CN102168085A

CN102168085A - SiRNA for inhibiting expression of miR-130b gene and expression vector and application of siRNA or/and expression vector to preparation of medicament for improving treatment effect of liver cancer

Info

Publication number: CN102168085A
Application number: CN2011100339197A
Authority: CN
Inventors: 关新元; 马桂宜; 陈国华; 邓君豪; 李锦华; 李焱
Original assignee: TUMOR PREVENTION AND THERAPY CENTER ZHONGSHAN UNIV
Current assignee: TUMOR PREVENTION AND THERAPY CENTER ZHONGSHAN UNIV; Sun Yat Sen University Cancer Center
Priority date: 2011-01-31
Filing date: 2011-01-31
Publication date: 2011-08-31

Abstract

The invention provides siRNA for specifically inhibiting the expression of a miR-130b gene. A sequence of the miR-130b gene is shown in SEQ ID NO: 1, and a sequence of the siRNA is shown in SEQ ID NO: 2. The invention also provides an expression vector specifically for the miR-130b gene, wherein the vector contains the siRNA shown in the sequence. The siRNA or/and the expression vector can be applied to the preparation of a medicament for improving the treatment effect of liver cancer. In the medicament, a medicament which performs targeted inhibition on the miR-130b gene is taken as an effective ingredient. The self-renewal capacity of liver cancer stem cells (CSC) is blocked through the siRNA for specifically inhibiting the expression of the miR-130b gene and the expression vector on which a miR-130b antisense strand nucleotide is loaded as well as the function that the siRNA and the expression vector are specifically combined with miR-130b to block the miR-130b, so that the sensitivity of the liver CSC to chemotherapy medicaments is improved.

Description

Suppress siRNA and the expression vector and the application in the medicine of preparation raising liver cancer treatment effect thereof of miR-130b genetic expression

Technical field

The present invention relates to suppress siRNA and the expression vector and the application in the medicine of preparation raising liver cancer treatment effect thereof of miR-130b genetic expression.

Background technology

Contriver's experimental study has in earlier stage proved that film surface protein CD133 can be used as liver cancer tumor stem cell (cancer stem cell, CSC) molecular marked compound, be used for sorting liver cancer CSC (Ma et al., Gastroenterology 132:2542-2556,2007).Recently, compared the express spectra of the CD133 positive and negative HCC iuntercellular micro-RNA, found that miR-130b is the micro-RNA of differential expression maximum.The expression and the liver cancer CSC that further discover miR-130b are proportionate, miR-130b can be by suppressing the self ability of TP53INP1 proteic expression increasing cell, and the self ability is one of sign of tumor stem cell (Ma et al., Cell Stem Cell 7:694-707,2010).CSC is one of focus of present tumor research, because CSC has the resistance stronger to chemotherapeutics than other tumour cell (Ma et al., Oncogene 27:1749-1758,2008).

Summary of the invention

The invention provides the siRNA that a specific specificity suppresses miR-130b genetic expression, wherein, the sequence of described miR-130b is shown in SEQ ID NO:1, and is specific as follows: cagugcaaugaugaaagggcau.

The sequence of described siRNA is shown in SEQ ID NO:2, and is specific as follows: atgccctttcatcattgcactg, site of action are complementary calmodulin binding domain CaMs.

The present invention also provides a specific specificity at the miR-130b expression carrier, and described expression vector contains the siRNA of above-mentioned sequence.

The siRNA of above-mentioned sequence is or/and above-mentioned expression vector can be applicable to preparation improves in the medicine of liver cancer treatment effect.This medicine is an effective constituent with the medicine that target suppresses the miR-130b gene.

The present invention suppresses the siRNA of miR-130b genetic expression by the design specificity and is loaded with the expression vector of miR-130b antisense strand Nucleotide, combine the function of blocking miR-130b by it with the miR-130b specificity, and then the self ability of blocking-up liver cancer CSC, improve its susceptibility to chemotherapeutics.

The invention will be further described below in conjunction with drawings and Examples.

Description of drawings

Fig. 1 is the expression of cell-surface antigens mark (CD133) in heteroplastic hepatocellular carcinoma (HCC) the clinical samples a series of experimental result pictures relevant with poor prognosis with high neoplasm staging;

Figure 1A decomposes the individual cells that obtains or its accordingly at wax embedding formaldehyde fixed tissue slice from NT tissue or HCC tissue sample, to its advance the figure as a result of the fluidic cell after the CD133 dyeing;

Figure 1B decomposes the individual cells that obtains or its accordingly at wax embedding formaldehyde fixed tissue slice from NT tissue or HCC tissue sample, to its advance the figure as a result of the immunohistochemical methods after the CD133 dyeing;

Fig. 1 C is the high expression level analysis chart relevant with high relapse rate of CD133;

Fig. 1 D is the high expression level and low complete survival rate correlation analysis figure of CD133;

Fig. 2 is the CD133 that is separated to from HCC patient's clinical samples ⁺The figure as a result of the one-tenth knurl of cell and a series of related experiment of stem-like cell characteristic;

Fig. 2 A is CD133 in the HCC clinical samples ⁺The fluidic cell point diagram of cell;

Fig. 2 B is tumour xenogenesis planting experiment figure as a result;

Fig. 2 C is CD133 ⁺TICs and CD133 ^-The continuous first-generation of cell and s-generation vitro culture be figure as a result;

Fig. 2 D is CD133 ⁺Cell is cultivated the spherical tumour of not broken up and breaking up in different nutrient solutions, the streaming histogram analysis that respectively the tumour separated and dissolved is obtained individual cells is figure as a result;

Fig. 2 E is the CD133 to not breaking up and breaking up ⁺The experimental result picture that qPCR analyzes is carried out in the stem cell genes involved of cell and the expression of multidrug resistant transporter gene;

Fig. 2 F is the CD133 that is separated to from the tumor specimen of fresh excision ⁺TICs and CD133 ^-The qPCR analytical results figure of cell;

Fig. 3 is the CD133 that is separated to from the HCC clinical samples of fresh excision and undifferentiated spherical tumour ⁺Among the TICs, the figure as a result of a series of related experiment of miR-130b high level expression;

Fig. 3 A is the analysis chart of HCC sample (left side, blue shading are analyzed number of tumors n=5) and HCC clone PLC8024 and Huh7 (right side, light brown shade) miRNA;

Fig. 3 B is the analysis chart to the expression (red lines) of the expression of the CD133 of one group of hepatic cell line (blue lines) and miR-130b;

Fig. 3 C is in 15 routine HCC clinical samples, with CD133 ^-Cell is compared, CD133 ⁺Scatter plot figure after the qPCR that the expression of miR-130b raises among the TICs detects;

Fig. 3 D is to not breaking up spherical tumour (" sphere ") and adherent the liver cancer cell (" diff of differentiation ") in the figure as a result of qPCR of expression of miR-130b;

HCC clone PLC8024 forms not differentiation (" sphere respectively under the different culture environment of Fig. 3 E ") and differentiation (" diff ") tumour, after chemotherapeutic cis-platinum (1.6 μ g/ml) and Dx (0.25 μ g/ml) processing, detect the analysis chart of the expression of its miR-130b;

Fig. 4 is that miR-130b is regulating CD133 ⁺The figure as a result of a series of related experiment of effect in TICs self, growing multiplication, one-tenth knurl and the resistance;

Fig. 4 A is transfected into CD133 negative cells (CD133 with miR-130b expression vector or empty carrier ^-MiR-130b and CD133 ^-EV) after, cell proliferation test is figure as a result;

Fig. 4 B is that qPCR detected its stem cell related gene expression figure as a result after miR-130b expression vector or empty carrier were transfected into the CD133 negative cells;

Fig. 4 C is CD133 after concentration is the Dx processing of 0 μ g/ml (contrast) and 2 μ g/ml ⁺Cell and CD133 ^-MiR-130b, CD133 ^-The per-cent experimental result picture of the last active cells of EV;

Fig. 4 D is CD133 ^-MiR-130b and CD133 ^-EV compares, the external experimental result picture that can form the spherical tumour of greater amt;

Fig. 4 E utilizes the Xenogen system to CD133 ^-The experimental result picture that the formed primary tumo(u)r of miR-130b is carried out the GFP video picture;

Fig. 4 F be (left side and in) in xenogenesis plantation continuous passage test, take out the s-generation and the intravital plantation tumour of third generation mouse and also be used for the vitro culture tumour and form test-results figure;

Fig. 4 G is that the qPCR analysis of cells is CD133 among Huh7 and the PLC8024 ^-Cell (CD133 ^-EV and CD133 ^-MiR-130b) and CD133 ⁺The experimental result picture of the expression of cell (ZIP CTRL and ZIP miR-130b) CD133;

Fig. 5 is that TP53INP1 is a series of related experiment figure as a result of the direct target spot of miR-130b;

Fig. 5 A is the Venn sketch, and show: what PicTar (red), TargetScan (indigo plant) and mRNA expression pattern analysis (green) were predicted may be the candidate mRNA of miR-130b target spot;

Fig. 5 B is mouse (mmu: house mouse), rat (rno: Rattus norvegicus), monkey (mml: rhesus monkey), European ox) and people (has: the possible binding site of miR-130b of two predictions of the miR-130b homo sapiens) and TP53INP13 ' non-coding region (TP53INP13 ' UTR): nt3927-3953 and nt5525-5562 cow (btau:;

Fig. 5 C is the fluorescence activity analytical results figure that miR-130b and TP53INP1 express in HCC clinical samples and the clone;

Fig. 5 D is the analytical results figure to the expression of the expression of CD133 of one group of hepatic cell line (blue line) and miR-130b (red line) and TP53INP1 (green line);

Fig. 5 E is in same HCC clone, detects the experimental result picture of the expression of CD133 and TP53INP1 by immunoblotting;

Fig. 5 F is in 15 routine HCC clinical samples, CD133 ⁺TICs and its CD133 ^-Control cells is compared, the scatter diagram of the qPCR experimental analysis of the expression of TP53INP1;

Fig. 5 G utilizes that linear regression is relevant with Pearson describes CD133 in the 15 routine HCC clinical samples ⁺Cell and CD133 ^-The figure that miR-130b and TP53INP1 express in the cell;

Fig. 5 H is CD133 in the HCC of the fresh excision of immunoblotting assay and the HCC clone ⁺Cell and CD133 ^-The expression of cell TP53INP1 is figure as a result;

Fig. 5 I is that qPCR analyzes CD133 in the HCC of fresh excision and the HCC clone ⁺Cell and CD133 ^-The expression of cell TP53INP1 is figure as a result;

Fig. 5 J is that qPCR detects CD133 ^-Cell (CD133 ^-EV and CD133 ^-MiR-130b) and CD133 ⁺The expression of cell (ZIP CTRL and ZIP miR-130b) TP53INP1 is figure as a result;

Fig. 5 K is that immunoblotting detects CD133 ^-Cell (CD133 ^-EV and CD133 ^-MiR-130b) and CD133 ⁺The expression of cell (ZIP CTRL and ZIP miR-130b) TP53INP1 is figure as a result;

Fig. 6 is that TP53INP1 regulates CD133 ⁺The tumour formation of TICs and a series of related experiment of self ability are figure as a result;

Fig. 6 A is the immunoblotting test experience figure as a result of the expression of TP53INP1 in the neighbour NT tissue of 17 routine HCC samples and paired thereof;

Fig. 6 B is the representative figure as a result of the expression of TP53INP1 in the organization chip;

Fig. 6 C is that shRNA disturbs PLC8024CD 133 ^-The expression of cell TP53INP1 has also formed a series of clones, and immunoblotting detects

clone

464 and 4095 and the contrast PLC8024CD133 that do not deal with ^-The expression of cell (NTC) and TP53INP1 is figure as a result;

Fig. 6 D is the situation figure as a result of the immunoblotting growing multiplication ability that detects

clone

464 and 4095;

Fig. 6 E is that

trace detects clone

464,4095 at the situation of body profile glomeration tumour figure as a result;

To be

clone

464,4095 and contrast NTC cell go into the right back arm of mouse, the tumour that forms (black arrow is a Subcutaneous tumor, the number n of every group of mouse=6) through subcutaneous injection to Fig. 6 F in SCID/Beige mouse body.

Fig. 6 G is that the tumour that forms in the mouse body is carried out H﹠amp; E dyeing, histological inspection is figure as a result;

Fig. 6 H measured a gross tumor volume, continuous 15 weeks every 10 days behind the cell inoculation.

Fig. 6 I is that

clone

464 and 4095 can form the plantation tumour in s-generation mouse body

Fig. 6 J the has been transfection CD133 of TP53INP1 ⁺The formation of the outer spherical tumour of cell energy inchoate aspect and the experimental result picture of continuous passage;

Fig. 6 K is the experimental result picture of aforementioned cell in immunodeficient mouse one-tenth knurl ability on one's body, the tumour that the black arrow representative is bigger, and the less tumour of white arrow representative.

Embodiment

For making the present invention easier to understand,, further set forth the present invention below in conjunction with specific embodiment.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.

It should be noted that, below in the experiment used experimental technique except the working method of routine, the visible following concrete grammar of experimental implementation method of several classes experiment:

1. clinical biological tissue sample

Under the codes of ethics of human experimentation codes of ethics council regulation instruct, we from the hepatocarcinoma patient of 83 routine excisions obtain on one's body corresponding fresh tumor tissues sample with its near relative healthy tissues.The tissue of patient sample is taken from 2008 and Hong Kong in 2009 Mary hospital of imperial family or Weir prince hospital.Before performing the operation, patient all do not carry out part or whole body therapeutic.The diagnosis of disease all is to carry out histology by pathologist based on the morphological specificity of microscopically tumour cell to identify.Patient is definite neoplasm staging by system's neoplasm staging of american cancer joint committee (AJCC)/International Union Against Cancer (UICC).Behind the excision, obtain tissue within 20 minutes, and shred at once, with VI Collagen Type VI enzyme (Sigma-Aldrich; Louis, MO) enzymolysis is containing penicillin (500U/ml) and the resuspended fragment of organizing of Streptomycin sulphate (500ug/ml) DMEM/F12 nutrient solution then.Suspension is filtered the filter membrane (BDBiosciences of 100um; Franklin Lakes NJ) obtains single cell suspension.Remove dead cell and red corpuscle by the method for sucrose density gradient centrifugation, the ACK damping fluid cracking of remaining red corpuscle.Viable count expects that by platform blue dyeing carries out analysis of accounts.

2.CD133 the clinical sample research of existence dependency

Our 41 routine liver cancer tissue samples are taken from the hepatocarcinoma patient that excision has been done by 2000 to 2005 Hong Kong Mary hospital of imperial family.These patients have comprised the 37 routine patients male sex and 4 routine female patients, and the age was between 28 to 80 years old (The median age was 55 years old).System by stages according to AJCC/UICC carries out neoplasm staging.Table S1 is that patient's clinical information is summed up.All patients know the inside story and have obtained their agreement before collecting patient's liver cancer sample, and the audit of Ethics Committee of Hong Kong University has also been passed through in this research.

3. cell sorting and flow cytometer showed

We use the anti-people CD133/1 of mouse monoclonal antibody (AC133, the Miltenyi Biotec of PE mark; Auburn, CA) the mark liver cell carries out the fluidic cell sorting.Mouse IgG1k-PE (eBioscience; San Diego is CA) as the homology heterogenetic antibody.Using BD FACSVantage SE (BD Biosciences) analyzes and sorting sample.20% non-positive cell in the cell of 25% strong positive in the positive cell and the negative cells is elected to be positive cell group and negative cells group respectively.We carry out magnetic bead sorting with the CD133/1 antibody (AC133, Cell Isolation Kit, Miltenyi Biotec) of marked by magnetic bead in conjunction with the tumour cell of the liver cancer tissue sample of enzymolysis.Every twice of magnetic bead sorting of routine patient specimen.The cell that sorting obtains is used in conjunction with the antibody of another antigenic determinant of CD133 antigen (CD133/2, AC141, Miltenyi Biotec) and is analyzed and control its purity.Cytoactive is analyzed with trypan blue dyeing.Derive from tissue of patient and mouse xenogenesis the plantation knurl through sorting with not by the cell of sorting, CD133/1 (AC133, Miltenyi Biotec) antibody and mouse IgG1k-PE (eBioscience) with the PE mark analyze its CD133 expression as the homology heterogenetic antibody.Use the anti-people CD31 of the mouse monoclonal antibody antibody (eBiosciences) of FITC mark and the anti-people CD45 of the mouse monoclonal antibody antibody (clone2D1 of FITC mark respectively, Stem Cell Technologies) or mouse IgG1k-FITC homology heterogenetic antibody, analyze CD31 endotheliocyte and CD45 lymphocyte in the CD133+ cell mass.Use FACScalibur apparatus instrument and carry out flow cytometry, and data are analyzed with CellQuest software (BD Biosciences).

4.miRNA expression pattern analysis

Use Stem Cell miRNA qPCR chip (System Biosciences; Mountain View, CA) the total RNA to sorting cells carries out the miRNA expression pattern analysis, has wherein comprised 95 human miRNA that potential function is arranged in the self of cell and differentiation.U6RNA is as the stdn contrast of amplification in the human small molecular core.All miRNA are registered at Sanger miRBase lane database.Carry out the qPCR amplification with SYBR Green, the software that provides with System Biosciences carries out the data analysis processing.

5. animal model and mouse charge coupled device imaging experiment

Used zooperal working specification all meets Hong Kong University uses living animal about teaching and research criterion.Experiment is carried out in-situ injection or subcutaneous injection by the liver to 4 to 5 all SCID/Beige mouse, to detect the one-tenth knurl of cell.The method of in-situ injection: the fresh tumour cell that obtains obtains CD133+ and CD133-cell by sorting, be suspended in complete culture solution after, mix with matrigel (BD Biosciences) with 1: 1 ratio respectively, in-situ injection is in mouse liver.In the miR-130b transplantation experiments, the antagomirs of miR-130b or antisense contrast are used for transfection CD133+ tumour initiator cell, and miR-130b or empty carrier are used for transfection CD133-cell, and it is subcutaneous all to be inoculated in mouse after the cell after the transfection suspends with complete culture solution.Eight mouse are established in every group of experiment.After tumour forms, per 3 days sizes with a knurl of vernier caliper measurement, and tumor size is calculated acquisition by formula Volume (cm3)=L*W2*0.5.Mouse partly carries out imaging to mouse tumor after putting to death at once.In brief, utilize Xenogen IVIS 100 cooling charge coupled device camera (Caliper Life Sciences; Hopkinton, MA).Time shutter was from 30 seconds to 1 minute.After gray level image obtains, again tumor section is obtained fluoroscopic image.By overlapping, show the tumor image of animal to the scattered light of gray level image and photons/s/cm2.In the TP53INP1 transplantation experiments, the TP53INP1-shRNA cell of slow virus mediation or transfection after the contrast CD133-cell of non-special shRNA suspends with complete culture solution, it is subcutaneous to be inoculated in mouse.Six mouse are established in every group of experiment.After becoming knurl, tumor tissues is carried out frozen section (5 micron thickness), and be used for HE and IHC dyeing.Inoculated the mouse of tumour cell, 5 moonsets have and form obvious tumour, and terminations that will be condemned to death, and the position of cutting the inoculated tumour cell do not form tumour with definite its.

6. statistical analysis

Use Microsoft Office Excel software (Microsoft Corp.; Redmond WA), after the outlier in the rejecting data, carries out the independent sample t check, and all data are all used PASW Statistics 18.0 (SPSS, Inc.; Chicago IL) analyzes.The P value thinks that less than 0.05 significant difference is arranged.Different clinicopathologic stage CD133 expression difference are checked by X2 and are analyzed.The case that Δ Ct value drops in 1/2 standard deviation ± mean scope is disallowable.The case that Δ Ct value is lower than mean-1/2 standard deviation is considered to the CD133 high expression level, and Δ Ct value is higher than the case of mean+1/2 standard deviation and is considered to that CD133 is low to express.Utilize Kaplan-Meier method and log-rank to check difference between the comparison primary tumo(u)r CD133 positive and the primary tumo(u)r CD133 negative patient survival rate, survival rate was defined as from extremely dead this time period of operation, and dead patient is defined as the time period of following up a case by regular visits to the last time from operation.In the check organization chip there be in the used paired t-test of indifference the mean of other non-tumour hepatic tissue of cancer and hepatocellular carcinoma tissue expression Tp53INP1,134 routine patients' sample has only 77 examples meaningful, and residue 57 examples are not excluded owing to not expressing Tp53INP1 in other non-tumour hepatic tissue of cancer and the hepatocellular carcinoma tissue.

The positive liver neoplasm initiator cell of CD133 (CD133 in the embodiment 1. hepatocellular carcinoma clinical samples ⁺TICs) discriminating

This breadboard previous work has identified a class tumour initiator cell, and they are present in heteroplastic hepatocellular carcinoma (HCC) and the clone, have cell-surface antigens mark CD133.CD133 ⁺Cell can extensively be bred, and demonstrates the stronger self and the potentiality of differentiation, expresses the stem cell mark of correlation and keeping low occurrence rate .CD133 in tumour ⁺Cell can also be by activating the resistance that the Akt/PKB path causes HCC. to this class CD133 in heteroplastic HCC and the clone ⁺The discriminating of TICs and description prompting, in former HCC clinical samples, CD133 can become a kind of tumour initiator cell mark too.Therefore, as the first step, we utilize flow cytometry and immunohistochemical methods (IHC) to detect the expression of CD133 in the flesh tissue sample of taking from HCC patient.35 routine patients have been analyzed altogether, fluidic cell prompting CD133 in the HCC sample ⁺The occurrence rate of cell is very low, and scope is at 1.3% to 13.6% (Figure 1A).Utilize CD45 and CD31 to get rid of hemopoietic progenitor cell and endothelial progenitor cells in the fluidic cell process respectively to CD133 ⁺The potentially contaminated of cell mass.The result shows CD133 ⁺Pantematopoietic mark CD45 is negative in the cell, only less than 1.3% CD133 ⁺Subgroup may be CD31 ⁺Endothelial progenitor cells (Fig. 2 A).Ensuing histology is to CD133 ⁺The analytical results of cell similar to the result of fluidic cell (Figure 1B).All HCC samples have proved CD133 once more ⁺Cell mass only occupies the minority, and by contrast, CD133 expresses (Figure 1A and 1B) hardly in the corresponding other non-tumour hepatic tissue of cancer (NT).Because the follow-up period after clinical samples is collected falls short of, can't calculate the expression of CD133 and the dependency between disease free survival and the total survival rate.But, the analytical results and the follow up data of the real-time quantitative PCR (qPCR) of more early stage 41 parts of HCC tissue samples collecting shown that CD133 expresses that to increase not only the neoplasm staging with higher relevant, and relevant with higher recurrence rate and lower total survival rate.Compare with low neoplasm staging (I phase or II phase), the bigger (X of cognation with high neoplasm staging (III phase or the IV phase) is increased in the expression of CD133 in the hepatocellular carcinoma ²Check, p=0.008; Fig. 1 C).And (n=38, Pearson is relevant, r=-0.428, X to be negative correlation correlation analysis demonstration CD133 Δ Ct value and this 41 routine HCC patient's neoplasm staging ²Check, p=0.007).The Kaplan-Meier survival analysis shows, when negative with those primary tumo(u)rs CD133 or the low patient who expresses compares, primary tumo(u)r CD133 male patient has lower disease free survival, and (the former estimates=61.49 months by mean, latter's mean is estimated=13.75 months) (log-rank check, p=0.001; Fig. 1 D). in addition, CD133 expresses also relevant with long-term total survival rate, the average total survival rate of primary tumo(u)r CD133 male patient is 27.11 months, by contrast, the average total survival rate of the negative or low patient who expresses of primary tumo(u)r CD133 is (log-rank check in 78.51 months, p＜0.001). single argument COX regression analysis identifies the tight association of neoplasm staging and disease free survival equally, yet the CD133 expression is all relevant with total survival rate with disease free survival., the expression of CD133 and age, sex, the cognation of AFP content and tumour size is little.

Next, we analyze isolating CD133 from the fresh excision sample of HCC ⁺The one-tenth knurl of TICs and stem-like cell characteristic.Preliminary data confirms, tumor tissues is resolved into individual cells, and the cell of requirement at least 70% has activity and could guarantee to become the knurl test and the tumour of leaving one's post to form carrying out smoothly of test at body.In 83 pairs of HCC samples collecting and corresponding NT tissue, have only the sample of 1/4th (n=21) to decompose resulting cytoactive greater than 70%, therefore, have only this research as next step of this 21 increment: handy flow cytometry carries out primary dcreening operation (n=35) to the CD133 express cell.After removing the non-activity cell, again by magnetic bead sorting to CD133 ⁺TICs carries out enrichment, further makes CD133 ⁺The purity of cell reaches considerable 82%-92%, the more important thing is, can make CD133 ^-The purity of cell is greater than 98%.Similarly, in streaming, utilize CD45 and CD31 to get rid of the potentially contaminated of hemopoietic progenitor cell and endothelial progenitor cells respectively.

Pair cell carries out after the sorting, and we have studied the CD133 in tumour source ⁺Cell and CD133 ^-Cell is in the ability of xenogenesis plantation of the normal position of SCID/Beige mouse and generation tumour.Approximately need CD133 ^-Liver cancer cell 5 * 10 ⁵Be suspended in the formation of initial tumour once in a while in the matrigel, yet, by contrast, only need be with 2 * 10 ⁴CD133 ⁺Cell suspension just can produce macroscopic tumour (data represented 8 tumours that are detected of Fig. 2 B) after 8 weeks in matrigel.These Notes of Key Datas: cell that can initial HCC all is enriched in CD133 ⁺In the cell mass.In addition, histologic analysis shows CD133 ⁺The tumour that the plantation of cell xenogenesis produces is on histological type identical with primary tumo(u)r (data are unlisted).In order to study CD133 ⁺Whether liver cancer cell has secular one-tenth knurl, and we have tested them and form the ability of tumour in continuous planting experiment.From the tumour that the plantation of first-generation xenogenesis forms, sub-elect CD133 respectively ⁺And CD133 ^-Cell is planted it in s-generation mouse body again, has only CD133 ⁺Tumour cell can form tumour.S-generation plantation is compared with first-generation plantation, and the speed that tumour forms is faster, and the mouse number that successfully forms tumour more (second on behalf of 85%, the first on behalf of 65%) prove that the s-generation plants growth of tumor and have more superiority (Fig. 2 B).On the form of tumour, be difficult to offer an explanation it from first-generation plantation tumour or primary tumo(u)r.Therefore, be present in CD133 in the HCC tissue ⁺Cell mass can point out it to have in body self ability forming tumour in the xenogenesis plantation continuously.

Next, we have detected CD133 ⁺TICs and CD133 ^-Cell is at non-sticky, and serum-free is added with the ability that grows into spherical tumour in the nutrient solution of somatomedin, and this nutrient solution can promote the propagation of undifferentiated cell.In 3 time-of-weeks of cultivating, obtain spherical hepatocellular carcinoma, by the CD133 that is in growth conditions ⁺Cell is formed, and CD133 ^-Tumour cell to grow (Fig. 2 C, data represented 7 the detected tumours) that in this serum-free medium, lose activity.The more important thing is, from these CD133 ⁺Groups of cells glomeration tumor tissues decomposes and the individual cells that comes can breed to form in ensuing continuous passage and cloned, and demonstrates unlimited energy for growth.CD133 ⁺When cell amplification was grown to serve as spherical hepatocellular carcinoma, the cell in the cancerous tissue still was CD133 ⁺Cell.In order to identify these CD133 ⁺The differentiation capability of cell, in the nutrient solution of spherical tumour, add 10% serum, remove Urogastron and fibroblast growth factor 2 simultaneously, after cultivation in a few days, spherical tumour begins differentiation, and adhering to becomes attached cell in the cultivation, compare with undifferentiated spherical tumour, the expression amount of these attached cells CD133 after external evoked differentiation reduces (Fig. 2 D, data represented 7 detected tumours).CD133 ⁺Cell forms the ability of spherical each continuous passage of tumour and points out it to have stripped self ability.Similarly, CD133 ⁺After the external evoked differentiation of TICs cell mass, the stem cell genes involved comprises Bmi-1, and Notch 1, Sox2, Oct-4, nanog, β-catenin, Smo, the expression of nestin and multidrug resistant translocator ABCG2 and ABCB1 has all reduced (Fig. 2 E, data represented 3 detected tumours).In addition, derive from the CD133 of patient HCC tissue ⁺TICs is with CD133 ^-Cell is compared, and its stem cell Expression of Related Genes higher level comprises nanog, Oct-4, ABCB1 and Sox2 (Fig. 2 F, data represented 3 detected tumours).In sum, have the existence of the tumour initiator cell of surface markers CD133 among these digital proofs HCC, and these cells can produce tumour, have the stem cell characteristic, comprise self, the ability of differentiation and external formation tumour.

Embodiment 2.CD133 ⁺TICs and contrast CD133 thereof ^-The miRNA express spectra of cell

To CD133 ⁺After TICs differentiates, next step experiment will describe that this class cell is brought into play the potential mechanism of its function and role in the tumour progression process.MiRNA is considered to the important regulating and controlling factor of a class in post-transcriptional level genetic expression, is regulating the growth of cytodifferentiation, embryonic stem cell, also uses tumour progression and differentiation.Given this, whether our hypothesis is because the differential expression of miRNA makes CD133 ⁺TICs has the different characteristic with its differentiation offspring.We isolate CD133 from HCC patient's excision sample and hepatoma cell line ⁺TICs and CD133 ^-Cell, the qPCR miRNA chip by based on SYBR-Green carries out the miRNA expression analysis to it.These chips comprise the miRNA that 95 that be described in detail and the stem cell self is relevant with the differentiation potential characteristic.The miRNA that demonstrates greater than 2 times of differences in HCC patient's tumor specimen and hepatoma cell line is considered to significant.In clinical liver cancer sample, find 5 miRNA that go up 24 downward modulations of mediation altogether.Similarly, in all hepatoma cell line, there is the miRNA of 9 downward modulations of mediation on 4 to be differentiated out.We infer that relevant miRNA should come across in primary tumo(u)r and the hepatoma cell line simultaneously.Therefore, we are depicted as Venn figure in conjunction with this two piece of data and with it, and observe the miRNA that always has 8 unconventionality expressions, they come across in all cells simultaneously: the miRNA (let-7a of the miRNA of 2 rises (miR-130b and miR-367-5p) and 6 downward modulations, miR-30c, miR-33, miR-153, miR-1 and miR-10b) (Fig. 3 A).In order to verify the result of miRNA expression pattern analysis, we have carried out second qPCR that takes turns, and used is accurate more Taqman probe, and corresponding target spot is hepatoma cell line PCL8024 and Huh7, CD133 ⁺The miRNA of common unconventionality expression expresses the different hepatoma cell line of degree (data are for showing) with a series of CD133 in the cell.The miRNA of top-priority those unconventionality expressions has obtained checking really, and still, in probe test, the expression of two contrast miRNA (miR-24 and miR-92) does not change.Yet, the expression closely related (Fig. 3 B) of CD133 in the expression of having only miR-130b and the hepatoma cell line that is detected.CD133 expresses lowly in the hepatoma cell line, and the expression of miR-130b is also relatively low, and (HeG2, H2P H2M), express high hepatoma cell line, the expression of miR-130b also higher relatively (PLC8024, Huh7, Hep3B) (Fig. 3 B) with respect to CD133.Given this, simultaneously because it is at CD133 ⁺Unconventionality expression level height among the TICs, we schedule miR-130b with the focus of research.

The CD133 that embodiment 3. is separated to from the HCC clinical samples of fresh excision ⁺Among the TICs, the miR-130b high level expression

Except used 5 routine HCC clinical samples in initial miRNA shaker test, we also detect the CD133 that is sorted into from the HCC clinical samples of other 15 routine fresh excisions by qPCR ⁺TICs and CD133 ^-The expression of tumour cell miR-130b.We also sorting come from the spherical tumour CD133 of vitro culture ⁺TICs and CD133 ^-The expression of miR-130b in the tumour cell.With CD133 ^-Control cells is compared, CD133 ⁺The expression of cell mass miR-130b higher (N=15, P=0.018; Fig. 3 C).In addition, those high expression levels CD133 comes from patient's tumor specimen and compares with those tumour cells of not expressing CD133 or vitro differentiation, and its miR-130b expresses higher (Fig. 3 D).Hepatoma cell line PLC8024 is after Dx and cis-platinum (they all are conventional clinically hepatocellular carcinoma chemotherapeutic) processing, and qPCR analyzes and shows its high level expression miR-130b, with corresponding (P＜0.05 of CD133 high expression level situation; Fig. 3 E).

Embodiment 4.miR-130b demonstrates that stronger increment, self and tumour form ability and to the resistance of conventional chemotherapy medicine

We further study miR-130b and how to regulate and control CD133 ⁺The one-tenth knurl of TICs, the potential and the resistance of self.We will include the lentiviral vectors stable transfection Huh7CD133 of the pri-miR sequence of miR-130b ^-Or PLC8024CD133 ^-Cell, the ripe body of the high-caliber miR-130b of cell expressing after the transfection.Detect (Fig. 4 A) through XTT cell growth test, with transfection the control cells (CD133 of empty carrier ^-EV) compare, transfection the CD133 of miR-130b ^-Cell (CD133 ^-MiR-130b) in, the stem cell genes involved is high expression level also, comprising: β-catenin, and Notch 1, Sox2, nestin, Bmi-1 and ATP are in conjunction with box half way around fortune albumin A BCG2 (Fig. 4 B).And, overexpression miR-130b CD133 ^-Cell is also to chemotherapeutics: Dx has stronger resistance (Fig. 4 C).We then detect the influence of the expression of increase miR-130b to self and tumor growth generation.CD133 ^-The miR-130b cell compares CD133 ^-The EV cell produces bigger more spherical tumour (Fig. 4 D) in the time that significantly shortens.The spherical tumour of the important miR-130b that is transfection can reach the next generation from the first-generation, and the spherical tumour that control cells forms can not go down to posterity.These two kinds of cell seedings are gone into the side of body side of SCID/Beige mouse, CD133 ^-The growth of miR-130b cell significantly strengthens (Fig. 4 E).In the middle of 8 mouse of every group, CD133 ^-The miR-130b liver cancer cell be injected into mouse subcutaneous after, in 9 whens week, can produce tumour in 4 mouse bodies therein nearly, and CD133 ^-EV control cells or do not have the CD133 of transfection ^-Liver cancer cell can not produce tumour in the mouse body.Opposite, slow-virus transfection PLC8024CD133 ⁺TICs knocks out miR-130b (ZIPmiR-130b) and produces opposite result, with a transfection CD133 of antisense contrast (ZIP CTRL) ⁺The CD133 of TICs or not transfection ⁺Liver cancer cell is compared to have lower in-vivo tumour and forms ability (table 1, table 1 are to change to have/CD133 of no miR-130b ⁺CD133 ^-Tumor formation rate).Same, the cell that miR-130b expresses can produce more tumour (data are unlisted), the self ability (Fig. 4 F) that the spherical tumour of the third generation that exsomatizes also points out miR-130b can strengthen cell in the body continuous passage during to s-generation mouse.CD133 ⁺The CD133 of TICs and expression miR-130b ^-Plastidogenetic tumour is no significant difference on weave construction and form.In a word, express CD133 ^-MiR-130b and CD133 ^-EV compares, and demonstrates and CD133 ⁺The characteristic that TICs is more approaching.Opposite, with CD133 ⁺TICs compares, the CD133 of miR-130b expression by inhibitation system ⁺Cell (CD133 ⁺ZIP miR-130b) demonstrates and CD133 ^-The characteristic that cell is more approaching.The expression of increasing or reduce miR-130b does not influence the expression of CD133, prompting, although the expression of miR-130b is regulated by CD133, CD133 expresses the adjusting (Fig. 4 G) that is not subjected to miR-130b.

Table 1

Annotate: ¹: CD133 ^-Cross expression empty carrier (EV) or miR-130b in the cell. ²: at CD133 ⁺Knock out empty carrier (ZIP CTRL) or miR-130b (ZIP-miR-130b) in the cell.

Embodiment 5.TP53INP1 is the direct target molecule of miR-130b

In order to search out the downstream target molecule of miR-130b, we integrate mRNA expression pattern analysis result and computer forecast result.Utilize computer forecast software PicTar and TargetScan, find the target molecule of 289 miR-130b among both synergetic results altogether.To transfection the microarray analysis of mRNA express spectra of hepatoma cell line PLC8024CD133 negative cells of miR-130b or empty carrier obtain changing multiple greater than 271 of 2 downstream genes.In a word, with these data binding analysis, filter out candidate's said target mrna of 3 miR-130b: TP53INP1 (oncoprotein P53 inductive nucleic acid-protein 1), DPYSL2 (dihydropyrimidinase associated protein 2) and MDFI (the obform body p40 that comprises MyoD family supressor) (Fig. 5 A).In these three possible target molecules, that we pay close attention to is TP53INP1, because it is by the tumor suppressor gene known to the people, and one piece of recent report proof causing because of human T-cell leukemia virus 1 in the unusual cell of growth regulating, and TP53INP1 is the functional target molecule of miR-130b.

According to the base complementrity pair principle, we find that the 3 ' non-coding region (TP53INP13 ' UTR) of TP53INP1 comprises two possible miR-130b binding sites (3927-3953nt and 5525-5562nt), all has significant complementarity (Fig. 5 B) with miR-130b.Two elements of this of TP53INP13 ' UTR are high conservative with miR-130b in different species.In mouse, rat, monkey and people's autoploid, have identical sequence, point out it to have critical function (Fig. 5 B).In order to verify whether TP53INP1 is the real target molecule of miR-130b, we clone the downstream in luciferase reporter gene respectively with people TP53INP13 ' UTR full length fragment and two fragments that are positioned at 3927-3953nt (site 1) and 5525-5562nt (site 2) that comprise possible binding site.With a transfection contrast of miR-130b compare, common transfection the cell of sense strand of miR-130b and TP53INP13 ' UTR total length, its fluorescence activity significantly descends about 38%.Common compared with the control transfection the fluorescence activity of cell in miR-130b and TP53INP13 ' UTR site 1 and/or site 2 about 20-29% that descends.For proving its bonded specificity, the antisense strand of our binding site that TP53INP13 ' UTR is possible 1 and binding site 2 replaces sense strand, and this retarding effect promptly is cancelled (Fig. 5 C).What is interesting is, at PLC8024CD133 ^-Degraded TP53INP1 can not promote the expression of CD133 or miR-130b in the cell.Compare, at PLC8024CD133 ⁺Cell or Huh7CD133 ⁺In the cell, the expression of reticent CD133 but can significantly suppress the nearly 10-20 of expression times of miR-130b, raises the expression of TP53INP1 simultaneously, and prompting miR-130b and TP53INP1 are the direct downstream target spots (Fig. 5 D) of CD133.

What is interesting is that in a series of hepatic cell lines of expressing CD133 in various degree, in gene and two levels of albumen, the expression of the expression of TP53INP1 and CD133 and miR-130b is negative correlation.In the low hepatoma cell line of expressing of CD133,, can detect the expression (Fig. 5 E) of a large amount of TP53INP1 such as MIHA, H2P and H2M.On the contrary, the hepatoma cell line of CD133 continuous expression is expressed low-level or is not expressed TP53INP1 as HepG2, PLC8024, Hun7 and Hep3B.Same, the CD133 that from the HCC clinical samples of fresh excision, extracts ⁺TICs and its CD133 ^-Control cells is compared, and the expression of TP53INP1 has also significantly been suppressed (n=15, P=0.043; Fig. 5 F and 5H).Specifically, in same 15 couples of NT tissue and HCC clinical samples, we have detected the miR-130b expression, list among Fig. 3 C.Between miR-130b and TP53INP1, there are remarkable negative correlation (P=0.002, Pearson correlation coefficient r=-0.732; Fig. 5 G).At gene and protein level, be selected from the CD133 of HCC clinical samples and HCC clone ⁺In the cell mass, the negative correlation of miR-130b and TP53INP1 is (P＜0.01 all clearly; Fig. 5 H and 5I).In addition, we also observe, and utilize the lentiviral vectors transfection system, make CD133 ^-The miR-130b up-regulated of cell, the expression of its TP53INP1 is just low; And make CD133 ⁺The miR-130b down-regulated expression of cell, the expression of its TP53INP1 just high (Fig. 5 J and 5K).

Embodiment 6.TP53INP1 regulates CD133 ⁺The ability of TICs formation and self

In order further to explore TP53INP1 role in the HCC progress, we utilize immunoblotting to detect to take from the proteic expression of TP53INP1 in 17 routine patient's paired NT tissues and the HCC sample, have also used simultaneously to include that 134 routine patient's paired NT organize and the organization chip of HCC sample.Immunoblotting detects the NT that 11 examples (65%) are arranged among the 17 routine patients and organizes high expression level TP53INP1 (to be respectively patient A, B, C, D, E, I, K, L, M, N and P; Fig. 6 A).Compare with corresponding neighbour HCC tissue, the expression of NT tissue T P53INP1 has significantly been risen, and (NT tissue and HCC sample be to subnumber n=77, paired t-test, p＜0.001; Fig. 6 B).TP53INP1 in pair cell matter dyeing can observe that tenuigenin dyes by force in the NT tissue, and the HCC sample, Comparatively speaking, tenuigenin is light to be dyed, and shows that the expression of its TP53INP1 is relatively low (Fig. 6 B, a left side and right).And, among the HCC expression of TP53INP1 high more, the low more (X of its AFP content ²Check, p＜0.001; Table S5).Yet the expression level of TP53INP1 and sex, age, serum HB antigen positive rate and liver cirrhosis do not have obvious dependency.In order further to understand function and the effect that TP53INP1 exercises in liver cancer forms, we utilize the shRNA slow virus system that knocks out to suppress PLC8024CD133 ^-The expression of cell TP53INP1 (Fig. 6 C).In the clone that these 5 TP53INP1 are degraded by shRNA, detect with immunoblotting and wherein to clone 464 and 4095 and compare the inhibition degree maximum that TP53INP1 expresses with the contrast that does not deal with, thereby they are chosen as further research object (Fig. 6 C).Suppress PLC8024CD133 ^-The expression of cell TP53INP1 (clone 464 and 4095), although cell growth has only slight promoter action (Fig. 6 D), can significantly promote cell and in external non-sticky serum-free medium, form the ability of spherical tumour and the ability (Fig. 6 E) of external continuous passage.More what is interesting is, compare PLC8024CD133 with its contrast ^-After the expression of cell TP53INP1 was suppressed, the ability that its subcutaneous injection immunodeficient mouse forms tumour had improved (Fig. 6 F and 6H, the number n of every group of mouse=6, hypodermic cell count=1 * 10 ⁵).The tumour that subcutaneous xenogenesis plantation is produced is through H﹠amp; Its histological type of E dyeing proof is former HCC (Fig. 6 G).Of paramount importancely be, clone 464 and 4095 can form in s-generation mouse body and plant tumour, and (Fig. 6 I, the cell count that the number n of every group of mouse=5, two group mouse is injected respectively is 1 * 10 to point out it to have the self ability equally ⁴With 3 * 10 ⁴).Continuously in the tumour xenogenesis planting experiment, the s-generation is tried mouse and is formed the required time of tumour and shorten, and the number that tumour forms increases, and illustrates that it plants into the knurl ability and increase (Fig. 6 I).

In order to illustrate above viewed phenomenon is because suppressed the expression of TP53INP1 rather than because due to reticent other genes of miR-130b, we remedy experiment below having carried out really.We arrive CD133 with the shRNA of the antagomirs of reticent miR-130b and the TP53INP1 that degrades or with the shRNA transfection of same antagomirs and no degrade specifically effect simultaneously ⁺In the TICs, have only and degrade TP53INP1 simultaneously and suppress the CD133 that miR-130b expresses ⁺The cells in vitro tumour forms ability and the self ability strengthens, in the intravital one-tenth knurl of immunodeficient mouse increase (Fig. 6 J and 6K).With CD133 ⁺Cell and CD133 ⁺ZIP CTRL is similar, has suppressed the miR-130b expression, transfection simultaneously the CD133 of TP53INP1 ⁺The formation and the continuous passage (Fig. 6 J) of the outer spherical tumour of cell energy inchoate aspect.With CD133 ⁺Cell and CD133 ⁺ZIP CTRL compares, and these cells demonstrate similar tumour and form ability (mouse was condemned to death in the 12nd week for Fig. 6 K, the number n of every group of mouse=3).In order to form contrast well, to CD133 ^-Cell and CD133 ⁺ZIP miR-130b cell has also been implemented the same experiment of remedying.

Should be noted that at last; above embodiment is only in order to illustrate technical scheme of the present invention but not limiting the scope of the invention; although the present invention has been done detailed description with reference to preferred embodiment; those of ordinary skill in the art is to be understood that; can make amendment or be equal to replacement technical scheme of the present invention, and not break away from the essence and the scope of technical solution of the present invention.

Sequence table

＜120〉suppress the siRNA of miR-130b genetic expression and expression vector and improve in preparation

Application in the medicine of liver cancer treatment effect

<160>2

<210>1

<211>22

<212>miR-130b

<400>1

cagugcaaug?augaaagggc?au 22

<210>1

<211>22

<212>siRNA

<400>2

atgccctttc?atcattgcac?tg 22

Claims

1. a specific specificity suppresses the siRNA of miR-130b genetic expression, it is characterized in that the sequence of described miR-130b is shown in SEQ ID NO:1, and the sequence of described siRNA is shown in SEQ ID NO:2.

2. a specific specificity is characterized in that at the miR-130b expression carrier, and described expression vector contains the described siRNA of claim 1.

3. the described siRNA of claim 1 is or/and the application of the described expression vector of claim 2 in the medicine of preparation raising liver cancer treatment effect.

4. application according to claim 3 is characterized in that, the described medicine that is used to improve the liver cancer treatment effect is an effective constituent with the medicine that target suppresses the miR-130b gene.