CN102154482A - Application of calcium activated chloride channels ANO1/TMEM16A in diagnosis and treatment of prostate cancer - Google Patents
Application of calcium activated chloride channels ANO1/TMEM16A in diagnosis and treatment of prostate cancer Download PDFInfo
- Publication number
- CN102154482A CN102154482A CN 201110041063 CN201110041063A CN102154482A CN 102154482 A CN102154482 A CN 102154482A CN 201110041063 CN201110041063 CN 201110041063 CN 201110041063 A CN201110041063 A CN 201110041063A CN 102154482 A CN102154482 A CN 102154482A
- Authority
- CN
- China
- Prior art keywords
- ano1
- tmem16a
- prostate cancer
- cell
- treatment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses an application of calcium activated chloride channels ANO1/TMEM16A in diagnosis and treatment of prostate cancer. In the invention, firstly discovering by in-vitro experiments, the ANO1/TMEM16A is closely related with the prostate cancer of people, and the ANO1 expression is increased along the increase of the malignancy of the cancer; and discovering from further in-vitro experiment, the ANO1/TMEM16A can promote the proliferation, transfer and intrusion capabilities of prostate cancer in an in-vitro manner. Discovering from in-vivo experiments, the restraining of the ANO1/TMEM16A expression can effectively restrain the proliferation of the cells of the prostate cancer, thus showing that the ANO1/TMEM16A plays an important role in developing process of the prostate cancer, being capable of taking the ANO1/TMEM16A as a biomarker for diagnosing or detecting the prostate cancer or for being used as an assessment index for prognosis and treatment, and also being prepared into a gene medicament for treating the prostate cancer.
Description
Technical field
The present invention relates to the new purposes that calcium activates chloride channel ANO1/TMEM16A, relate in particular to calcium and activate chloride channel ANO1/TMEM16A, belong to the medicinal use field that calcium activates chloride channel ANO1/TMEM16A in preparation diagnosis and the reagent of treatment prostate cancer or the purposes in the medicine.
Background technology
Calcium activates chloride channel and is present in widely on various excitability and the non-excitability cell, the multiple critical function of performance under physiological status, as: regulating cell excitability, contraction, cell cycle, secretion and cell transfer or the like, they have played crucial effects for the maintenance organization homeostasis.These vital role of ionic channel mainly are to realize by ionic current, adjusting cell volume and the generation membrane potential of control by cell.
Chloride channel plays an important role in the process of control cytolemma excitability, transmembrane transport and adjusting cell volume.Carry out in active absorption, exocytosis, propagation and the atomization at cell, effectively keep out cell volume and change, keep constant volume and homeostasis is the prerequisite of cell survival.
Prostate cancer or gland cancer originate from glandular epithelium, are one of modal malignant tumours of the male sex.Yet its pathogenesis is not clear and definite as yet so far.Evidence shows, changes the calcium ion homeostasis or makes the voltage gated ion channel up-regulated can cause some cell generation cancerations.
ANO1/TMEM16A is that the calcium on the cytolemma activates chloride channel (its nucleotides sequence is classified as shown in the SEQ IDNo.1, and coded proteic aminoacid sequence is shown in the SEQ ID No.2).ANO/TMEM16 family has 10 members in Mammals, they are respectively TMEM16A-TMEM16J (ANO1-ANO10).ANO/TMEM16 family is 8 transmembrane channels, and its N-holds and the C-end all is positioned at born of the same parents.The gene TMEM16A of coding ANO1 passage is positioned at human euchromosome 11q13.Up to now, it is the biomarker of prostate cancer that bibliographical information ANO1/TMEM16A is not arranged as yet, can be used for prognosis assessment index after diagnosis, prognosis and the treatment of prostate cancer.
Summary of the invention
The purpose of this invention is to provide a kind of new medicinal use that calcium activates chloride channel ANO1/TMEM16A.
The objective of the invention is to be achieved through the following technical solutions:
The present invention finds by experiment in vitro that at first ANO1/TMEM16A and human prostata cancer are closely related, and along with the increasing of cancer grade of malignancy, the ANO1 expression is increased; Further experiment in vitro is found, propagation, migration and invasive ability that ANO1/TMEM16A can external promotion Human Prostate Cancer Cells.Experiment is found in the body, and the expression that suppresses ANO1/TMEM16A can effectively suppress the propagation of prostate cancer cell, illustrates that ANO1/TMEM16A plays an important role in the evolution of prostate cancer.
By this serial experiment of the present invention, prove that calcium activates the medicinal use that chloride channel ANO1/TMEM16A can have following several respects at least:
Because ANO1/TMEM16A and human prostata cancer are closely related, can be with it as biomarker, be used for diagnosis or detect prostate cancer, that is to say, ANO1/TMEM16A can be prepared into the reagent of detection or diagnosing prostate cancer, for example, ANO1/TMEM16A albumen can be become diagnosis as Antibody Preparation or detect the test kit of prostate cancer, or the ANO1/TMEM16A gene is prepared into gene chip is used for diagnosis or detects human prostata cancer.In addition, because along with the increasing of cancer grade of malignancy, ANO1 expresses and increases, ANO1/TMEM16A can be used for the prognosis and the treatment back prognosis assessment index of prostate cancer.
In addition, the present invention found through experiments, and the expression that suppresses ANO1/TMEM16A can effectively suppress the propagation of prostate cancer cell, therefore ANO1/TMEM16A can be prepared into genomic medicine and be used for prevention or treatment human prostata cancer.For example, can pass through the RNA interference method, prepare and suppress the genetically engineered drug that ANO1/TMEM16A expresses, these methods all are that those skilled in the art institute is known.
Concrete, the present invention at first found through experiments, and in Human Prostate Cancer Cells (PC-3), the mRNA of ANO1/TMEM16A and protein expression level all are higher than normal human prostate epithelial cell (RWPE-1).Prove that thus ANO1/TMEM16A and human prostata cancer are closely related; In order further to study the dependency of ANO1/TMEM16A and human prostata cancer, the present invention adopts RNA to disturb means, when detecting the ANO1/TMEM16A in knocking out Human Prostate Cancer Cells PC-3, it is to becoming the influence of knurl in PC-3 cells in vitro propagation, migration, invasive ability and the nude mouse.Experimental result finds, when with shRNA (shRNA3) the in-vitro transfection Human Prostate Cancer Cells PC-3 of selectively targeted ANO1/TMEM16A, after finding to knock out ANO1/TMEM16A, the PC-3 ability of cell proliferation weakens.Show that thus ANO1/TMEM16A promotes Human Prostate Cancer Cells propagation.The present invention by the cell scratch experiment and utilize Tranwell migration cell respectively detection specificity knock out behind the ANO1/TMEM16A the migration of Human Prostate Cancer Cells PC-3 and the influence of invasive ability.According to experimental result as can be known, with respect to transfection Negative control shRNA group, behind the transfection ANO1 shRNA3, the transfer ability of PC-3 cell reduces greatly.That is: ANO1/TMEM16A can promote the cancer cells migration.The present invention detects the cancer cells invasive ability by cell invasion experiment (utilizing the Transwell cell).Experimental result shows that with respect to transfection Negative control shRNA group, behind the transfection ANO1shRNA3, the invasive ability of PC-3 cell reduces.This shows that ANO1/TMEM16A also can promote the invasion and attack of cancer cells.Show propagation, migration and invasive ability that ANO1/TMEM16A can external promotion Human Prostate Cancer Cells PC-3 by above experimental result.
In order further to observe the relation of ANO1/TMEM16A and human prostata cancer, the present invention has carried out testing in the body at animal knurl body injection ANO1 shRNA, the result shows in the body, can the slow down growth of nude mice tumour (prostate cancer cell transplanted tumor) of ANO1 shRNA, this result proves that further ANO1/TMEM16A plays an important role in the evolution of prostate cancer.
Description of drawings
Fig. 1 Real-time PCR and western detect the expression result of ANO1/TMEM16A mRNA and protein level in Human Prostate Cancer Cells.
The expression of results of Fig. 2 ANO1 in normal people, hyperplasia of prostate patient and prostate cancer patient's prostata tissue; A is the normal human prostate tissue, does not detect ANO1 and expresses; B is the hyperplasia of prostate tissue of patient, does not have ANO1 to express equally; C then is a prostate cancer tissue of patient coloration result.
The full cell currents experimental result of ANO1 of Fig. 3 normal human prostate epithelial cell (RWPE-1) and two kinds of prostate cancer cell lines (DU145 and PC-3).
The specificity shRNA (shRNA1-3) of Figure 43 section target ANO1/TMEM16A is to the inhibition efficiency test result of ANO1/TMEM16A.
Fig. 5 knocks out the influence test-results of the middle ANO1/TMEM16A of Human Prostate Cancer Cells (PC-3) to its in-vitro multiplication ability.
Fig. 6 cell scratch experiment detection specificity knocks out behind the ANO1/TMEM16A experimental result to migration and the invasive ability influence of Human Prostate Cancer Cells PC-3.
Fig. 7 cell invasion experiment (utilizing the Transwell cell) is used to detect the experimental result of ANO1/TMEM16A to cancer cells invasive ability Ying County.
The experimental result that influences tumor proliferation behind Fig. 8 knurl body injection ANO1shRNA.
Embodiment
Further describe the present invention below in conjunction with specific embodiment, advantage of the present invention and characteristics will be more clear along with description.But these embodiment only are exemplary, scope of the present invention are not constituted any restriction.It will be understood by those skilled in the art that and down can make amendment or replace without departing from the spirit and scope of the present invention, but these modifications and replacing all fall within the scope of protection of the present invention the details of technical solution of the present invention and form.
The dependency experiment of experimental example 1ANO1/TMEM16A and human prostata cancer
At first detect the expression of ANO1/TMEM16A mRNA and protein level in Human Prostate Cancer Cells by Real-time PCR and western.
In order to detect the expression of ANO1/TMEM16A mRNA level in Human Prostate Cancer Cells, the whole-cell rna (Trizol method) of normal human prostate epithelial cell (RWPE-1) (available from ATCC company) and Human Prostate Cancer Cells (PC-3 and DU145) (available from ATCC company) is extracted in this experiment respectively, after using reverse transcription test kit (Promega company) then the whole-cell rna reverse transcription being cDNA, and then use
Premix Ex TaqTM II kit (Japanese TAKARA company) carries out the detection of Real-Time PCR experiment.The 20ul system is adopted in Real-Time PCR experiment: pre-sex change in 95 ℃, 30 seconds; Amplify 40 circulations (sex change in 95 ℃, 5 seconds then; Annealing in 60 ℃, 34 seconds and extension).The required primer of Real-Time PCR is respectively: the ANO1/TMEM16A forward primer is: TCTGCTGGATGAAGTTTACGG; The ANO1/TMEM16A reverse primer is: AGGCGACATAGAAGATGGGAG;
β-actin forward primer is: TGTTACCAACTGGGACGAC;
β-actin reverse primer is: GGTGTTGAAGGTCTCAAACAT.
For further detecting the expression of ANO1/TMEM16A protein level in Human Prostate Cancer Cells, the western detection method is adopted in this experiment.Extract the whole-cell protein of normal human prostate epithelial cell (RWPE-1) and Human Prostate Cancer Cells (PC-3 and DU145) at first respectively, use BCA protein quantification method (reagent is available from U.S. Thermo company) that each group cell protein is carried out quantitatively then.When carrying out the western experiment, applied sample amount is 30ug.ANO1/TMEM16A antibody in the experimentation (the anti-people ANO1/TMEM16A of rabbit is available from Britain Abcam company) extension rate is 1: 1000; β-actin antibody (goat-anti people β-actin is available from U.S. Santa Cruz company) extension rate is 1: 500; Two is anti-all available from U.S. Santa Cruz company, and extension rate is 1: 5000.
Experimental result is seen Fig. 1.Experimental result shows: in Human Prostate Cancer Cells PC-3 (available from ATCC company), the mRNA of ANO1/TMEM16A and protein expression level all are higher than normal human prostate epithelial cell (RWPE-1).Prove that thus ANO1/TMEM16A and human prostata cancer are closely related.
Be the expression of further examination ANO1 at the prostate cancer tissue of patient, by the means of immunohistochemical methods, detected the 72 examples expression of ANO1 in prostate cancer patient, 16 routine hyperplasia of prostate patients and the 5 routine normal peoples' of (TNM clinical stages I is to the IV phase) the prostata tissue in various degree respectively.Experimental result is seen Fig. 2.In normal people and hyperplasia of prostate patient's prostata tissue, all do not detect ANO1 as can be known by the result and express, then have ANO1 in various degree to express in the prostate cancer tissue of patient.
Table 1 and table 2 are respectively the statisticses that obtains after being marked, analyzed by immunohistochemical staining.Table 1 has been introduced ANO1 expression in different patient's prostata tissues.None example detects the ANO1 expression in the 5 routine health adult tissues.Have 2 examples to detect ANO1 among the 16 routine hyperplasia of prostate patients and express rising, positive rate is 12.5%.And in the 72 routine prostate cancer patients that detect, have 65 routine patients to detect ANO1 and express rising, positive rate reaches 90.3%.Table 2 further according to TNM by stages and Gleason scoring carry out statistical study, find along with TNM by stages and the rising (promptly along with the prostate cancer grade malignancy increases) of Gleason scoring, ANO1 expresses and progressively increases.This just shows that ANO1 becomes the biomarker of prostate cancer probably.
Table 1
Table 2
Next, this experiment is respectively to the full cell currents of ANO1 of normal people's prostate epithelial cell (RWPE-1) and two kinds of prostate cancer cell lines (DU145 and PC-3).Normal human prostate epithelial cell (RWPE-1) and two kinds of prostate cancer cell lines (PC-3 and DU145) have been write down in this experiment respectively.Experiment is at room temperature carried out, and liquid formula is (mM): 140NMDG-Cl in the electrode that is adopted, 7.4Ca2+-EGTA, 2.6NMDG-EGTA, and 10NMDG-HEPES; The outer liquid formula of electrode is (mM): 140NMDG-Cl, 5KCl, 2CaCl2,1MgCl2, and 10 NMDG-HEPES.Inside and outside liquid pH value is 7.2.Adopt the EPC10 patch clamp amplifier of HEKA company during record.Electrode resistance remains on 3-5M Ω during record.
Experimental result is seen Fig. 3.By experimental result as can be known, the about 2.66nA of ANO1 electric current of PC-3 cell, normal human prostate epithelial cell (RWPE-1) 917.5pA that then only has an appointment, the two differs about 4.5 times, yet the ANO1 channel current is suppressed after having added 5uM DIDS, and the outer liquid after-current of perfusion electrode recovers again.Thereby the ANO1 of proof in PC-3 PC-3 expresses more than the normal human prostate epithelial cell.
Experimental example 2
In order further to study the dependency of ANO1/TMEM16A and human prostata cancer, this experiment adopts RNA to disturb means, when detecting the ANO1/TMEM16A in knocking out Human Prostate Cancer Cells PC-3, it is to becoming the influence of knurl in PC-3 cells in vitro propagation, migration, invasive ability and the nude mouse.
At first, this experiment has been made the specificity shRNA (called after shRNA1-3 respectively) of 3 sections target ANO1/TMEM16A and has been detected its inhibition efficient to ANO1/TMEM16A.
The specificity shRNA of 3 sections target ANO1/TMEM16A and negative control shRNA are designed and synthesized by the Shanghai triumphant gene engineering of Ji company limited.
The sequence of the human ANO1/TMEM16A genes of designed three sections siRNA targets be respectively: ANO1/TMEM16A gene (GenBank NM_018043): CGTGTACAAAGGCCAAGTA (1077-1095nt), GCATCTATTTGACTTGTCT (991-1009nt) and CGAAGAAGATGTACCACAT (837-855nt);
In order to detect the inhibition efficient of three designed shRNA to ANO1, at first the ANO1 plasmid transfection is advanced in the blank HEK293 cell (available from U.S. ATCC company), after treating its expression, respectively shRNA1-3, negative control shRNA transfection are advanced in the HEK293-ANO1 cell again.Extract respectively two days later and respectively organize cell protein by its ANO1 expression of western experiment detection.
Experimental result is seen Fig. 4.By experimental result as seen, with respect to transfection Negative controlshRNA group and positive controls (HEK293-ANO1 group), the specificity shRNA of 3 sections target ANO1/TMEM16A (shRNA1-3) is respectively the retarding effect that is expressed in the ANO1/TMEM16A in the HEK293 cell: 85%, 87% and 96%.Confirm that thus 3 sections ANO1 shRNA are all effective and ANO1 shRNA3 is most effective to the inhibition of ANO1/TMEM16A, can be used for further experiment.
Next, this experiment at first utilizes the WST-8 method to carry out cell proliferation experiment, detects to knock out among the Human Prostate Cancer Cells PC-3 ANO1/TMEM16A to the influence of its in-vitro multiplication ability:
This experiment adopts ANO1 shRNA3 to experimentize, respectively with Negative control shRNA and ANO1 shRNA3 in-vitro transfection Human Prostate Cancer Cells PC-3.After the transfection three days,, 6 parallel multiple holes are set respectively with two groups of cell inoculations (5000/hole) in 96 orifice plates.(it can be reduced into water miscible Jia Za dyestuff under the situation that electron carrier 1-Methoxy PMS exists to add WST-8 (Japanese Dojindo company) in different time points (since first day) then, then be determined at the absorbancy at 450nm place with microplate reader, this numerical value is that the O.D. value can directly reflect viable cell quantity) solution, every hole 10ul.5%CO
2/ 37 ℃ hatch 5 hours after, detect 450nm place absorbance.
Experimental result is seen Fig. 5, and according to experimental result as seen, when with shRNA (shRNA3) the in-vitro transfection Human Prostate Cancer Cells PC-3 of selectively targeted ANO1/TMEM16A, after finding to knock out ANO1/TMEM16A, the PC-3 ability of cell proliferation weakens.Show that thus ANO1/TMEM16A promotes Human Prostate Cancer Cells propagation.
This experiment by the cell scratch experiment and utilize Tranwell migration cell respectively detection specificity knock out behind the ANO1/TMEM16A the migration of Human Prostate Cancer Cells PC-3 and the influence of invasive ability.Cell scratch experiment purpose is that detection specificity knocks out behind the ANO1/TMEM16A influence to the transfer ability of Human Prostate Cancer Cells PC-3.Negative control shRNA and ANO1shRNA in-vitro transfection Human Prostate Cancer Cells PC-3 respectively will wait the quantity cell inoculation in 6 orifice plates after three days.After treating that cell covers with, wash the cut edge twice with micropipet head parallel scratches, serum free medium.Observe the cut width down respectively at 0h, 12h, 24h and 36h low power lens.Experimental result is seen Fig. 6.
By experimental result (Fig. 6) as can be known, with respect to transfection Negative control shRNA group, behind the transfection ANO1shRNA3, the transfer ability of PC-3 cell reduces greatly.That is: ANO1/TMEM16A can promote the cancer cells migration.
Cell invasion experiment (utilizing the Transwell cell) is used to detect the cancer cells invasive ability.Negative control shRNA and ANO1shRNA3 in-vitro transfection Human Prostate Cancer Cells PC-3 respectively changed substratum into serum free medium and continue to cultivate 18 hours after three days.Then with 1.5x10
5Individual cell inoculation is gone up the chamber in Transwell.Last chamber contains the 300ul serum free medium, and following chamber is for containing 10% blood serum medium.5%C0
2/ 37 ℃ hatch 24 hours after, chamber in the taking-up wipes out the indoor cell gently with cotton swab, carries out then that methyl alcohol is fixed, DAPI dyeing, the 20X fluorescent microscope is observed down.Experimental result shows (Fig. 7), and with respect to transfection Negative control shRNA group, behind the transfection ANO1shRNA3, the invasive ability of PC-3 cell reduces.This shows that ANO1/TMEM16A also can promote the invasion and attack of cancer cells.
Show propagation, migration and invasive ability that ANO1/TMEM16A can external promotion Human Prostate Cancer Cells PC-3 by above experimental result.
Experimental example 3
At first in nude mice (available from Department Of Medicine, Peking University's Experimental Animal Center) body, plant the PC-3 cell, make it become knurl.When the knurl bulk-growth to 80-100mm
3The time, be divided into three groups at random: 1) blank group (being left intact); 2) negative control group (injection Negative control shRNA on the knurl body); 3) experimental group (injecting ANO1shRNA3 on the knurl body).Injection volume is 50ug/ time, and is weekly, injects for 6 weeks continuously.Measure knurl body volume and record before the per injection.
Experimental result is seen Fig. 8, by experimental result as seen, behind the knurl body injection ANO1shRNA3, the growth of the nude mice tumour that can slow down (prostate cancer cell transplanted tumor).This result proves that ANO1/TMEM16A plays an important role in the evolution of prostate cancer.
Claims (7)
1.SEQ the calcium shown in the ID No.1 activates the purposes of chloride channel ANO1/TMEM16A gene in the reagent of preparation diagnosis or detection human prostata cancer.
2.SEQ the calcium shown in the ID No.1 activates the purposes of chloride channel ANO1/TMEM16A gene in preparation prevention or treatment human prostate cancer drug.
3. according to the described purposes of claim 2, it is characterized in that: described medicine is a genetically engineered drug.
4. the test kit diagnosing or detect human prostata cancer is characterized in that: contain the calcium shown in the SEQ IDNo.1 and activate chloride channel ANO1/TMEM16A gene.
5.SEQ the calcium shown in the ID No.2 activates the purposes of chloride channel ANO1/TMEM16A albumen in the reagent of preparation diagnosis or detection human prostata cancer.
6.SEQ the calcium shown in the ID No.2 activates the purposes of chloride channel ANO1/TMEM16A albumen in preparation prevention or treatment human prostate cancer drug.
7. the test kit diagnosing or detect human prostata cancer is characterized in that: contain the calcium shown in the SEQ IDNo.2 and activate chloride channel ANO1/TMEM16A albumen.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110041063 CN102154482B (en) | 2011-02-16 | 2011-02-16 | Application of calcium activated chloride channels ANO1/TMEM16A in diagnosis and treatment of prostate cancer |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110041063 CN102154482B (en) | 2011-02-16 | 2011-02-16 | Application of calcium activated chloride channels ANO1/TMEM16A in diagnosis and treatment of prostate cancer |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102154482A true CN102154482A (en) | 2011-08-17 |
CN102154482B CN102154482B (en) | 2012-12-12 |
Family
ID=44436151
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201110041063 Expired - Fee Related CN102154482B (en) | 2011-02-16 | 2011-02-16 | Application of calcium activated chloride channels ANO1/TMEM16A in diagnosis and treatment of prostate cancer |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102154482B (en) |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8748587B2 (en) | 2011-06-02 | 2014-06-10 | Novartis Ag | Molecules and methods for modulating TMEM16A activities |
CN104422777A (en) * | 2013-09-10 | 2015-03-18 | 中国医学科学院肿瘤医院 | Application of ANO1 protein in prediction on prognosis of esophagus cancer and precancerous lesion risk |
US9045546B2 (en) | 2012-05-31 | 2015-06-02 | Novartis Ag | Molecules and methods for modulating TMEM16A activities |
KR101741826B1 (en) | 2015-06-24 | 2017-05-31 | 한국과학기술연구원 | Agents for inhibiting movement of ANO1 to plasma membrane for cancer therapy and method for screening the same |
CN110596406A (en) * | 2019-10-30 | 2019-12-20 | 河北工业大学 | TMEM16A as osteoporosis marker, application thereof, osteoporosis diagnosis kit and medicament |
CN112359088A (en) * | 2020-10-09 | 2021-02-12 | 吉林医药学院 | FRT cell strain and application thereof in preparation of preparation or kit for detecting concentration of free calcium ions in cells |
CN113754764A (en) * | 2021-08-20 | 2021-12-07 | 四川大学华西医院 | anti-DOG-1 antibodies, conjugates, pharmaceutical compositions, pharmaceutical formulations and uses thereof |
CN116926193A (en) * | 2023-06-06 | 2023-10-24 | 北京肿瘤医院(北京大学肿瘤医院) | Tumor immunotherapy prognosis evaluation preparation and application of ANO1 targeting agent in preparation of tumor prognosis improving medicine |
-
2011
- 2011-02-16 CN CN 201110041063 patent/CN102154482B/en not_active Expired - Fee Related
Non-Patent Citations (2)
Title |
---|
《Advances in Anatomic Pathology》 20100531 Lee,Cheng-han,et al The Utility of Discovered on Gastrointestinal Stromal Tumor 1 (DOG1) Antibody in Surgical Pathology-the GIST of It 摘要 1,4,5,7 第17卷, 第3期 * |
《PHYSIOLOGY》 20101231 Loretta Ferrera et al TMEM16A Protein: A New Identity for Ca2+-Dependent Cl- Channels 第361页右栏第3-4段 1,5 第25卷, * |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8748587B2 (en) | 2011-06-02 | 2014-06-10 | Novartis Ag | Molecules and methods for modulating TMEM16A activities |
US9045546B2 (en) | 2012-05-31 | 2015-06-02 | Novartis Ag | Molecules and methods for modulating TMEM16A activities |
CN104422777A (en) * | 2013-09-10 | 2015-03-18 | 中国医学科学院肿瘤医院 | Application of ANO1 protein in prediction on prognosis of esophagus cancer and precancerous lesion risk |
CN104422777B (en) * | 2013-09-10 | 2017-11-28 | 中国医学科学院肿瘤医院 | Application of the ANO1 albumen in cancer of the esophagus prognosis and precancerous lesion risk profile |
KR101741826B1 (en) | 2015-06-24 | 2017-05-31 | 한국과학기술연구원 | Agents for inhibiting movement of ANO1 to plasma membrane for cancer therapy and method for screening the same |
CN110596406A (en) * | 2019-10-30 | 2019-12-20 | 河北工业大学 | TMEM16A as osteoporosis marker, application thereof, osteoporosis diagnosis kit and medicament |
CN110596406B (en) * | 2019-10-30 | 2021-05-07 | 河北工业大学 | TMEM16A as osteoporosis marker, application thereof, osteoporosis diagnosis kit and medicament |
CN112359088A (en) * | 2020-10-09 | 2021-02-12 | 吉林医药学院 | FRT cell strain and application thereof in preparation of preparation or kit for detecting concentration of free calcium ions in cells |
CN113754764A (en) * | 2021-08-20 | 2021-12-07 | 四川大学华西医院 | anti-DOG-1 antibodies, conjugates, pharmaceutical compositions, pharmaceutical formulations and uses thereof |
CN116926193A (en) * | 2023-06-06 | 2023-10-24 | 北京肿瘤医院(北京大学肿瘤医院) | Tumor immunotherapy prognosis evaluation preparation and application of ANO1 targeting agent in preparation of tumor prognosis improving medicine |
CN116926193B (en) * | 2023-06-06 | 2024-05-31 | 北京肿瘤医院(北京大学肿瘤医院) | Tumor immunotherapy prognosis evaluation preparation and application of ANO1 targeting agent in preparation of tumor prognosis improving medicine |
Also Published As
Publication number | Publication date |
---|---|
CN102154482B (en) | 2012-12-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102154482B (en) | Application of calcium activated chloride channels ANO1/TMEM16A in diagnosis and treatment of prostate cancer | |
Zhang et al. | The long non‐coding RNA DANCR regulates the inflammatory phenotype of breast cancer cells and promotes breast cancer progression via EZH2‐dependent suppression of SOCS3 transcription | |
Fang et al. | MicroRNA‐29b suppresses tumor angiogenesis, invasion, and metastasis by regulating matrix metalloproteinase 2 expression | |
Bates et al. | Stromal matrix metalloproteinase 2 regulates collagen expression and promotes the outgrowth of experimental metastases | |
Song et al. | LncRNA SNHG8 promotes the development and chemo-resistance of pancreatic adenocarcinoma. | |
Zhuang et al. | MicroRNA-23a depletion promotes apoptosis of ovarian cancer stem cell and inhibits cell migration by targeting DLG2 | |
Wu et al. | Upregulation of SCNN1A promotes cell proliferation, migration, and predicts poor prognosis in ovarian cancer through regulating epithelial–mesenchymal transformation | |
Liu et al. | miR‐302b regulates cell cycles by targeting CDK 2 via ERK signaling pathway in gastric cancer | |
Jiang et al. | Galectin-1 gene silencing inhibits the activation and proliferation but induces the apoptosis of hepatic stellate cells from mice with liver fibrosis | |
Zhang et al. | NCAPG induces cell proliferation in cardia adenocarcinoma via PI3K/AKT signaling pathway | |
Yu et al. | PSME3 promotes TGFB1 secretion by pancreatic cancer cells to induce pancreatic stellate cell proliferation | |
Yue et al. | NEDD4 triggers FOXA1 ubiquitination and promotes colon cancer progression under microRNA-340-5p suppression and ATF1 upregulation | |
Zhang et al. | Hypoxia preconditioned renal tubular epithelial cell-derived extracellular vesicles alleviate renal ischaemia-reperfusion injury mediated by the HIF-1α/Rab22 pathway and potentially affected by microRNAs | |
Zhuo et al. | Exosomal linc-FAM138B from cancer cells alleviates hepatocellular carcinoma progression via regulating miR-765 | |
Yao et al. | MiR-125-5p/IL-6R axis regulates macrophage inflammatory response and intestinal epithelial cell apoptosis in ulcerative colitis through JAK1/STAT3 and NF-κB pathway | |
Feng et al. | mir-218-2 promotes glioblastomas growth, invasion and drug resistance by targeting CDC27 | |
Ma et al. | Activating transcription factor 3 is overexpressed in human glioma and its knockdown in glioblastoma cells causes growth inhibition both in vitro and in vivo | |
Wu et al. | Circ_0007444 inhibits the progression of ovarian cancer via mediating the miR-570-3p/PTEN axis | |
Wang et al. | miR-21 induces chemoresistance in ovarian cancer cells via mediating the expression and interaction of CD44v6 and P-gp | |
Li et al. | RETRACTED ARTICLE: miR-202-3p negatively regulates MMP-1 to inhibit the proliferation, migration and invasion of lung adenocarcinoma cells | |
Gao et al. | Circular RNA MYLK promotes hepatocellular carcinoma progression through the miR29a/KMT5C signaling pathway | |
Cao et al. | Knocking down of Polo-like kinase 2 inhibits cell proliferation and induced cell apoptosis in human glioma cells | |
Liu et al. | miR-182 promotes cell proliferation and invasion by inhibiting APC in melanoma | |
Li et al. | RUNX 3 is down‐regulated in glioma by Myc‐regulated miR‐4295 | |
Cao et al. | Circ-0104631 promotes cell proliferation and invasion in colorectal cancer and predicts poor prognosis. |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121212 Termination date: 20160216 |