding gene total length that increases or its any segmental primer are to also belonging to protection scope of the present invention.

A primer sequence of described primer centering is shown in SEQ ID NO:3, and another primer sequence of described primer centering is shown in SEQ ID NO:4.

The recombinant vectors, reorganization bacterium, transgenic cell line, recombinant virus or the expression cassette that contain above-mentioned arbitrary described encoding gene also belong to protection scope of the present invention.

Described recombinant vectors is for to insert the recombinant vectors that above-mentioned arbitrary described encoding gene obtains in the multiple clone site of expression vector pBI121.

Above-mentioned arbitrary described albumen, the application of encoding gene in improving plant stress tolerance also belong to protection scope of the present invention.

In the described application, described resistance of reverse is a salt tolerance;

In the described application, described plant is monocotyledons or dicotyledons, is specially Arabidopis thaliana.

Another object of the present invention provides a kind of method of cultivating the transgenic plant of resistance of reverse raising.

The method of the transgenic plant that cultivation resistance of reverse provided by the present invention improves comprises the steps: to import above-mentioned arbitrary described proteic encoding gene in the plant that sets out, and obtains the purpose transgenic plant that resistance of reverse is higher than the described plant that sets out.

In the said process, described proteic encoding gene imports by above-mentioned arbitrary described recombinant vectors.

In the said process, described resistance of reverse is a salt tolerance.

In the said process, described plant is monocotyledons or dicotyledons, is specially Arabidopis thaliana.

The present inventor studies show that to salicornia europaeal over-ground part comparison protein science 200, under the 800mM NaCl condition, salicornia europaeal V-ATPase A subunit expression amount raises 3.8 times and 13.6 times respectively.The present invention has cloned V-ATPase A subunit (SeVHA-A) from the halophytes salicornia europaeal, experiment showed, that gene of the present invention has the salt stress-resistant function, and therefore, the present invention is significant, has broad application prospects in the genetic breeding field of plant.

Description of drawings

Fig. 1 is that salicornia europaeal SeVHA-A gene transcript relative content in time changes under the salt stress.

A: over-ground part; B: underground part (* represents p＜0.01).

Fig. 2 is the transient expression of GFP fusion rotein in the tobacco epidermic cell.

A: empty carrier GFP expression; B:SeVHA-A-GFP expressing fusion protein situation

A, the d:GFP transmitting green fluorescence; B.e:FM4-64 red-emitting fluorescence; C, f: duplicative effect.

Fig. 3 crosses the VHA-A gene transcripts relative content of expressing strain system for part.

Fig. 4 is the influences of different stress conditions to transgenic arabidopsis and wild-type Arabidopis thaliana seed germination.

A: the germination rate of seed in the 1/2MS substratum relatively; B: the germination rate of seed in 1/2MS+150mM NaCl substratum relatively.WT: wild-type Arabidopis thaliana; The 4th strain system of A4:AVHA-A transgenosis;

S3, S4, the 3rd, 4,10 strain systems of S10:SeVHA-A transgenosis.

Fig. 5 is the reaction that transgenic arabidopsis and wild-type Arabidopis thaliana seedling are coerced NaCl.

10 days situation of A:1/2MS substratum growth of seedling; B:150mM NaCl coerces down 10 days situation of growth of seedling; Root under C:1/2MS and the 1/2MS+150mM NaCl stress conditions is long.WT: wild-type Arabidopis thaliana; The 4th strain system of A4:AVHA-A transgenosis; S3, S4, the 3rd, 4,10 strain systems of S10:SeVHA-A transgenosis.*：p＜0.05；**：p＜0.01。

Fig. 6 is under the different pH, the complementary situation of yeast mutants.

Fig. 7 is under the different salt concn, the complementary situation of yeast mutants.

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.

Salicornia europaeal (S.europeae L.) seed is available from the brilliant grand marine industries Development Co., Ltd in Dafeng City, Jiangsu Province.

The salicornia europaeal seed is evenly sowed in vermiculite, treated seed germination, with the pouring of 1/2Hoagland (Hoagland, 1935) nutritive medium.Seedling is cultivated in plant institute of Chinese Academy of Sciences greenhouse, and day temperature maintains 25～30 ℃, and nocturnal temperature is at 18～20 ℃, and relative humidity maintains 60～80%, and illumination condition is 16h illumination/8h dark.

The 1/2Hoagland nutrient solution prescription is as follows:

Embodiment 1, gene and proteic preparation

One, the preparation of gene

1, the clone of salicornia europaeal SeVHA-A gene

The acquisition of (1) 3 ' RACE gene fragment

Utilize the Trizol total RNA of extraction method extraction salicornia europaeal blade in a small amount, utilize the synthetic first chain cDNA of reverse transcription test kit (full formula gold is biological).With primer SeV-1F/3 ' oligdT is carried out pcr amplification, obtain cDNA3 ' terminal fragment.Concrete PCR reaction conditions is as follows: 94 ℃ of 5min; 2 cycles:94 ℃ 30sec, 68 ℃ of 30sec, 72 ℃ of 1min; 2 cycles:94 ℃ 30sec, 66 ℃ 30sec dT=-2 ℃, 72 ℃ of 1min; 25 cycles:94 ℃ 30sec, 54 ℃ of 30sec, 72 ℃ of 1min; 72 ℃ of 10min.

Upstream degenerated primer SeV-1F:5 '-CCTCTA (A/T/G) CTC (G/C/T) ACTGGACAGCG-3 '.Downstream primer is 3 ' oligdT.

The PCR product that obtains is carried out agarose gel electrophoresis, reclaim and the close dna fragmentation of expection stripe size, check order after being connected into cloning vector.

(2) acquisition of intermediate segment

With the salicornia europaeal over-ground part cDNA in the step (1) is template, with primer SeV-1F and SeV-1R is carried out pcr amplification, obtains intermediate segment.

SeV-1F(5’-CCTCTA(A/T/G)CTC(G/C/T)ACTGGACAGCG-3’)。

SeV-1R(5′CACGCTCCACAGCCTGATTG-3’)。

The PCR product that obtains is carried out agarose gel electrophoresis, reclaim and the close dna fragmentation of expection stripe size, check order after being connected into cloning vector.

The acquisition of (3) 5 ' RACE gene fragments

With the salicornia europaeal over-ground part cDNA in the step (1) is template, and use 5 ' RACE anchor primer (UPM) and primer SeVGSP (5 '-TGGCACAGAAACACCACGAGGTATGT-3 '), with warm start

TaqDNA polysaccharase (available from Takara company) is according to Clontech SMART ^TMThe method of RACE cDNAAmplification Kit and step are carried out the amplification of cDNA5 ' end.Concrete PCR reaction conditions is as follows: 94 ℃ of 5min; 5 cycles:94 ℃ 30sec, 68 ℃ of 30sec, 72 ℃ of 2min; 30 cycles:94 ℃ 30sec, 65 ℃ of 30sec, 72 ℃ of 2min; 72 ℃ of 10min.The PCR product that obtains is carried out agarose gel electrophoresis, reclaim and the close dna fragmentation of expection stripe size, check order after being connected into cloning vector.

(4) acquisition of full length cDNA sequence

With DNAMAN software splicing 5 ' and 3 ' RACE and intermediate segment sequence, according to this sequences Design primer SeVF1/SeVR1.

SeVF1：5’-CATGGGGAGATATTTGCGTAGCA-3’；(SEQ?ID?NO：3)

SeVR1：5’-CAAAGCAAGCAAAGGCTGTCTG-3’。(SEQ ID NO:4) (the 2-2138 position Nucleotide coupling among this primer pair and the SEQ ID NO:2)

CDNA is a template with salicornia europaeal children stem, uses primer SeVF1/SeVR1, with HiFi Taq polymeric enzymatic amplification full-length cDNA.The full-length cDNA that obtains is connected into cloning vector, and order-checking is confirmed.The nucleotide sequence of the gene that the result obtains is shown in SEQ ID NO:2, and the proteic aminoacid sequence of this genes encoding is shown in SEQ ID NO:1. and unnamed gene is the SeVHA-A gene, albumen called after SeVHA-A.In the gene, 1-142bp is 5 '-UTR (untranslated region, a non-translational region) shown in the SEQ ID NO:2, and 143-2014 position Nucleotide is the ORF of 1872bp, and 2015-2470 position Nucleotide is 3 '-UTR.

Two, the SeVHA-A gene expression pattern is analyzed and the protein subcellular location

1, gene expression pattern analysis under the salt condition

Salicornia europaeal is sprouted in vermiculite, change the 1/2Hoagland nutritive medium after 4 weeks over to and cultivate, 4 week the back in nutritive medium, add 200 or the NaCl of 800mM, respectively handle 0,6,12,24, during 48h, draw materials (salicornia europaeal over-ground part and underground part) 3 strain composite sampless respectively.Use Trizol reagent to extract total RNA, the total RNA that extracts digests through DNase, after the reverse transcription, (Toyobo Japan) carries out fluorescence quantitative RT-RCR and detects (used instrument is Stratagene Mx3000P) to utilize SYBR Green Realtime PCR Master Mix.With salicornia europaeal actin gene is confidential reference items, by 2 ^{-Δ Δ Ct}Method relative quantification is carried out in genetic expression.Each amplification is provided with 3 repetitions, if 3 reproducible results is all similar then reaction is successful, and then do 3 independently tests respectively, averaging obtains final result.

The primer sequence is as follows in the fluorescence quantitative RT-RCR:

Mark actin primer in the salicornia europaeal:

SeActup1：5′-TGAGAGATTCCGTTGCCCAG-3′

SeActdn1：5′-CCACCACTGAGCACGATGTTAC-3′

Salicornia europaeal SeVHA-A gene primer:

RTVu?4?5′-CTGGTTCGGATGGTCAAAAGA-3′

RTVd?4?5′-GATTGCGGAAAGAAGCACTCA-3′

The qRT-RCR experimental result shows that under salt stress, over-ground part SeVHA-A genetic expression is significantly raised, and 200mM NaCl handles 12h and raises obviously, and 800mM NaCl handles more obvious (Figure 1A); The obvious apparent down regulation trend of underground part SeVHA-A genetic expression (Figure 1B).This shows under salt stress, and the SeVHA-A gene expression pattern of part and underground part on the ground there are differences.

2, the Subcellular Localization of A subunit

The pCAMBIA1300-pHRS1::GFP carrier contains the Hyg selection markers, inserts the SeVHA-A gene and is used for the protein subcellular Position Research.

GFP fusion rotein Subcellular Localization experiment material therefor is this uncured tobacco.

In order to study the Subcellular Localization of A subunit, made up expression vector pCAMBIA1300-pHRS1::SeVHA-A-GFP, infect tobacco by agrobacterium mediation method.GFP albumen excites transmitting green fluorescence down at the 488nm argon laser, and FM4-64 (surface of cell membrane fluorescence dye, 15～30min can be adsorbed onto on the cytolemma) emission red fluorescence.Ruddiness and green glow overlap and manifest yellow fluorescence.Get the tobacco leaf that infects after 5 days, utilize laser scanning co-focusing microscope (Zeiss LSM 510), the 488nm argon laser excites GFP to find the blade of transmitting green fluorescence, and blade is soaked 15～30min in the FM4-64 of 40uM, after twice of the rinsing, microscopy.

Utilize the result of GFP fusion rotein research A subunit Subcellular Localization to show empty carrier pCAMBIA1300-pHRS1::GFP, constitutive expression in cell.Cytolemma, tenuigenin and nucleus send green fluorescence, and the red fluorescence stack of GFP on the cytolemma and FM4-64 emission shows chlorogogue cell's profile (Fig. 2 A) clearly.From SeVHA-A-GFP Expression of Fusion Protein situation, may be positioned cytolemma, in the endomembrane systems such as vacuole skin (Fig. 2 B).

The application of embodiment 2, gene

One, cross expression---transform the wild-type Arabidopis thaliana

1, recombinant expression vector

Plant expression vector pBI121 disclosed in document " Overexpression of Organellar and Cytosolic AtHSP90 in Arabidopsis thaliana Impairs Plant Tolerance to Oxidative Stress.Hongmiao Song; Pengxiang Fan; Yinxin Li.Plant Mol Biol Rep (2009) 27:342-349. ", and the public can obtain from Institute of Botany, Chinese Academy of Sciences.Used plant expression vector pBI121 contains Kana (kantlex) selection markers, inserts SeVHA-A and AtVHA-A gene respectively, is used for the checking of Arabidopis thaliana gene function.

The SeVHA-A gene that embodiment 1 is obtained inserts between the Xba I and Sma I restriction enzyme site of plant expression vector pBI121, and the recombinant expression vector note that obtains is made pBI121-SeVHA-A; Sequence verification, the gene order of result between the Xba of pBI121-SeVHA-A I and Sma I restriction enzyme site shows that the recombinant expression vector of structure is correct shown in 143-2014 position Nucleotide among the SEQ ID NO:2.

2, reorganization Agrobacterium

Agrobacterium C58 bacterial strain disclosed in document " Overexpression of Organellar and Cytosolic AtHSP90in Arabidopsis thaliana Impairs Plant Tolerance to Oxidative Stress.Hongmiao Song; Pengxiang Fan; Yinxin Li.Plant Mol Biol Rep (2009) 27:342-349. ", and the public can obtain from Institute of Botany, Chinese Academy of Sciences.

Utilize the method for heat shock to change recombinant expression vector pBI121-SeVHA-A over to Agrobacterium C58 bacterial strain, obtain positive reorganization Agrobacterium.

3, arabidopsis thaliana transformation

Arabidopis thaliana (Arabidopsis thaliana), the ecotype is Columbia-0.

The normal culture condition of Arabidopis thaliana is that temperature is 22 ℃, and illumination condition is 16h illumination/8h dark.

With the Agrobacterium C58 bacterial strain that carries plant expression vector pBI121-SeVHA-A, utilize agriculture bacillus mediated flower-dipping method to transform the wild-type Arabidopis thaliana to obtain expression strain system.Seed (the T of the Arabidopis thaliana of results ₀Generation) through broadcasting sowing equably respectively behind the surface sterilization on the 1/2MS solid medium that contains 50mg/L Kana, at first placed 2 days down in 4 ℃ the dark place, normally cultivate 7 days after, positive seedling changed over to move to grow to seed maturity in the compost.Select to separate than the T1 that is 3: 1 and isozygoty and be for the numerous transgenosis that obtains of expansion.

4, the genetic expression of transfer-gen plant detects

Utilize fluorescence quantitative RT-RCR to detect the SeVHA-A expression of gene that transgenosis is isozygotied and is.With Arabidopis thaliana Actin gene as confidential reference items, according to SeVHA-A and AtVHA-A conserved regions design primer.

AtAct1：5′-CCCGCTATGTATGTCGCCA-3′

AtAct2：5′-AACCCTCGTAGATTGGCACA-3′

RTF1：5′-CGTTCGTAAGGTTTCAGGTCC-3

RTR1：CGTAAACTTGGATGGTGGCAGA

Change the empty carrier contrast: in the wild-type Arabidopis thaliana, change the Arabidopis thaliana that empty carrier pBI121 obtains over to.

Positive control: with pBI121-AtVHA-A plant overexpression vector arabidopsis thaliana transformation.The construction process of pBI121-AtVHA-A: also identical Xba I of same pBI121-SeVHA-A, restriction enzyme site and Sma I.

The acquisition of Arabidopis thaliana AtVHA-A gene: the AtVHA-A gene C DS full length sequence design primer AtVF that includes according to NCBI (5 '-ATGCCGGCGTTTTACGG-3 ' and AtVR (5 '-TTACCGAGTTTCATCTTCCAAAGC-3 '), be template amplification acquisition Arabidopis thaliana AtVHA-A gene C DS total length with Arabidopis thaliana cDNA.

Chosen the expression of the transgenic line testing goal gene of the transgenic line of 5 AtVHA-A and 8 SeVHA-A at transcriptional level.The qRT-PCR detected result shows that the SeVHA-A of most of transgenic line has significant increase (Fig. 3, *: p＜0.05) at the expression amount of mRNA level.Show that SeVHA-A and AtVHA-A gene have changed Arabidopis thaliana over to, and can stably express.Finally having selected the higher strain of expression amount is AtVHA-A4 (A4 is called for short in the back) and SeVHA-A3,4,10 (S3 is called for short in the back, S4, and S10) 4 strains are the phenotype analytical of doing under the salt stress.

5, the salt resistance of transgenic arabidopsis detects

(1) transgenic arabidopsis in the seed germination phase tolerance to NaCl

Wild-type, 4 mistakes are expressed strain system and change the Arabidopis thaliana seed of empty carrier contrast, behind surface sterilization, respectively sowing and 1/2MS with contain on the 1/2MS substratum of 150mM NaCl.4 ℃ of down dark cultivations 2 days, normal condition was cultivated, and began to add up seed germination rate from second day of normal cultivation.Result such as table 1 and shown in Figure 4.

Table 1, do not add the treatment group seed germination rate (first day not statistics) of NaCl

	0 day	2 days	3 days	4 days	5 days	6 days	7 days	8 days
									WT	0	100	100	100	100	100	100	100
A4	0	100	100	100	100	100	100	100
									S3	0	99.29±0.71	100	100	100	100	100	100
S4	0	99.29±0.71	100	100	100	100	100	100
									S10	0	98.57±0.82	99.29±0.71	100	100	100	100	100

Table 2, add the treatment group seed germination rate of NaCl

The result shows wild-type, changes the germination rate basically identical of seed on the 1/2MS substratum of empty carrier contrast, positive control and transgenic line, and very big difference is arranged in that 150mM NaCl stress conditions is next.On the 1/2MS substratum, the seed germination of wild-type and transgenic line is very fast, at second day just near 100%.Coerce down at NaCl, the seed germination of wild-type and transgenic plant all has been subjected to inhibition.Coerce down at NaCl, transgenic line A4, S3, the germination rate of S4 and S10 are higher than wild-type, A4 wherein, and S3, S4 are not remarkable, and S10 is significantly higher than wild-type, and reaches utmost point conspicuous level (p＜0.01).These results show that SeVHA-A more can improve the salt resistance that Arabidopis thaliana is sprouted period than AtVHA-A.It is consistent with wild-type to change empty carrier control group result.

(2) transgenic arabidopsis of seedling phase is to the tolerance of NaCl

Wild-type, 4 mistakes are expressed the Arabidopis thaliana seed of strain system and the contrast of commentaries on classics empty carrier after growing 3 days on the 1/2MS substratum, the consistent seedling of picking growth forwards 1/2MS respectively to and contains on the 1/2MS substratum of 150mM NaCl and vertically cultivates, vertical culture condition: (culture dish is vertically placed, 60 degree angles tilt, temperature is 22 ℃, and illumination condition is 16h illumination/8h dark).Handle after 10 days, it is long to measure the plant main root.

Arabidopis thaliana is also very responsive to salt stress in the seedling phase, also be to identify the importance of transgenic arabidopsis to saline-alkaline tolerance in the seedling phase to the tolerance of NaCl therefore, and root length is the most direct monitoring index.The result shows: wild-type and the transgenic line seedling upgrowth situation basically identical (Fig. 5 A) on the 1/2MS substratum, and very big difference arranged in that 150mM NaCl stress conditions is next.Under salt stress, wild-type and transgenosis seedling all have been subjected to inhibition (Fig. 5 B).Each strain owner root length statistics is shown, A4, S3, the growing way of S4 and S10 seedling is higher than wild-type; Wherein, A4 reaches conspicuous level (p＜0.05), and S10 reaches utmost point conspicuous level (p＜0.01), illustrates that SeVHA-A more can improve Arabidopis thaliana in the seedling salt resistance in period than AtVHA-A.It is consistent with wild-type to change empty carrier control group result.

Table 3, main root long (centimetre)

	0	150mM?NaCl
			WT	4.43±0.16	1.25±0.06
A4	4.34±0.27	1.54±0.11
			S3	4.51±0.26	1.45±0.08
S4	4.38±0.20	1.49±0.08
			S10	4.33±0.12	1.65±0.10

Two, Arabidopis thaliana function complementation experiment

Krain is breadboard to be studies show that, Arabidopis thaliana AtVHA-A transgenation is to isozygoty lethally, shows as the microgametophyte impaired development, part megagametophyte impaired development.Heterozygous mutant body (VHA-A/vha-A ,+/-) self progeny has only 17.9% to be mutant.This mutant is that AtVHA-A gene T-DNA inserts mutant, has the Kana selection markers.This research changes the SeVHA-A gene over to mutant, and can check SeVHA-A realize having complementary functions.We have made up the pSN1301-SeVHA-A plant overexpression vector, the arabidopsis thaliana transformation mutant.Be blank with empty carrier arabidopsis thaliana transformation mutant simultaneously.

Arabidopis thaliana heterozygous mutant body VHA-A/vha-A disclosed in document " Essential role of the V-ATPase in male gametophyte development.Jan Dettmer; Daniel Schubert; Olga Calvo-Weimar; York-Dieter Stierhof; Renate Schmidt; Karin Schumacher.The Plant Journal (2005) 41,117-124. ", and the public can obtain from Institute of Botany, Chinese Academy of Sciences.Culture temperature is 22 ℃, and illumination condition is 16h illumination/8h dark.

1, plant overexpression vector

The pSN1301-SeVHA-A plant overexpression vector: the SeVHA-A gene that embodiment 1 is obtained inserts between the Xba I and Sac I restriction enzyme site of pSN1301 carrier, obtains the recombinant expression vector note and makes pSN1301-SeVHA-A; Sequence verification, the gene order of result between the Xba of pSN1301-SeVHA-A I and Sac I restriction enzyme site shows that the recombinant expression vector of structure is correct shown in 143-2014 position Nucleotide among the SEQ ID NO:2.

The pSN1301 carrier is at document " Overexpression of phytoene synthase gene from Salicornia europaea alters response to reactive oxygen

2, reorganization Agrobacterium

Utilize the heat shock method to change recombinant expression vector pSN1301-SeVHA-A over to Agrobacterium C58 bacterial strain, obtain positive reorganization Agrobacterium.

3, arabidopsis thaliana transformation mutant

With the Agrobacterium C58 bacterial strain that carries plant expression vector pSN1301-SeVHA-A, utilize agriculture bacillus mediated flower-dipping method to transform heterozygous mutant body (VHA-A/vha-A, +/-), mix the screening transgenic progeny, the transgenic progeny that obtains isozygotying (T3 generation) by Kana and Hyg.

Change the empty carrier contrast: in heterozygous mutant body (VHA-A/vha-A ,+/-), change the Arabidopis thaliana that empty carrier pSN1301 obtains over to.

Because AtVHA-A transgenation, cause the gametophyte impaired development, the transgenic progeny of therefore isozygotying still for the heterozygous mutant body (be genotype be SeVHA-A/SeVHA-A/+/-), the transgenic progeny seed of isozygotying of changeing empty carrier and changeing pSN1301-SeVHA-A is seeded on the 1/2MS substratum that contains 50 μ g/mL Kana screens statistics antibiotics resistance rate.

The result shows: 3 transgenic progeny seed resistance rates of isozygotying of changeing pSN1301-SeVHA-A strain system are respectively 29.7%, 31.3%, 28.2%, and the positive rate that changes the empty carrier offspring is 17.3%, is significantly higher than contrast (table 4).This shows that SeVHA-A makes mutant partly recover the phenotype of wild-type.

That resistance rate of table 4, complementary plant offspring's card relatively

Kana ^R: block that resistance; Kana ^S: block that susceptibility

This experimental results show that the albumen of the genes encoding that this experiment is cloned into is the A subunit that function is arranged, and can be assembled into V-ATPase and go up enforcement catalysis ATP hydrolysis function.

Three, pass through the function of yeast mutants function complementation experiment research SeVHA-A

The acquisition of yeast VMA1p gene: the yeast VMA1 gene C DS full length sequence design primer ScF that includes according to NCBI (5 '-ATGGCTGGTGCAATTGAAAACG-3 ') and ScR (5 '-TTAATCGGTAGATTCAGCAAATCTT-3 '), be template amplification acquisition yeast ScVMA1 gene C DS total length with yeast cDNA.

This experiment used yeast wild type strain is YPH499, and its mutant is RH104, (S.cerevisiae) is its generic name and kind name, and the yeast of experiment usefulness belongs to this big class more.

Yeast YPH499 (being wild-type yeast) is at document " Proton Gradient-Driven Nickel Uptake by Vacuolar Membrane Vesicles of Saccharomyces cerevisiae.KEN NISHIMURA; KAZUEI IGARASHI; YOSHIMI KAKINUMA.JOURNAL OF BACTERIOLOGY; 0021-9193/98/$04.0010.Apr.1998; disclosed p.1962-1964. ", the public can obtain from Institute of Botany, Chinese Academy of Sciences.

Yeast mutants RH104 is at document " Proton Gradient-Driven Nickel Uptake by Vacuolar Membrane Vesicles of Saccharomyces cerevisiae.KEN NISHIMURA; KAZUEI IGARASHI; YOSHIMI KAKINUMA.JOURNAL OF BACTERIOLOGY; 0021-9193/98/$04.0010.Apr.1998; disclosed p.1962-1964. ", the public can obtain from Institute of Botany, Chinese Academy of Sciences.

Yeast expression carrier p416GPD disclosed in document " Expression of five AtHsp90 genes in Saccharomyces cerevisiae reveals functional differences of AtHsp90s under abiotic stresses.Hongmiao Song; Pengxiang Fan; Wuliang Shi; Rongmin Zhao; Yinxin Li.Journal of Plant Physiology 167 (2010) 1172-1178. ", and the public can obtain from Institute of Botany, Chinese Academy of Sciences.

The RH104 bacterial strain is that the VMA1 gene inserts mutant, can not tolerate high pH (7.5), but can grow under low pH environment.Its wild-type yeast bacterial strain YPH499 can be under high pH7.5 normal growth.This experiment utilizes this two yeast strains, verifies the function of SeVHA-A gene by function complementation experiment.We have made up Yeast expression carrier p416GPD-SeVHA-A, and are over against photograph with p416GPD-ScVMA1, and empty carrier is negative contrast, and p416GPD-AtVHA-A is circumstantial evidence transformed yeast mutant RH104, carries out high pH and salt stress resistance assay respectively.Used yeast expression vector p416GPD contains Ura (uridylic) selection markers, inserts SeVHA-A respectively, and AtVHA-A and ScVMA1 gene are used for the yeast mutants complementation test.

The construction process of Yeast expression carrier p416GPD-SeVHA-A: the same pBI121-SeVHA-A of method, restriction enzyme site is also identical, Xba I and Sma I.

The construction process of Yeast expression carrier p416GPD-ScVMA1: the same pBI121-SeVHA-A of method, restriction enzyme site is also identical.

The construction process of Yeast expression carrier p416GPD-AtVHA-A: the same pBI121-SeVHA-A of method, restriction enzyme site is also identical.

The method of transformed yeast:

Yeast competence preparation: the 100 μ L cultures of getting after the activation add in the 100mL liquid nutrient medium, and 28 ℃, 200rpm, jolting is cultured to OD ₆₀₀Value is 0.4～0.6.The centrifugal 10min of 4000rpm, supernatant discarded, collecting precipitation.Use 25mL ddH ₂The resuspended precipitation of O, the centrifugal 10min of 4000rpm abandons supernatant.Lithium Acetate (LiAc) (now with the current) 1mL re-suspended cell with 100mM moves to suspended substance in the aseptic EP pipe of 1.5mL the quick centrifugal 5sec of 8000rmp, sedimentation cell, sucking-off LiAc.LiAc re-suspended cell to final volume with 100mM is 250 μ L, wherein approximately contains the LiAc of 160 μ L.28 ℃ of water-baths are left standstill and are cultivated 30min, thorough mixing, and with its five five equilibrium.Transfer to (every pipe 50 μ L) in the aseptic EP pipe of 1.5mL.The competent cell for preparing can use at once, can preserve 48h for 4 ℃, but changes-70 ℃ of refrigerator long storage in liquid nitrogen after the quick-frozen over to, takes out from-70 ℃ of refrigerators during use, puts to melt the back use on ice.

Yeast conversion:

A. reagent preparation

1) polyoxyethylene glycol (PEG4000,50%, w/v)

It is soluble in water to get 50g PEG4000, is settled to 100mL.Behind the autoclaving, sealing is preserved, and divides evaporation to cause strength of solution to raise to prevent water.

2) 10 * TE damping fluid

100mM Tris-HCl, 10mM EDTA transfers pH=8.0 with HCl.

3)LiAc(1M)

Take by weighing 0.5g LiAc, be dissolved in the 4.8mL water, the suction filtration sterilization is sub-packed in the aseptic EP pipe of 1.5mL in Bechtop.

4) strand carrier DNA (2mg/mL)

With the TE damping fluid preparation of pH8.0, final concentration is 2mg/mL.

B. yeast conversion:

(1) 500 μ L single stranded DNA samples is boiled 5min, place ice to cool off fast.

(2) 50 μ L competence, the centrifugal 30sec of 8000rpm, sedimentation cell is removed LiAc.

(3) in the EP pipe, add following solution in order successively:

Thermal agitation 1min is to the complete mixing of cell.

(4) 30 ℃ of water bath heat preservation 30min.42 ℃ of heat shock 15～20min.The centrifugal 15sec of 8000rpm removes supernatant liquor.

(5), evenly be coated onto on the selection plate culture medium with spreading rod with the resuspended gently precipitation of 100 μ L sterilized waters.Be inverted for 28 ℃ and cultivate, appearance in 2～4 days transforms bacterium colony.

The tolerance experimental technique of high pH: yeast liquid nutrient medium YPD5.5 is cultivated each bacterial strain (YPH499, RH104, RH104+p416, RH104+p416-ScVMA1, RH104+p416-SeVHA-A, and RH104+p416-AtVHA-A.) to OD ₆₀₀About=1.0, the centrifugal 5min of 6000rpm collects thalline, and is resuspended to OD with sterilized water ₆₀₀=1.0, with 100 times of sterilized water dilutions, draw 6 μ L points to different solid mediums with pipettor: YPD7.5, YPD5.5, and SD-Ura5.5 (yeast synthetic medium SD does not contain uridylic), add 10mM MES and 10mM MOPS in all substratum, use the NaOH adjust pH, 30 ℃ of cultivations are inverted and are cultivated;

Salt stress resistance assay method: each bacterial strain put contain 600, on the YPD of 800mM NaCl (pH the is 5.5) substratum.30 ℃ of cultivations are inverted and are cultivated.

Experimental results show that SeVHA-A is the same with the ScVMA1 gene with the AtVHA-A gene, can make mutant RH104 recover the tolerance (Fig. 6) of wild-type high pH.With wild-type, mutant and transgenic yeast are cultivated in the substratum that contains 600mM and 800mM NaCl, discovery is under 800mM NaCl, mutant and commentaries on classics empty carrier mutant yeast growth are suppressed, and the complementary strain system normal growth of the same energy with wild-type yeast, illustrate that SeVHA-A is the same with the ScVMA1 gene with the AtVHA-A gene, can make mutant RH104 recover the salt resistance (Fig. 7) of wild-type yeast.Proved that further the SeVHA-A gene of cloning has the salt tolerant function from salicornia europaeal.

Yeast YPD culture medium preparation

NaOH solution with 1M is transferred pH5.5 or 7.5.

The 1/2MS culture medium preparation

The preparation of substratum mother liquor and preservation

More than in the various mother liquors, the macroelement mother liquor is 20 times of concentrated solutions, micro-mother liquor and mother liquid of iron salt are 200 times of concentrated solutions, the organic composition mother liquor is 100 times of concentrated solutions.When being used to cultivate Arabidopis thaliana, be diluted with water to 1/2MS, add 1% sucrose and 0.488g/L MES, transfer pH=5.8～6.0, add 8% agar powder at last with the NaOH solution of 1M.Autoclaving.

Claims (10)

1. albumen, be following a) or b) protein:

A) protein of forming by the aminoacid sequence shown in the SEQ ID NO:1;

B) with the aminoacid sequence shown in the SEQ ID NO:1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with stress resistance of plant by a) deutero-protein.

2. the described proteic encoding gene of claim 1.

3. encoding gene according to claim 2 is characterized in that: described encoding gene is following 1) or 2) or 3) or 4) shown in:

1) its nucleotide sequence is from dna molecular shown in 5 ' terminal 143-2014 position Nucleotide or the 2-2138 position Nucleotide among the SEQ ID NO:2;

2) its nucleotide sequence is a dna molecular shown in the SEQ ID NO:2;

3) under stringent condition with 1) or 2) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;

4) with 1) or 2) dna sequence dna that limits has the homology more than 90% and the dna molecular of encoding said proteins.

4. amplification claim 2 or 3 described encoding gene total lengths or its any segmental primer are right.

5. primer according to claim 4 is right, it is characterized in that: a primer sequence of described primer centering is shown in SEQ ID NO:3, and another primer sequence of described primer centering is shown in SEQ ID NO:4.

6. the recombinant vectors, reorganization bacterium, transgenic cell line, recombinant virus or the expression cassette that contain claim 2 or 3 described encoding genes.

7. recombinant vectors according to claim 6 is characterized in that: described recombinant vectors inserts the recombinant vectors that the described proteic encoding gene of claim 1 obtains for the multiple clone site at expression vector pBI121.

8. the described albumen of claim 1, claim 2 or the 3 described encoding genes application in improving plant stress tolerance.

9. a method of cultivating the transgenic plant of resistance of reverse raising comprises the steps: to import the described proteic encoding gene of claim 1 in the plant that sets out, and obtains the purpose transgenic plant that resistance of reverse is higher than the described plant that sets out.

10. application according to claim 8 or the described method of claim 9 is characterized in that: the described proteic encoding gene of described claim 1 imports by recombinant vectors described in claim 6 or 7;

Described resistance of reverse is a salt tolerance;

Described plant is monocotyledons or dicotyledons.

Images