CN102191242A - Paris polyphylla microsatellite DNA molecular markers - Google Patents
Paris polyphylla microsatellite DNA molecular markers Download PDFInfo
- Publication number
- CN102191242A CN102191242A CN2011100516581A CN201110051658A CN102191242A CN 102191242 A CN102191242 A CN 102191242A CN 2011100516581 A CN2011100516581 A CN 2011100516581A CN 201110051658 A CN201110051658 A CN 201110051658A CN 102191242 A CN102191242 A CN 102191242A
- Authority
- CN
- China
- Prior art keywords
- cgc
- microsatellite
- paris polyphylla
- ctt
- tcc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses Paris polyphylla microsatellite DNA molecular markers. The preparation method of the molecular markers comprises the following steps: constructing a Paris polyphylla microsatellite (CT)n enriched library, and screening and sequencing microsatellite sequence positive clones to obtain 51 clones with microsatellite repetitive sequences and screen out 12 highly polymorphic microsatellite molecular markers, namely Ps1, Ps2, Ps3, Ps4, Ps5, Ps6, Ps7 and Ps8, Ps9, Ps10, Ps11 and Ps12. The molecular markers are used in the research on the genetic diversity of Paris polyphylla and the variance and evolutionary relationship between different species and populations of Genus Paris plants, have good repeatability, and are reliable and effective molecular markers.
Description
Technical field
The present invention relates to molecular marking technique, be specifically related to a kind of magnificent Paris polyphylla micro-satellite molecule genetic marker.
Background technology
Little satellite (Microsatellite) be called again short polyphone repeat (Short Tandem Repeats, STRs), simple repeated sequence (Simple Sequence Repeat, SSRs), SSLP (SSLP).Be meant that a class is dispersed throughout (being called core sequence, being generally 1～6bps) the simple series connection of forming for repeating unit and repeating by several nucleotide pairs in the biological gene group.Its multiplicity is an alterable height between the different genotype of same species, but this section multiple two ends are conservative relatively single-copy sequences, design primer in view of the above, can analyze the variation of core sequence multiplicity, between different genotype, detect polymorphic by round pcr.According to the formation of repeating unit, the microsatellite DNA sequence is divided into 3 types: single type (pure), compound (compound) and discontinuous form (interrupted).For example:
Single type: ATATATATATATATATATATATAT
Compound: ATATATCACACACACACACAC
Discontinuous form: ATATATCA ATATATCA ATATATA
As a kind of molecule marker, microsatellite DNA has following characteristics: be distributed widely in the Eukaryotic genome, 1 microsatellite locus is just arranged in every according to estimates 6kb length; The multiplicity of core sequence is height variability, polymorphism information capacity height: be codominance, follow the heredity of broad-mouthed receptacle for holding liquid Dare rule between individuality; Select neutrality or the like.
Based on above characteristics, microsatellite DNA is widely used in that structure, the assignment of genes gene mapping, cultivar identification and the germplasm of plant genetic collection of illustrative plates are preserved, the research of analysis, assistant breeding, structure finger printing, genetic diversity and the aspects such as spore and sibship of quantitative character gene.
China's Paris polyphylla has another name called Rhizoma Paridis, and flea stops etc., is Liliaceae Paris per nnial herb.This flavour of a drug hardship, cold nature, slightly poisonous, return Liver Channel.Have effects such as clearing heat and detoxicating, swelling and pain relieving, the arresting convulsion of cool liver, have pharmacological research to show, it also has hemostasis and anti-inflammation, antitumor, antifertility, adjusting immunity and many-sided physiologically active such as cardiovascular.
In recent years, kind of compound surplus isolation identification goes out 50 from this platymiscium one by one mainly contains C
17Steroidal saponin, flavonoid glycoside and polysaccharide etc.Be usually used in that the furunculosis carbuncle is swollen, swelling and pain in the throat, venomous snake bite, traumatic pain, convulsion with spasms etc., be the important source material of taking Chinese patent medicines such as life pellet, total saponins sheet, Yunnan white powder, tranquilizing uterine blood by force.
Though its medicine source is wide, in recent years because a large amount of exploitation natural crude drugs, among the people dig excessively serious, in addition the natural crude drugs cycle long, cause the wild resource exhaustion, this plant now is rare protective plant in imminent danger.Even at present both at home and abroad to the research of paris plant seldom, paris plant is classified this difficult problem so far still for solving.
Summary of the invention
The technical problem that the present invention solves: the microsatellite DNA molecule marker of separating clone China Paris polyphylla, set up magnificent Paris polyphylla microsatellite DNA technical system and carry out magnificent Paris polyphylla genetic diversity with these molecule markers, the research of paris plant genetic affinity, and carry out magnificent Paris polyphylla Idioplasm identification.
The technical scheme of technical solution problem of the present invention: magnificent Paris polyphylla microsatellite DNA molecule marker, comprise the structure of the little satellite of magnificent Paris polyphylla (CT) n enriched library, the screening of microsatellite sequence positive colony and order-checking obtain 51 clones that contain little satellite tumor-necrosis factor glycoproteins.Obtain 12 microsatellite molecular marker Ps1, Ps2, Ps3, Ps4, Ps5, Ps6, Ps7, Ps8, Ps9, Ps10, Ps11, Ps12 that polymorphism is high; Ps1 is 386 Nucleotide, Ps2 is 390 Nucleotide, and Ps3 is 458 Nucleotide, and Ps4 is 496 Nucleotide, Ps5 is 447 Nucleotide, Ps6 is 276 Nucleotide, and Ps7 is 226 Nucleotide, and Ps8 is 495 Nucleotide, Ps9 is 274 Nucleotide, Ps10 is 549 Nucleotide, and Ps11 is 658 Nucleotide, and Ps12 is 409 Nucleotide.
Description of drawings
Fig. 1: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps1 site dyes PAGE figure.
Fig. 2: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps2 site dyes PAGE figure.
Fig. 3: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps3 site dyes PAGE figure.
Fig. 4: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps4 site dyes PAGE figure.
Fig. 5: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps5 site dyes PAGE figure.
Fig. 6: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps6 site dyes PAGE figure.
Fig. 7: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps7 site dyes PAGE figure.
Fig. 8: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps8 site dyes PAGE figure.
Fig. 9: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps9 site dyes PAGE figure.
Figure 10: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps10 site dyes PAGE figure.
Figure 11: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps11 site dyes PAGE figure.
Figure 12: the silver of the DNA of 21 magnificent Paris polyphylla of primer amplified in Ps12 site dyes PAGE figure.
Embodiment
Below in conjunction with embodiment the present invention is done detailed explanation.
Embodiment 1:
The structure of China's Paris polyphylla microsatellite DNA enriched library
1) genomic extraction and enzyme are cut:
The CTAB method of introducing with Doyle J (Doyle J.DNA protocols for plants-CTAB total DNA isolation[A] .In Hewitt GM, Johnston A (eds.), Molecular Techniques in Taxonomy[M] .Berlin:Springer, 1991,283-293) extract genome.Cut genome with restriction enzyme Sau 3AI (purchasing company) enzyme in TaKaRa.Behind 2% the agarose gel electrophoresis, under UV-light, downcut the dna fragmentation of 300bp-900bp.Reclaiming test kit (purchasing the company in Axygen) with glue reclaims.
2) add joint:
The product that glue is reclaimed behind the purifying adds joint:
oligo?A(5’-GGCCAGAGACCCCAAGCTTCG-3’)
oligo?B(5’-PO
4-GATCCGAAGCTTGGGGTCTCTGGCC-3’)，
Under T4 DNA Ligase (purchasing company) effect, spend the night in 16 ℃ of water-baths connections in Fermentas.
3) the PCR detection tabs connects:
With oligo A is primer, is that template is carried out pcr amplification to connect product, and (50 μ l reaction systems are as follows: 25 μ l
Green Master Mix (purchasing company) in Promega, 5 μ l primer oligoA, 5 μ l connect product, add water and mend to 50 μ l.The PCR response procedures: 94 ℃ of pre-sex change 5 minutes, 94 ℃ of sex change 50 seconds, 56 ℃ of annealing one minute, 72 ℃ were extended 2 minutes, sex change, annealing, three step cycle of extension 25 times, last 72 ℃ were fully extended 10 minutes.After agarose gel electrophoresis 2% detected, the PCR product carried out purifying with purification kit (purchasing the company in Axygen).
4) enrichment with magnetic bead:
Dna fragmentation sex change behind the purifying is formed after the strand and the little satellite probe hybridization that contains vitamin H, form " little satellite probe comprises the genomic dna strand of little satellite " complex body.Hybridization solution is added the magnetic bead of having handled well, and room temperature left standstill 30 minutes.Centrifuge tube is placed on the magnetic force frame, inhales and remove supernatant, use 6 * SSC successively, 2 * SSC, 1 * SSC washes twice under 60 ℃, use at last under 0.1 * SSC room temperature and wash once.Add the TE damping fluid, 95 ℃ of sex change are 15 minutes on the PCR instrument, collect supernatant.Repeat twice.
5) PCR enrichment:
With the enrichment with magnetic bead product is template, and oligo A is that primer carries out pcr amplification, and 25 μ l reaction systems are as follows, 12.5 μ l
Green Master Mix (purchasing company) in Promega, 1.5 μ l primer oligo A, the DNA after the 2.5 μ l enrichments adds water and mends to 25 μ l.The PCR response procedures is as follows: 94 ℃ of pre-sex change 3 minutes, and 94 ℃ of sex change 35 seconds, 60 ℃ of annealing property 35 seconds, 72 ℃ were extended 1 minute, sex change, annealing, three step cycle of extension 25 times, last 72 ℃ were fully extended 12 minutes.The PCR product carries out purifying with purification kit (purchasing the company in Axygen) after 2% agarose gel electrophoresis detection.
6) preparation of competent cell:
The single bacterium colony of E.coli DH-5 α is inoculated in the LB substratum that does not contain Amp of 5ml on the picking flat board, and 37 ℃ of shaking culture are spent the night.Get the 1ml nutrient solution in the LB of 50ml liquid nutrient medium, 37 ℃ of shaking culture, 2～4h is to logarithmic phase.Survey 0D (0.2～0.6).The nutrient solution branch is filled to (every pipe 1.5ml bacterium liquid) in the EP pipe, water-bath 10～15min.4 ℃ centrifugal, 4000rpm, 10min (earlier cooling after centrifugal again) abandons supernatant.Abandon three pipe and pipes behind the supernatant, and ice bath 30min (first pipe adds 0.1mol/L, and 1ml is the CaCl2 of precooling in the ice in advance, mixing, sucking-off to the second pipe is so with three pipes and a pipe).Take out the back gradient centrifugation, 4 ℃, 4000rpm, 5～8min.Abandon supernatant.Add 200 μ l precooling glycerine (15%)/CaCl
2(0.1M) mixing ,-80 ℃ of preservations.
7) connect conversion:
The purified product of getting after the PCR enrichment connects into TA cloning vector (pMD19-T Simple Vector) (purchasing the company in TaKaRa), and 16 ℃ of water-baths connect 2-3 hour.Take out frozen pipe, on ice recovery 10min; The connection product of 10 μ l is added in the 200 μ l competent cells mixing, ice bath 30min; 42 ℃ of water-bath heat-shocked 90s; Ice bath 2min adds 600 μ l LB substratum, 37 ℃ of shaking culture 1.5h; Get 70 μ l nutrient solutions, splash on the LB/Amp/X-gal/IPTG flat board and coating even (X-Gal needs lucifuge); 37 ℃ of forwards of flat board are placed cultivation 0.5h, in 37 ℃ of baking ovens, be inverted overnight incubation then.Through the cultivation of 12h, treat that the bacterium colony on the flat board is of moderate size, take out flat board and locus coeruleus is fully manifested in 4 ℃ of placements.With white mono-clonal bacterium colony on the toothpick picking flat board of the bacterium of going out, place 96 deep-well plates (deep-well plates has added the LB/Amp substratum that contains the Amp resistance of 400 μ l in advance).After the single bacterium colony picking of white finishes, with non-setting adhesive orifice plate is built the back in 37 ℃, 225rpm shaking culture 4h.
8) screening of positive colony:
To connect the bacterium liquid that transforms gained is template, utilizes primer oligo A and primer (CT)
12For primer carries out pcr amplification.15 μ l PCR reaction systems comprise: rTaq enzyme 0.375U (available from TaKaRa company), 10 * Buffer, 1.5 μ l, dNTP 0.2 μ M, MgCl
21.5 μ M, and primer 0.4 μ M (ol igo A, (CT)
12), water, template.Response procedures: 94 ℃ of pre-sex change 3 minutes, 94 ℃ of sex change 50 seconds, 56 ℃ of annealing 35 seconds, 72 ℃ were extended 1 minute, sex change, annealing, three step cycle of extension 30 times.Last 72 ℃ were fully extended 12 minutes.1.5% agarose gel electrophoresis detects.
9) positive colony order-checking and design of primers:
Choose the amplification fragment length and contain the bacterium liquid of positive colony, send the order-checking of the biological (Shanghai) Co., Ltd. of living worker, obtain 51 sequences that contain microsatellite DNA altogether at 300-900bp.Utilize software Primer Premier5.0 to design primer according to the sequence at microsatellite DNA two ends.
10) screening has the primer of polymorphism:
Extract the genome of magnificent Paris polyphylla with above-mentioned CTAB method.With primer (table 1) the amplification gene group that designs.Response procedures: 94 ℃ of pre-sex change 4 minutes, 94 ℃ of sex change 45 seconds, corresponding annealing temperature 30 seconds, 72 ℃ were extended 35 seconds, sex change, annealing, three step cycle of extension 35 times.Last 72 ℃ were fully extended 8 minutes.1.5% agarose gel electrophoresis detects.The PCR product detects with the PAGE electrophoresis.Obtain 12 microsatellite markers that polymorphism is arranged altogether.Ps1 is 386 Nucleotide, Ps2 is 390 Nucleotide, and Ps3 is 458 Nucleotide, and Ps4 is 496 Nucleotide, Ps5 is 447 Nucleotide, Ps6 is 276 Nucleotide, and Ps7 is 226 Nucleotide, and Ps8 is 495 Nucleotide, Ps9 is 274 Nucleotide, Ps10 is 549 Nucleotide, and Ps11 is 658 Nucleotide, and Ps12 is 409 Nucleotide.
11) interpretation of result:
Use Cervus3.0 computed in software expectation heterozygosity and observe heterozygosity.Use the value of Genepop3.4 computed in software Hardy-Weinberg and linkage disequilibrium, describe the feature of 12 magnificent Paris polyphylla microsatellite DNA polymorphic sites with this.Can find out by accompanying drawing 1-12, the diversity that the length of 12 microsatellite sequences of the present invention all occurs in 21 magnificent Paris polyphylla for examination, this shows, these 12 microsatellite markers of the present invention can be used to study the genetic diversity of magnificent Paris polyphylla, between the paris plant kind and variation between population and evolutionary relationship, having very high repeatability, is a kind of reliable and effective molecule marker.
Table 1 primer property list:
F represents upstream primer in the table 1, and R represents. downstream primer.
Claims (2)
1. magnificent Paris polyphylla microsatellite DNA molecule marker, it is characterized in that: the label of described microsatellite marker is respectively: Ps1, Ps2, Ps3, Ps4, Ps5, Ps6, Ps7, Ps8, Ps9, Ps10, Ps11, Ps12;
Its nucleotide sequence is respectively:
Ps1：
gatctaggtg?agcctctccc?cacctatatc?tttgcaacaa?cgggggaagg?ggacaagccc 60
tacctcctat?cgccttcctt?ccaatatcat?gtcggtggca?tgcgggccag?gatttggctg 120
caggttagtg?acttcccttt?gctgccgaac?acctatagta?gaggagaggg?gagaagaacc 180
ctcttctctt?tgtttcttcc?tcgacaccaa?tgagcataga?atcgagcttc?atccttgacc 240
tctctctttc?tctctctctc?tctctctctc?tctctctctc?tctctctctc?tctctttctt 300
gtcttgccca?tcgtcgtcgc?cacggaccta?cccgtatgta?gtgatgcgac?atacagattc 360
tatgacccag?cattgaaatc?gacaat 386
Ps2：
gatccgacgg?cccaaagaat?gcgtggttga?cacgcagtag?ctctgagtgg?atataatgtt 60
ttctttcaac?cgccataccg?tttggcttaa?gaatcagccg?cgaagcatca?taacgcaaaa 120
tgcctttccg?taggccggtt?ttcgttgtga?ggtcatcccg?cgaatcgacg?cggagagaca 180
accaatcgac?gctgagagag?agaaggagat?ttagagcaac?ggacagagaa?ctataaagag 240
agatagtggg?agatttaaag?cgagagagag?agagagagag?agagagagag?agagagagat 300
ggagcgttct?agtcttacgg?acaccgagtt?agaagcagca?aagcagctga?tgcagctgag 360
tgagagcagc?cgagactcaa?cggaggagat 390
Ps3：
gatcaacgtg?ctgcctacct?gtcgacgtac?atgtagacca?aggtacccat?aaaattgttt 60
gataatacct?cccctgcatg?gttgacaact?gagaatactc?cgacgggtgt?tgtccatgtc 120
caaaaccccc?gttggaaata?ccatcaacgg?aggggagttg?cacacaccac?aagagagaga 180
gagagagaga?gagagagaga?gagagagaga?gagagagaga?gaggatgaga?tagggagaga 240
agtgtcgaga?atgatgtgag?cttgttgggg?ctcgccgaca?ttggacgatg?aagggagggg 300
aagctcctcc?tttcctctgg?ctatcgctcg?gggaggtcgc?cggaggccta?gcctcatcac 360
tggaaaatag?cagctatacc?tcctgtgtga?gctgctcaga?aaccgaaggg?gttgcgggcc 420
tcctccttgc?gacctattac?tcgaagagga?gaagagat 458
Ps4：
gatctcatag?atcgaggcaa?gatcgagagg?gattggggag?ccatgcgcct?gatctgacga 60
taggtgattg?gatctcgttg?tcccaccttc?gatccagtaa?tgattgctca?gatctagtca 120
gatatcatta?cctgccatcc?agatccgtgc?tcgggtgagc?gaatcagcga?tcgacaccat 180
cgtccagtgc?tccctccttc?cagatctgac?gatcgaaggc?agtttcctcc?ccccttctcc 240
tcctcccccc?ctccctttcg?tacatctatt?ctctctctct?ctctctctct?ctctctctct 300
ctctctctct?ctatctatct?atctatctat?ctatctttct?ctctctctat?ctctccctct 360
ctctctcttg?ctcgtctcgt?atactgaaat?ccgacaagcg?actgaatctc?tgctccaatt 420
acaccaccgc?cgatcgaatc?tcctcgatcc?cgtaccttgg?tagcagcagt?gattagtttt 480
tttttccctt?tcccgt 496
Ps5：
gatcatctag?gccaccacca?atctgctatg?tgtggggtgg?agaagtaatc?gagtgtcgga 60
gtcggagtcc?gagtgcagga?gcgtggggtg?gagaagtgac?cgatggttta?actctccttt 120
gcgcttcttc?tcctctcaat?ctcatctctt?gcgctccacc?tccctcgcct?ctccccctag 180
tgtcgtcctc?tcatctaccg?ccaatgatag?cgtcgagcaa?gtcttcgatc?gtcgtcccct 240
accgcgagac?ctctgcctcg?tcgttcaccc?taacctcccc?tacagagaag?aacgagcaga 300
gtctctgtgt?gtgtgtgtgt?gtgtgtgtgt?gtgtgtgaga?gagagagaga?gagagagaga 360
gagagagaga?gagagagaga?gagagagaga?gagagaggga?accattgttg?ttgcggggat 420
tggacaaacc?acacacctta?tgctacc 447
Ps6：
atcacaaaac?caagcgcgat?taggacaggg?attcaccttg?ttgaggattt?gctcttgtaa 60
gagagagaaa?agagataaat?ctttagcatt?tcatcaagca?tgttaaatgc?aaattttcaa 120
atctgatcta?agtttgaagc?tacagtacaa?ttttcaaatc?tgtggttcta?acaatttcca 180
tacacgaggc?atagagagag?agagagagag?agagagagag?agaggcaaac?cagagctcta 240
gaggcccgtg?gagccgcagc?aaagtagatg?aagttt 276
Ps7：
atcaagcaac?acttgctaat?ttgcaggtat?tcatcgcttc?taaggagaaa?gcttggcctc 60
cccgttcgaa?ctcctagtgc?tctctctctc?tctctctttc?tctctctctc?tctctctctc 120
tcacacatac?acacacgcgt?gcgcaaatgt?ttgtgttgtt?gatgcaaatg?gtctcctctc 180
cgtccgtcag?tctccacata?gtccatcggt?cacacggcct?ccacgt 226
Ps8：
gatcacttcc?ttggttcgcg?gtatagatta?ggctagcaca?taactgcaac?gagcatcact 60
aggtaaaaaa?gctaaaaagt?tacaataaaa?tgctacacca?aatgatagtt?tcaccgtcat 120
ttagttggtg?cgagaatatt?aacgaccaat?aaccgtcaat?ttctagcaaa?actaattttc 180
ccagctgatc?ctaatttgct?gctctctctc?tctctctctc?tctctctcta?acgctctctc 240
tttccctccc?tctagcactc?tgctaggttt?cctagtcttc?atatctgtgg?ctctctctct 300
ctctctctct?ctctctctct?ctctctccct?ccctccctct?agcgctctgc?tagggttcca 360
aggcgttcac?atctgtggtc?gctctctctc?tccttctagc?actctgctag?ggtcctagtg 420
ttcacatctg?tggttgccca?ttgtctatct?ttgaggttct?tcctcttcca?cacgctgttg 480
gcgaccacaa?cctct 495
Ps9：
aatccagtcg?aaaaacctta?gcaaaaatta?cccttcgtgt?gagaaaacaa?catgaaagag 60
agagaaatag?cggagagaga?gagagagaga?gagagagagg?gagagagaga?gagagaaata 120
atgaggagag?aatgagagat?aaacttaaat?agaggatggg?cgtcaagata?gacgtaccat 180
ccatccgtct?atgcgtctgt?catactggga?tgttaaaata?ataaaagaga?tggacgccag 240
gataggtgca?ctatccgtcc?gtccatgcat?ctgt 274
Ps10：
gatccccgta?ccctcttcct?cctcccctta?atgttcgtgt?agtcacaaat?ccgtcgaccc 60
catgtccttc?cttcgacgat?gagttcacga?cgctggcgag?gccctcgtca?ccgccactct 120
ttctctctct?ctctctctct?ctctctctct?ctctctctct?ctcattctat?ctcttgctac 180
gacggtcgat?gccgatgcca?tccctcgagt?tttgacatgt?acaatattac?gacacgtagg 240
atccatggac?tcgacctcct?cgtccttggt?gagcgaaaca?ccgaagagtg?atgggtcggg 300
cctagcaacg?ccccagcgag?aggaggagtc?cctcgcccgc?ggtggtaccc?tcgatcattc 360
gcccttccgg?cgaggctgtg?cccgcggtgt?ctgctctgac?gagcgatggt?ctgcggcccc 420
gtaccttctc?gtactgcagg?caactggtgg?agttcgaccg?tgccgagtac?gaaacccatg 480
gtcattggcg?agtttttgac?atagacagga?ggtcaatgta?actaccatct?ctcgctacct 540
ctcttgtgt 549
Ps11：
gatcgaacag?agcctgatcg?gtattgtcgg?ctaagactct?ttggttgcca?aggcctagat 60
gagaaaagcc?tggatggcca?gagcttggat?gacctatcaa?agcctagtta?ggttgaagaa 120
gagagagaaa?gaaaaagaga?gagggagaga?gagagagaga?gagagagaga?gagagagaga 180
gagataaaga?aggaaagggc?gtggtctatg?tatggaagat?gtgaaccaag?tttgcacctc 240
ctgtacatag?tcctcattgt?cttaattact?ctcaaatctc?ttcgggcctt?ctcccatacg 300
tggctttgtc?gctcgagcac?atttccataa?actttcaaaa?ggtgggaccc?gcatgggact 360
tgagtgggcc?ccatacttaa?aactttgtac?ccacgttata?ctaccctggg?gagagttaac 420
tgatcatacc?tggtaaaacc?ttggaatgcc?agtgtccctg?ttctggctcg?tgttagcccc 480
accattagct?tacatgtttt?gtgagctgaa?aactacacca?ttttccaagg?agtcactgaa 540
ccctatcggt?aataccccag?gcttagtggt?attaccgacg?ttgactccta?aagcgatagg 600
tccctctcgg?gctcaccacg?ggccagcgag?gcccacccct?agttatctgg?tcgtcttt 658
Ps12：
gatcatcggc?gtaacaccgt?ccgtcgacgc?ccgccctcgg?ctggcatgga?gcccaccctt 60
gacgttgcac?cgttcgtcaa?cgtgcgtgct?tgagctcatc?attgctgacc?tcatctctct 120
ctctctcgat?gccttgtcgt?cgtcaccggc?cacacaacga?gagagagaga?gagagagaga 180
gagagagaga?gagagagaga?gagagagagt?cgggtgtcaa?gcggtgttgc?cggatgccag 240
ggtcggagcg?gtacacggat?gatgctaccg?aataccgggg?ttgaagcgat?gtaccggcat 300
ggtgccgaaa?agtcgccggt?cgaagaggtc?tgctgaccaa?actaaacttc?acacgtggtt 360
tttgaatttt?aaacacccca?tgtaaactca?actccacgac?ggaaacgtg 409。
2. a kind of magnificent Paris polyphylla microsatellite DNA molecule marker according to claim 1 is characterized in that:
The primer sequence in described Ps1, Ps2, Ps3, Ps4, Ps5, Ps6, Ps7, Ps8, Ps9, Ps10, Ps11,12 sites of Ps12 is:
Ps1-F?TAT?CGC?CTT?CCT?TCC?AAT
Ps1-R?GAA?TCT?GTA?TGT?CGC?ATC?ACT
Ps2-F?TTC?TTT?CAA?CCG?CCA?TAC?CGT
Ps2-R?TGC?TTT?GCT?GCT?TCT?AAC?TCG
Ps3-F?AAT?ACT?CCG?ACG?GGT?GTT?G
Ps3-R?AGC?GAT?AGC?CAG?AGG?AAA?GG
Ps4-F?ATC?TCG?TTG?TCC?CAC?CTT?C
Ps4-R?GTC?GCT?TGT?CGG?ATT?TCA?G
Ps5-F?TCC?ACC?TCC?CTC?GCC?TCT
Ps5-R?CGC?AAC?AAC?AAT?GGT?TCC?CT
Ps6-F?CGC?CAT?TAG?GAC?AGG?GAT?TCA?C
Ps6-R?TCT?ACT?TTG?CTG?CGG?CTC?CAC
Ps7-F?GCA?GGT?ATT?CAT?CGC?TTC?T
Ps7-R?CGA?TGG?ACT?ATG?TGG?AGA?CT
Ps8-F?ACC?GTC?ATT?TAG?TTG?GTG?CGA?G
Ps8-R?TGT?GAA?CGC?CTT?GGA?ACC?CT
Ps9-F?GTG?AGA?AAA?CAA?CAT?GAA?AGA
Ps9-R?ACA?TCC?CAG?TAT?GAC?AGA?CG
Ps10-F?GAC?GAT?GAG?TTC?ACG?ACG?CTG
Ps10-R?GTG?TTT?CGC?TCA?CCA?AGG?ACG
Ps11-F?AGC?CTG?ATC?GGT?ATT?GTC?GG
Ps11-R?CCA?CGC?CCT?TTC?CTT?CTT?TA
Ps12-F?ATG?GAG?CCC?ACC?CTT?GAC?GT
Ps12-R?AAC?ACC?GCT?TGA?CAC?CCG?AC。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110051658 CN102191242B (en) | 2011-03-04 | 2011-03-04 | Paris polyphylla microsatellite DNA molecular markers |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110051658 CN102191242B (en) | 2011-03-04 | 2011-03-04 | Paris polyphylla microsatellite DNA molecular markers |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102191242A true CN102191242A (en) | 2011-09-21 |
| CN102191242B CN102191242B (en) | 2013-06-05 |
Family
ID=44600114
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110051658 Active CN102191242B (en) | 2011-03-04 | 2011-03-04 | Paris polyphylla microsatellite DNA molecular markers |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102191242B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105483282A (en) * | 2016-03-02 | 2016-04-13 | 云南省农业科学院药用植物研究所 | PCR specificity identifying primers and paris polyphylla identifying method adopting same |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101654707A (en) * | 2009-09-21 | 2010-02-24 | 安徽师范大学 | Polygonatum cyrtonema microsatellite markers |
| CN101880659A (en) * | 2010-04-22 | 2010-11-10 | 浙江师范大学 | Microsatellite molecular marker of mauremys mutica and application thereof |
| CN201880659U (en) * | 2010-12-17 | 2011-06-29 | 东莞光润家具股份有限公司 | Special edge UV (ultraviolet) paint roller-coating unit |
-
2011
- 2011-03-04 CN CN 201110051658 patent/CN102191242B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101654707A (en) * | 2009-09-21 | 2010-02-24 | 安徽师范大学 | Polygonatum cyrtonema microsatellite markers |
| CN101880659A (en) * | 2010-04-22 | 2010-11-10 | 浙江师范大学 | Microsatellite molecular marker of mauremys mutica and application thereof |
| CN201880659U (en) * | 2010-12-17 | 2011-06-29 | 东莞光润家具股份有限公司 | Special edge UV (ultraviolet) paint roller-coating unit |
Non-Patent Citations (2)
| Title |
|---|
| JUN HE ET AL: "Genetic Diversity of Paris polyphylla var. yunnanensis, a Traditional Chinese Medicinal Herb, Detected by ISSR Markers", 《PLANTA MEDICA》 * |
| 张瑞 等: "重楼属植物AFLP实验体系的建立", 《四川大学学报(自然科学版)》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105483282A (en) * | 2016-03-02 | 2016-04-13 | 云南省农业科学院药用植物研究所 | PCR specificity identifying primers and paris polyphylla identifying method adopting same |
| CN105483282B (en) * | 2016-03-02 | 2019-03-29 | 云南省农业科学院药用植物研究所 | One group of PCR specificity diagnostic primers and its method for identifying paris polyphylla |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102191242B (en) | 2013-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | Sequencing and analysis of Strobilanthes cusia (Nees) Kuntze chloroplast genome revealed the rare simultaneous contraction and expansion of the inverted repeat region in angiosperm | |
| CN101988063B (en) | Microsatellite molecular marker of lycoris | |
| CN102649955A (en) | Dendrobium huoshanense microsatellite deoxyribonucleic acid (DNA) molecular marker | |
| CN102134586A (en) | High-efficiency screening method for microsatellite marker of Marbled Sand Goby and application of same | |
| Labonne et al. | Positional cloning of the s haplotype determining the floral and incompatibility phenotype of the long-styled morph of distylous Turnera subulata | |
| CN101654707B (en) | Polygonatum cyrtonema microsatellite markers | |
| CN104846081B (en) | Collard red autumnal leaves gene Re SSR marker and application | |
| Yun et al. | Next-generation sequencing identification and characterization of microsatellite markers in Aconitum austrokoreense Koidz., an endemic and endangered medicinal plant of Korea | |
| CN102191242B (en) | Paris polyphylla microsatellite DNA molecular markers | |
| CN102599047A (en) | Method by adopting molecular marker-assisted backcross to improve gibberellic disease expansion resistance of wheat | |
| CN103695418A (en) | Maize phosphate starvation responses intron length polymorphism marker for corn | |
| CN102703444B (en) | Radix polygonati officinalis microsatellite DNA (deoxyribonucleic acid) molecular marker | |
| CN102168084A (en) | Dendrohuoshanense microsatellite deoxyribonucleic acid (DNA) molecule mark | |
| CN101275167B (en) | Screening method for hydroxyl carthamin yellow A-containing safflower | |
| CN102465178A (en) | C0t-1DNA, its preparation method and application | |
| KR101432281B1 (en) | SSR markers and Genetic linkage map using Intraspecific population of Capsicum annuum | |
| CN109457023B (en) | Gene combination for identifying sex of gleditsia sinensis, SSR primer combination, identification method and application | |
| CN103397087B (en) | The probe that transgene component MLPA detects and prepare the primer of its long probe | |
| KR20100091016A (en) | Dna marker to genic male sterile in tomato and use thereof | |
| CN110551830A (en) | Human Y-STR locus fluorescence labeling kit and detection method | |
| CN109468407A (en) | The SSR molecular marker of Stauntonia latifolia and its application and preparation method | |
| KR101427103B1 (en) | Specific SSR primers for discriminating waxy corn cultivar 'Arichal', and uses thereof | |
| KR101432283B1 (en) | SSR markers and Genetic linkage map using Intraspecific population of Capsicum annuum | |
| KR101432290B1 (en) | SSR markers and Genetic linkage map using Intraspecific population of Capsicum annuum | |
| KR101432287B1 (en) | SSR markers and Genetic linkage map using Intraspecific population of Capsicum annuum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20201201 Address after: 214500 No. 1 Weiliu Road, Yupo North Road, Jingjiang City North Park, Taizhou City, Jiangsu Province Patentee after: JIANGSU GONGHUAN CHEMICAL EQUIPMENT Co.,Ltd. Address before: 241000 Wuhu Road, Yijiang District, Anhui, Patentee before: ANHUI NORMAL University |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220517 Address after: 214500 No. 28, Yingbin East Road, Jingjiang City, Taizhou City, Jiangsu Province Patentee after: Jiangsu Huarong Investment Development Co.,Ltd. Address before: 214500 No. 1 Weiliu Road, Yupo North Road, Jingjiang City North Park, Taizhou City, Jiangsu Province Patentee before: JIANGSU GONGHUAN CHEMICAL EQUIPMENT Co.,Ltd. |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230327 Address after: 214500 No. 28, Yingbin East Road, Jingjiang City, Taizhou City, Jiangsu Province Patentee after: Jingjiang City Chengzhong Village Investment and Construction Co.,Ltd. Address before: 214500 No. 28, Yingbin East Road, Jingjiang City, Taizhou City, Jiangsu Province Patentee before: Jiangsu Huarong Investment Development Co.,Ltd. |
|
| TR01 | Transfer of patent right |