CN102154405A - Preparation method of hyaluronic acid - Google Patents

Abstract

The invention provides a preparation method of hyaluronic acid. The method comprises the following steps: transforming a recombinant expression vector into the colibacillus to obtain engineering colibacillus by constructing the recombinant expression vector of which hyaluronic acid synzyme gene Has and uridine diphosphate glucose dehydrogenase gene are jointly expressed in the colibacillus; and fermenting the engineering colibacillus to obtain the hyaluronic acid. After the method is used, the production yield of the hyaluronic acid achieves 2.5g/L. compared with the prior art, the yield of the highest HA (hyaluronic acid) obtained by gram positive chained coccus HA synthetic gene spHas expressed in the colibacillus is approximately improved by 10 times.

Description

A kind of hyaluronic preparation method

Technical field

The present invention relates to the gene engineering technology field of microorganism, specifically is to produce hyaluronic preparation method with the plasmid form or with the engineering colon bacillus that the genome conformity mode makes up.

Background technology

E. coli k12 strain system because of genetic background clearly, have numerous genetic transformation systems efficiently and genomic ease for operation is widely used in the metabolic engineering field, to produce high value added product miscellaneous.Do not find as yet at present that natural coli strain has the hyaluronic ability of production.

(Hyaluronic acid HA) separates obtain a kind of and has the high viscosity glycosaminoglycan hyaluronic acid the earliest from buphthalmos.Hyaluronic acid extensively exists in the humans and animals tissue, and its molecular weight is 5 * 10 ⁴To 8 * 10 ⁶Between the dalton, be by β-1, glucuronic acid and β-1 that the 4-glycosidic link connects; nitrogen ethanoyl glucosamine (the β 1-4 D-Glucuronic acid that the 3-glycosidic link connects; GlcA, β 1-3 D-N-acetylglucosamine, the straight-chain polymer that GlcNAc) alternately is formed by connecting.Studies confirm that this polysaccharide has participated in numerous physiological activities such as mammiferous fertilization, fetal development, revascularization and joint lubrication as structure and signaling molecule; Also playing an important role aspect inflammation and injury repairing, the moisture of keeping skin and the elasticity simultaneously.

Discover that the HA oligonucleotide chain of length-specific is being brought into play important function at aspects such as the unusual reparations of antineoplastic immune.Because hyaluronic acid unique chemical characteristic and physiological function, HA and the oligonucleotide chain that comes from HA are widely used in all many-sides such as ophthalmologic operation, arthritis treatment, antitumor, administering mode, cosmetic industry, only HA in 2008 is as raw material, and the dealing money in the world market is about 1,000,000,000 dollars and the trend that increases is year by year arranged.

Occurring in nature HA extensively exists, as the cell envelope of animal tissues Mammals cause of disease bacterium and the chlorella of viral PBCV-1 dip-dye etc.Present commercial HA mainly from the pathogenic bacteria of animal tissues's (as cockscomb, umbilical cord, buphthalmos, knuckle synovia) and cultivator and higher mammal (as strep, Streptococci) the middle extraction.For the consideration of aspects such as resource limit, cost problem and safety of medicine, above-mentioned production is ideal style absolutely not, and the method for more economic, safe and lasting production HA is done one's utmost to explore by international community.

Molecular biology and development of biology are for the solution of the problems referred to above provides important means.To HA synthesis mechanism in animal and microorganism, the researchs such as clone of the building-up process indispensable gene of many HA all are the means by metabolic engineering, and reconstruction or transformation route of synthesis are produced HA and established solid basis in the host living beings of safety.

Japanese scholar in 2004 Chai paddy grows youth etc.(Chinese patent application number be 200480022328.8) attempts HA synthesizing in plant tissue by express the HA synthetic gene (Has) that obtains from human and paramecium virus (PBCV-1) in transgenic plant.Widner B etc. (Bill Widner et al., Hyaluronic Acid Production in Bacillus subtilis Appl. Environ. Microbiol. 2005,71 (7): 3747 – 3752) successful expression obtains from gram-positive strep in subtilis HA synthetic gene, the engineering genus bacillus is fermented in common triangular flask and obtains 0.5-0.6g/L HA content.

Yet produce hyaluronic acid in plant, because of the conversion difficulty of plant, growth cycle is subject to seasonal restrictions, and many conservative environmentalists oppose transgenic plant, and there is environmentally safe potential hazard etc. in transgenic plant itself and is subjected to application limitations.For subtilis, because of this bacterium has the generation intracellular toxin, the report of various big ring grease classes and lipopeptide antibiotic, and can cause through fermentation, be used for the separation and purification cost up of field of medicaments HA, serial problems such as productive rate reduction.

Many intestinal bacteria that derive from human intestinal are beneficial bacterias of safeguarding intestinal microbial balance and HUMAN HEALTH.In addition e. coli k12 strain cording clearly genetic background, have numerous genetic transformation systems efficiently and genome operability, and be widely used in the biological product of metabolic engineering field with the production high added value.For being that the host carries out the Stephanopoulos G study group that the hyaluronic reported first of engineered production is a Massachusetts Institute Technology with intestinal bacteria.2008 these study group pass through at expression in escherichia coli Gram-positive strep HA synthetic gene SpHasWith brand-new synthetic, optimized codon and be used for escherichia coli expression SeHasGene, this research obtain the HA output of the highest about 0.2g/L.This project intestinal bacteria are difficult to obtain the industrialization utilization because of the HA synthetic yield is low.

Summary of the invention

The purpose of this invention is to provide a kind of hyaluronic preparation method who produces with efficient product hyaluronic acid engineering colon bacillus.Overcome and produce hyaluronic shortage of resources, safety issue and low hyaluronic acid synthetic problem in engineering colon bacillus in the prior art.

The present invention produces hyaluronic acid with the efficient product hyaluronic acid engineering colon bacillus of a kind of expression hyaluronan synthase gene (hyaluronic acid synthase Has) and uridine diphosphoglucose dehydrogenase gene (UDP-glucose Dehydrogenase).

The efficient product hyaluronic acid engineering colon bacillus that contains hyaluronan synthase gene and uridine diphosphoglucose dehydrogenase gene is to make up acquisition by the following method:

(1) carrier of construction expression hyaluronan synthase gene Has specifically is that the Has that PCR clones is connected in the colibacillary expression vector (as pQE80l);

(2) carrier of construction expression uridine diphosphoglucose dehydrogenase gene, the uridine diphosphoglucose dehydrogenase gene that PCR is cloned connects in the colibacillary expression vector (as pQE80l);

(3) structure contains hyaluronan synthase gene Has ,With contain the uridine diphosphoglucose dehydrogenase gene, the recombinant vectors of co expression in intestinal bacteria; The uridine diphosphoglucose dehydrogenase gene expression carrier that contains with structure in (2) is the template of PCR, and amplification contains driven element (as T5) and drives KfiThe PCR product that D expresses, and be connected into the expression hyaluronan synthase gene that makes up in (1) HasExpression vector in and obtain to contain hyaluronan synthase gene HasWith the uridine diphosphoglucose dehydrogenase gene, and can be in intestinal bacteria the recombinant vectors of co expression.

(4) hyaluronan synthase gene will be obtained to contain in (3) HasWith the recombinant vectors of uridine diphosphoglucose dehydrogenase gene, transformed into escherichia coli (as the JM109 bacterial strain) obtains the hyaluronic engineering colon bacillus of efficient product through screening.

The hyaluronic engineering colon bacillus of efficient product that contains hyaluronan synthase gene Has and uridine diphosphoglucose dehydrogenase gene used among the present invention is pHK/JM109, classification called after colon bacillus ( Escherichia coli), preserving number is CGMCC No.3926, China Committee for Culture Collection of Microorganisms common micro-organisms center (the being called for short CGMCC) preservation on June 17th, 2010 in the BeiJing, China city.

Hyaluronan synthase gene described in the hyaluronic engineering colon bacillus CGMCC of the described efficient product NO:3926 HasDerive from Pasteurella multocida ( Pasteurella multocida subsp. Multocida) in hyaluronan synthase gene PmHasDescribed uridine diphosphoglucose dehydrogenase gene derives from GDPG dehydrogenase gene in the intestinal bacteria k5 bacterial strain KfiDDescribed expression vector host strain, e. coli jm109 are purchased the company in Promega.

By coexpression hyaluronan synthase gene and contain the engineering colon bacillus pHK/JM109 of uridine diphosphoglucose dehydrogenase gene, and make it utilize simple carbohydrate (as glucose) to synthesize hyaluronic acid.

Produce hyaluronic output for further improving engineering colon bacillus of the present invention,, add fermentation substrate such as nitrogen acetyl grape amine, citric acid in the substratum and make hyaluronic output obtain a large amount of raisings by changing the aeration condition of fermentation culture.

It is as follows to produce hyaluronic method with engineering colon bacillus pHK/JM109:

(1) shake-flask culture is synthetic

Shake-flask culture is synthetic:

In the 500ml triangular flask, contain 25-50 mM K with cumulative volume 100ml-500ml ₂HPO ₄3H ₂O, pH6.5-7.2,2-4mM g/L MgSO47H2O, 20-40 mM/L citric acid, 1-2 mM MnCl ₂, 300-400 mM glucose 50-75 mM nitrogen acetylglucosamine adds in the system of 5-10 mM lactose, 10-30 g/L glycerine, 3-5g/L Casamino acid (caseinic acid hydrolyzate) and expresses PmHasWith KfiThe pHK/JM109 of D makes somatic cells concentration reach 4-5%(W/V), fermentation condition is 30-33 ℃, 250 rpm, and as follows with 28% V/V() ammoniacal liquor regulate pH to neutral, the fermentation reaction time is 30-36 hour.

HA content can reach (Fig. 1) about 0.75-1 g/L after measured.Because of the synthetic aerobic of HA and than stable p H, for further improving the output of engineering bacteria, the present invention has carried out fermentor tank HA synthetic and has cultivated.

(2) fermentor cultivation is synthetic:

Receive mycin from (penbritin) Amp50-100ug/ml+Km(card) the LB flat board of 25-100ug/ml provokes 3-5 through the single bacterium colony of the pHK/JM109 of line and incubated overnight, place 100ml TB substratum (Terrific Broth:12 g/L peptone (Tryptone), 24 g/L yeast extracts (Yeast extract), 9.4 g/L K ₂HPO ₄With 2.2 g/L KH ₂PO ₄, pH6.8) incubated overnight; This culture is through centrifugal collection thalline, thalline suspends with 20-50ml TB, all change the fermentor tank of 1-5L over to, fermentation tank culture medium is the TB substratum and contains Amp50-100 ug/ml+Kmn25-100 ug/ml, cumulative volume is 600-3000 ml, 37 ℃ of controlled temperature, rotating speed 1200 rpm, feeding flow is the mixed gas (oxygen: air 1:10 v/v) of 60 ml/min, be oxygen: air 1:10 v/v, and, cultivated 4 hours, as culture OD with 8% V/V ammoniacal liquor and 4 mol/L HCl adjusting pH to 6.8-7.2 ₆₀₀Reach at 5 o'clock, adding IPTG makes its final concentration reach 0.5-1 mM, simultaneously temperature of reaction being adjusted to 30-33 ℃ cultivated 2 hours, add 50% W/V glucose and 10% W/V ammonium phosphate pH6.8 this moment, make that glucose and ammonium phosphate content are respectively 50 g/L and 1 g/L in the fermented liquid, cultivate after 10 hours for 30 ℃, adding IPTG, glucose and ammonium phosphate once more makes its concentration be respectively 0.5 mM, 50 g/L and 1 g/L, mixed solution is cultivated after 14-30 hour for 30 ℃ and is finished fermentation, obtains the hyaluronic acid of 2-2.5 g/L concentration.

Carry out the production of HA in fermentor tank, cell concn is greatly improved, OD ₆₀₀Can reach 25-30, HA content obtains 2-3g/L, has improved synthesis capability greatly, for the condition (see figure 1) has been prepared in large-scale production.

Compared with prior art, the invention has the beneficial effects as follows:

1, engineering colon bacillus of the present invention can produce hyaluronic acid 2g/L～2.5g/L, than in the prior art by expression in escherichia coli Gram-positive strep HA synthetic gene spHas and brand-new synthetic, the hyaluronic acid volume of production of the highest about 0.2g/L that optimized codon and be used for that the seHas gene of escherichia coli expression obtains improves nearly 10 times.）

2, the present invention is used in the hyaluronan synthase gene pmHas of derived from gram-negative bacteria for the first time and contains the uridine diphosphoglucose dehydrogenase gene KfiD expresses in the Gram-negative host and produces hyaluronic acid.

Description of drawings

Fig. 1 is the metamorphosis figure behind the synthetic hyaluronic acid of efficient product hyaluronic acid intestinal bacteria pHK/JM109 of the present invention, wherein: A, C:pQE80l/JM109(control strain) use the observation of simple microscope and environmental scanning electronic microscope (ESEM) respectively; B, D:pHK/JM109 use the observation of simple microscope and environmental scanning electronic microscope (ESEM) respectively; A among the B, b, c, d: after the matter that shows transparency acid was synthetic, it is big that thalline becomes, the situation of mutual sticking connection between two bacterium individualities.

Fig. 2 is of the present invention by HA cumulative change figure in the triangular flask cultivation and fermentation process; Show among the figure that pHK/JM109 produces the hyaluronic acid ability greater than pQHK/JM109, and the empty carrier bacterial strain there is not hyaluronic generation.

Fig. 3 is the Fu Jitu of hyaluronic acid (HA) in supernatant in the bacterial strain pHK/JM109 fermentation purge process of the present invention, A:pHK/JM109, and B: the no hyaluronic acid of contrast (pQE80l/JM109) generates.

Fig. 4 produces best hyaluronic acid engineering strain pHK/JM109 through shake flask fermentation among the present invention, the consumption variation diagram of cell concn, hyaluronic accumulation and substrate after fermentation cylinder for fermentation.Showed cell concentration is greatly improved among the figure, OD ₆₀₀Can reach 25-30, HA content obtains 2-2.5g/L, has put forward synthesis capability greatly, for condition has been prepared in large-scale production.

Embodiment

Embodiment 1

Hyaluronic shake-flask culture is synthetic among the pHK/JM109:

In the 500ml triangular flask, contain 50 mM K with cumulative volume 100ml ₂HPO ₄3H ₂O, (pH7.0) 4mM g/L MgSO47H2O, the 20mM/L citric acid, 1mM MnCl2,300mM glucose 50 mM nitrogen acetylglucosamines (GlcNAc), 10mM lactose, 10g/L glycerine, 5g/LCasamino acid(casamino acids) system in add and express PmHasWith KfiThe pHK/JM109 of D makes somatic cells concentration reach 5%(W/V), fermentation condition is 30 ℃, 250rpm, and use 28%(V/V) ammoniacal liquor regulate pH to neutral, the fermentation reaction time is 36 hours.HA content can reach 0.75-1 g/L left and right sides (see figure 2) after measured.

Embodiment 2

In the 2500l triangular flask, contain 25 mM K with cumulative volume 500ml ₂HPO ₄3H ₂O, (pH6.5) 2mM g/L MgSO47H2O, 40mM/L citric acid, 2mM MnCl2,400mM glucose 75 mM nitrogen acetylglucosamines (GlcNAc) add in the system of 5mM lactose, 30g/L glycerine, 3g/L casamino acids (Casamino acid) and express PmHasWith KfiThe pHK/JM109 of D makes somatic cells concentration reach 4%(W/V), fermentation condition is 33 ℃, 250rpm, and use 28%(V/V) ammoniacal liquor regulate pH to neutral, the fermentation reaction time is 30 hours.

HA content can reach about 0.7-8.5 g/L after measured.Because of the synthetic aerobic of HA and than stable p H, for further improving the output of engineering bacteria, the present invention has carried out fermentor tank HA synthetic and has cultivated.

Embodiment 3

Hyaluronic fermentor cultivation is synthetic among the pHK/JM109:

Provoke 3-5 the single bacterium colony of the pHK/JM109 through line and incubated overnight from the LB flat board of Amp100ug/ml+Km100 ug/ml, place 100ml TB substratum (Terrific Broth): 12 g/L tryptones (Tryptone), 24 g/L yeast extracts (Yeast extract), 9.4 g/L K ₂HPO ₄With 2.2 g/L KH ₂PO ₄(pH6.8), incubated overnight.This culture is through centrifugal collection thalline, and thalline suspends with 20ml TB, all changes the fermentor tank (Bioreactor, BIOSTAT Bplus Sartoris BBI system Germany product) of 1L over to.Fermentation tank culture medium is that TB contains penbritin (Amp) 100ug/ml+ kantlex (Km) 100 ug/ml, and cumulative volume is 600ml.37 ℃ of controlled temperature, rotating speed 1200rpm feeds flow and is the mixed gas (oxygen: air 1:10 v/v) of 60ml/min, and regulates pH to 6.8 automatically with 28% ammoniacal liquor and 4 mol/L HCl.Cultivated about 4 hours, as culture OD ₆₀₀Reach at 5 o'clock, adding IPTG makes its final concentration reach 1mM, simultaneously temperature of reaction is adjusted to 30 ℃ and cultivates 2 hours to induce the expression of pmHas and kfiD, add 50%(W/V this moment) glucose and 10%(W/V) ammonium phosphate (pH6.8) makes that glucose and ammonium phosphate content are respectively 50g/L and 1g/L in the fermented liquid, cultivate after 10 hours for 30 ℃, adding IPTG, glucose and ammonium phosphate once more makes its concentration be respectively 0.5mM, 50g/L and 1g/L, mixed solution is cultivated after 14 hours for 30 ℃, finish totally 30 hours fermentation reactions, obtain on average to be about 2-3 g/L HA.

Embodiment 4

Hyaluronic fermentor cultivation is synthetic among the pHK/JM109:

Provoke 3-5 the single bacterium colony of the pHK/JM109 through line and incubated overnight from the LB flat board of Amp50ug/ml+Km25 ug/ml, place 100ml TB substratum (Terrific Broth): 12 g/L tryptones (Tryptone), 24 g/L yeast extracts (Yeast extract), 9.4 g/L K ₂HPO ₄With 2.2 g/L KH ₂PO ₄(pH6.8), incubated overnight.This culture is through centrifugal collection thalline, and thalline suspends with 50ml TB, all changes the fermentor tank (Bioreactor, BIOSTAT Bplus Sartoris BBI system Germany product) of 5L over to.Fermentation tank culture medium is that TB contains penbritin (Amp) 50ug/ml+ kantlex (Km) 25 ug/ml, and cumulative volume is 3000ml.37 ℃ of controlled temperature, rotating speed 1200rpm feeds flow and is the mixed gas (oxygen: air 1:10 v/v) of 300ml/min, and regulates pH to 7.2 automatically with 28% ammoniacal liquor and 4 mol/L HCl.Cultivated about 4 hours, as culture OD ₆₀₀Reach at 5 o'clock, add IPTG and make its final concentration reach 1mM, simultaneously temperature of reaction is adjusted to 33 ℃ and cultivates 2 hours to induce PmHasWith KfiDExpression, add 50%(W/V this moment) glucose and 10%(W/V) ammonium phosphate (pH6.8), make that glucose and ammonium phosphate content are respectively 50g/L and 1g/L in the fermented liquid, cultivate after 10 hours for 30 ℃, adding IPTG, glucose and ammonium phosphate once more makes its concentration be respectively 0.5mM, 50g/L and 1g/L, mixed solution is cultivated after 14 hours for 30 ℃, finishes totally 30 hours fermentation reactions, obtains on average to be about 2-3 g/L HA.

From Fig. 4 as seen, carry out the production of HA in fermentor tank, cell concn is greatly improved, OD ₆₀₀Can reach 25-30, HA content obtains 2-2.5g/L, has put forward synthesis capability greatly, for condition has been prepared in large-scale production.

Hyaluronic extraction with separate:

The reaction mixture of above-mentioned fermentative production adds the dehydrated alcohol of 1/10 volume, 20% hexadecyl bromination ethamine (Cetyl Trimethyl Ammonium Bromide CTAB) and 2 times of volumes, places 10min behind the mixing.Got precipitation in centrifugal 10 minutes with 14000rpm.(too high because of hyaluronic acid contents sometimes, solution is divided into three layers of (see figure 3), and hyaluronic acid is difficult for precipitation, can suitably dilute initial reaction mixture in this case).Precipitation is used 1 times of volume once more, and the sodium-chlor of 1M suspends at 42 ℃ and extracted about 2 hours, the centrifugal collection supernatant liquor of 12000rpm, and after corresponding precipitation is used the resuspended 10min of the sodium-chlor of 1/10 volume 1M once more, resuspended mixing recentrifuge, supernatant solution abandons precipitation after merging.The supernatant solution that merges adds 2.5 times dehydrated alcohol, and mixing was placed 5 minutes, and centrifuging and taking precipitation, precipitation be with after 70% washing with alcohol, drying or heavily be dissolved in the 1M NaCl solution and be used for HA content and molecular weight determination.

The observation of thalli morphology behind the synthetic hyaluronic acid of pHK/JM109:

In HA synthetic reaction system, get about 2 μ l mixtures, place and allow liquid air-dry on the slide glass, air-dry bacterium is with 5 minutes (polychromatophilia reagent of 0.1% polychromatophilia reagent dyeing, Stains all is the Sigma product, http://www.sigmaaldrich.com) this dye liquor solvent (methane amide: Virahol, v/v7:3) preparation.The unnecessary fuel in dyeing back with distilled water flushing after, directly the micro-sight of 1000X is looked into and is collected pictures with CCD.See the metamorphosis of looking into the synthetic back of hyaluronic acid bacterial cell for further improving resolving power, the pHK/JM109 cell is directly observed with environmental scanning electronic microscope (ESEM) in the reaction system.Found that HA synthetic causes the coli somatic overstriking, terminal color depth, the sticking connection of thalline (Fig. 4).Control cells under ESEM (pBQ/JM109) smoother, HA synthetic cell (pHK/JM109) then surface irregularity (see figure 4) and thalline two ends have tangible material to pile up, and illustrate that cell has synthesized HA, and accumulate on the thalline surface.Color depth from the bacterium two ends that observe, infer that two ends may be the main site (see figure 1)s of the active secretion of thalline HA.

Hyaluronic enzymatic degradation is identified:

For further confirming that the said extracted thing is a hyaluronic acid really, utilize Sigma company from separate the hyaluronic acid streptomycete ( Streptomyces hyalurolyticus) middle purifying, the energy hyaluronic Unidasa of single-minded hydrolysis (Sigma product article No.: H 1136) is hydrolyzed, and carries out Analysis and Identification with the ion-exchange type HPLC of Dai An company (Dionex BioLC).With 250mU enzyme/mgHA ratio, 37 ℃ of hydrolysis totally 10 hours, being hydrolyzed respectively at sampling in 0,2.5,5 and 10 hour, the generation of hyaluronic acid 4 oligosaccharides detects in the mixture.The detailed process that ion-exchange type HPLC analyzes is, the enzymolysis biased sample is through 100 ℃, 5min termination reaction, mixture is centrifugal through 13000rpm, 0.2uM strainer filter after, the last Dionex BioLC (Sunnyvale of system, CA, the U.S.) analyze, this system separates with CarboPac PA20 post, electrochemical detector (Dionex ED50 electrochemical detector) carries out signal monitoring, the concrete ginseng of this detector is set to (waveform:t=0.41 sec, p=-2.00 V; T=0.42 sec, p=-2.00 V; T=0.43 sec, p=0.60 V; T=0.44 sec, p=-0.10 V; T=0.50 sec, p=-0.10 V). use the oligosaccharides of buying from Sigma company in the analytic process, Oligo-HA4, (production number: O9140-5MG) identify (appearance time of Dionex BioLC systems analysis is about 15min) for standard substance.Mobile of chromatography is A solution (the 200 mM NaOH that the degassing is handled, B solution (degassing is handled and contained 200 mM NaOH and 1M NaCl), flow velocity is 0.5 ml/min, A liquid and B liquid are all inflated with rare gas element helium in The whole analytical process, and separately proportionlity changes as follows in the gradient elution process: t=0 min, 5:95 (A liquid: B liquid, down together); T=5 min, 5:95; T=10 min, 20:80; T=20 min, 20:80; T=21 min, 100:0; T=30 min, 100:0; T=35 min, 5:95; T=50 min.As shown in Table 1, institute's extract mass-energy is by single-minded degraded hyaluronic acid, derive from separate the hyaluronic acid streptomycete ( Streptomyces hyalurolyticus) Unidasa degrade.Thereby conclusive evidence pmHas and kfiD efficiently express in intestinal bacteria, make the e. coli jm109 bacterial strain that can not synthesize HA under the natural condition change the synthetic bacterial strain of HA.

The mensuration of hyaluronic acid contents:

Conventional hyaluronic analytical procedure is with people such as Bitter (Bitter T et al, A modified uronic acid carbazole reaction .Anal. Biochem. 1,962 4,330 – 334.) carbazole (carbazole) analytical procedure.Hyaluronic content is by its hydrolysate in this method, glucuronic acid (glucuronic acid), content calculate.Learn from else's experience sample 1 mL of different dilutions of detailed process.In ice-water bath, add the 6 mL vitriol oils, after shaking up, be put in and keep 20 min in 85 ℃ of water-baths, take out to place then and be chilled to room temperature on ice, add 0.2 mL carbazole liquid (50 mg carbazoles are dissolved in 50 mL, 95% ethanol), after placing 100 ℃ of water-baths to keep 10 min, taking-up places and is chilled to room temperature on ice, measures the absorption of 530 nm. and typical curve is made of sigma company glucuronic acid standard model.Above-mentioned conventional determining method is proofreaied and correct by the immune analysis method of hyaluronic acid binding protein.Concrete hyaluronic acid radioimmunoassay kit (the Beijing North biotechnology research institute product that adopts, http://www.bnibt.com,) analyze, this assay kit adopts competition radio immunoassay, promptly HA in standard or the testing sample and 125I-HA common with the hyaluronic acid binding protein (HABP) of limiting the quantity of being at war with property association reaction under suitable condition.Part 125I-HA combines with HABP and forms mixture, and another part is unbound state.125I-HA and HABP bonded ratio depend on the content of non-marked HA in standard or the testing sample, and the content of non-marked HA is high more, and the mixture that 125I-HA and HABP form is few more.HA-HABP mixture and HABP antibody and second antibody form crosslinked polymer precipitation gets off, and measures sedimentary radiocounting.Can obtain typical curve and regression equation through after the data processing, find the HA content of sample from typical curve.After proofreading and correct, begin to carry out routine analysis with carbazole (carbazole) analytical procedure.Analytical results show that the shake flask fermentation hyaluronic acid concentration can reach 05g/L and in fermentor tank or the bio-reactor fermentation can make concentration reach 2.5g/L.

Hyaluronan molecule amount Determination of distribution:

For carrying out the mensuration of HA molecular weight distribution, above-mentioned hyaluronic extraction with separate, be dissolved in the 1M Hyaluronic acid sodium salt, add 1/10 volume 3M acetate and receive (pH5.5), equal-volume phenol: (after (1:1v/v) extracting once, water adds 2.5 times of ethanol sedimentation hyaluronic acids to chloroform, after throw out heavily is dissolved among 0.5M acetate and the 0.3 M Na2SO4, ((ASEC, aqueous size exclusion chromatography) method is measured the molecular weight of HA with the water gel exclusion chromatography.Concrete analysis is to carry out in island crystalline substance (Shimadzu) HPLC system; with Viscotek TSK Viscogel PWXL guard column; G3000, G4000 and G6000 connect altogether as analytical column, with RID-10A RI-detector (refractive Index detector) detection signal.The moving phase of chromatography consists of 0.5M acetate and 0.3 M Na2SO4, it is for want of known that flow velocity is controlled to be 0.6 mL/min. by island brilliant LC-20AD solvent transfer system, the hyaluronic acid standard molecule of different molecular weight, with buying from sigma company, (concrete Dextran is respectively a production number 31389 to the dextran of 40-2000kD, Mw～40,000 (Sigma), production number 31390 Mw～70,000 (Sigma), production number 09184, Mw～100,000 (Fluka) and production number 95771 Mw～2,000,000 (Sigma)) for after standard molecular weight comes the production standard curve, and with the known hyaluronic acid of molecular weight (Select-HA Hyaluronan 150K, mol wt 125-175 kDa, sigma production number S0201-1MG) proofread and correct after, estimate the hyaluronic molecular weight ranges that engineering colon bacillus of the present invention is produced.Analytical results shows that the hyaluronic acid molecular-weight average of engineering colon bacillus production of the present invention is between 130-150kD, but with respect to Sigma company hyaluronic acid, the about 4-4.5 of the hyaluronic molecular distribution scope of engineering colon bacillus synthetic of the present invention (Mw/Mn) sees Table 2 greater than Sigma standard transparent matter acid 2.9().

Remarks: the * commercialization is from HA sigma, Mw: polymeric molecular-weight average (weight average of polymer), Mn: polymeric mean number (number average of polymer), Mw/Mn: the molecular distribution scope of polymer.

More than show, in intestinal bacteria,, on express cell, accumulated HA and caused the change of surface structure by expressing hyaluronic acid synthetase pmHas and guanosine diphosphate(GDP) dehydrogenase gene kfiD; Engineering bacteria fermentation culture in common triangular flask can obtain about 1g/L HA content, with the fermentor cultivation of optimizing, put forward synthesis capability greatly, can obtain 2-2.5g/L HA content, produced the hyaluronic acid ability and obviously be better than the synthetic hyaluronic colibacillus engineering strain of report in the past.

Above-described efficient product hyaluronic acid engineering colon bacillus (pHK/JM109) prepares by the following method:

(1) make up the expression vector pQEpmHas contain hyaluronan synthase gene, with the pcr amplification method clone be derived from Pasteurella multocida ( Pasteurella multocidaSubsp. Multocida) in hyaluronan synthase gene ( PAsteurella mUltocida hYaluronic aCid synthase PmHas), the design of its pcr amplification clone the primer is as follows:

Upstream primer pmHas P1 is 5'-TA GGATCC ATGAACACATTATCACAAGCAAT-3', (SEQ ID No:3 in the sequence table) contains BamH I site GGATCC and initiator codon ATG;

Downstream primer is PmHasP2 is 5'-TA GAGCTC TTASEQ ID No:4 in the TAGAGTTATACTATTAATAAT-3'(sequence table), contain SacI site GAGCTC and terminator codon TAA;

The masterplate of PCR is the genomic dna of Pasteurella multocida strains A TCC 15742, the amplified production warp BamH I and SacBehind the I double digestion, connect into the identical restriction enzyme site among the commercial carrier pQE80L, insert fragment after DNA order-checking conclusive evidence does not have sudden change, with obtaining carrier called after pQEpmHas, gene is PmHas(SEQ ID No:1 in the sequence table)

(2) make up the expression vector pQEkfiD contain the uridine diphosphoglucose dehydrogenase gene, with the pcr amplification method clone be derived from come from intestinal bacteria ( Escherichia coli, E.coli) bacterial strain k5( E. coliK5) GDPG dehydrogenase gene (K in ₅Capsule gene D, KfiD), the design of primers of amplification is as follows:

Upstream primer KfiD P1:5'-TGG AGATCT ATGSEQ ID No:5 in the TTCGGAACACTAAAAATAACT G-3'(sequence table), contain Bgl II site AGATCT and initiator codon ATG);

Downstream primer KfiD P2:5'-TT CTCGAG TTASEQ ID No:6 in the GTCACATTTAAA CAAATCGCGAC-3'(sequence table), contain XhoI site CTCGAG and terminator codon TAA;

The masterplate of PCR is the genomic dna of intestinal bacteria bacterium k5 strains A TCC 23500, the also product of purifying that successfully increases, warp BglII and XhoBehind the I double digestion, connect into the commercial carrier pQE80L's of Qiagen company BamH I and SalI site, gained carrier after DNA sequencing analysis conclusive evidence is inserted fragment and is not had sudden change, the carrier called after pQEkfiD that obtains, corresponding gene called after KfiD gene (SEQ ID No:2 in the sequence table);

(3) make up co expression hyaluronan synthase gene and the recombinant vectors that contains the uridine diphosphoglucose dehydrogenase gene in the intestinal bacteria:

According to the DNA sequences Design PCR primer of the pQEkfiD carrier that builds, amplification T5 promoters driven KfiThe fragment T5:kfiD that D expresses, concrete primer sequence design is as follows:

Upstream primer T5kfiD P1:5'-TA GAGCTCCCTTTCGTCTTCAC _GSEQ ID No:7 in the TCGAGA-3'(sequence table), this primer contains SacThe I site, GAGCTC, wherein subscript G represents C in the original pQE80L carrier is sported G, to eliminate it XhoThe l site, CTCGAG;

Downstream primer T5kfiD P2:5'-TA CTCGAGSEQ ID No:8 in the TTCTGAGGTCATTACTGGATCT-3'(sequence table), this primer contains XhoI site, CTCGAG;

The masterplate of PCR pQEkfiD carrier, the T5:kfiD amplified production of purifying, at first connect into the pGEM-T-Vector(Promega product, www.promega.com) and transformed into escherichia coli JM109 bacterial strain, obtain intermediate carrier pT-T5KfiD, SEQ ID No:9 in the T5:kfiD(sequence table in this carrier) fragment, after sequencing analysis confirmed that nucleotide sequence does not have sudden change, this inserted T5:kfiD(fragment warp SacI and XhoBehind the I double digestion, connect into expression vector pQEpmHas's SacI and SalI site and obtaining PmHasWith KfiThe recombinant vectors pQHK of D gene coexpression in intestinal bacteria;

(4) structure of pHK

Dna sequence dna (GenBank No. Y14439) design primer according to the Gram-negative bacteria host wide spectrum plasmid pBBR122 of German MoBiTec company:

Upstream primer PBBR P1:5'-TTTGGT GTCGACSEQ ID NO:10 in the CTTGCCAGCCCGTGGATATGTGG-3'(sequence table); Contain SalThe I restriction enzyme site, GTCGAC

Downstream primer PBBR P1:5'-TTAGGT GTCGACSEQ ID NO:11 in the TCTGTGATGGCTTCCATGTCGGCAG-3'(sequence table), contain SalThe I restriction enzyme site, GTCGAC);

With comprising its replication site and kalamycin resistance gene among the above-mentioned primer amplification plasmid pBBR122 in interior fragment, the parameter of PCR amplification is: 95 ℃, 2 min, 1 circulation; 94 ℃, 30s, 55 ℃, 30s, 72 ℃, 3 min, 25 circulations; 72 ℃, 1 circulation of 10 min, the about 3.2 kb amplified productions of purifying are used SalBehind the I enzymolysis, add ligase enzyme and connect certainly, self connect product transformed into escherichia coli JM109 bacterial strain by it, and obtain plasmid pRP (SEQ ID NO:12 in the sequence table) with kantlex screening, extract plasmid pRP, behind the SalI enzymolysis, connect into above-mentioned can be in intestinal bacteria coexpression pmHas and KfiThe pQHK's of D gene XhoThe I site, and obtain coexpression in Gram-negative bacteria PmHasWith KfiD synthesizes hyaluronic expression vector pHK;

(5) this recombinant vectors pHK is changed over to the hyaluronic engineering colon bacillus pHK/JM109(CGMCC of the described efficient product of acquisition NO:3926 in the e. coli jm109).

Above-described coli strain pHK/JM109 is the efficient hyaluronic acid engineering colon bacillus that produces, and wherein pHK is an expression vector, and its host strain is E.coliJM109.

Dna sequence dna explanation involved in the present invention:

In the sequence table shown in the SEQ ID NO:1 be derived from Pasteurella multocida ( Pasteurella multocidaSubsp. MultocidaIn hyaluronan synthase gene PmHasThe coding region nucleotide sequence.

In the sequence table shown in the SEQ ID NO:2 is to be derived from intestinal bacteria k5 bacterial strain (middle GDPG dehydrogenase gene KfiDThe coding region nucleotide sequence.

In the sequence table shown in the SEQ ID NO:3 be clone be derived from Pasteurella multocida ( Pasteurella multocidaSubsp. Multocida) in hyaluronan synthase gene PmHasThe base sequence of upstream primer.

In the sequence table shown in the SEQ ID NO:4 be clone be derived from Pasteurella multocida ( Pasteurella multocidaSubsp. Multocida) in hyaluronan synthase gene PmHasThe base sequence of downstream primer.

In the sequence table shown in the SEQ ID NO:5 is that the clone comes from GDPG dehydrogenase gene in the intestinal bacteria k5 bacterial strain KfiThe base sequence of the upstream primer of D.

In the sequence table shown in the SEQ ID NO:6 is that the clone comes from GDPG dehydrogenase gene in the intestinal bacteria k5 bacterial strain KfiThe base sequence of the downstream primer of D.

In the sequence table shown in the SEQ ID NO:7 is the base sequence of the segmental upstream primer of clone T5:kfiD.

In the sequence table shown in the SEQ ID NO:8 is the base sequence of the segmental downstream primer of clone T5:kfiD.

In the sequence table shown in the SEQ ID NO:9 is the segmental nucleotide sequence of T5:kfiD.

In the sequence table shown in the SEQ ID NO:10 is clone's PBRR122 kalamycin resistance gene and the base sequence that duplicates essential segmental upstream primer.

In the sequence table shown in the SEQ ID NO:11 is clone's PBRR122 kalamycin resistance gene and the base sequence that duplicates essential segmental downstream primer.

In the sequence table shown in the SEQ ID NO:12 is the nucleotide sequence of plasmid pRP.

The genetic resources that the present invention relates to:

1: kill Bath DS strains A TCC15742(Pasteurella multocida subsp. multocida (Lehmann and Neumann) Rosenbusch and Merchant) more; Genetic resources is taken from: U.S.'s typical case's culture is preserved center (ATCC); Obtain manner: buy price 225 U.S. dollars; Acquisition time: in January, 2008; Primary source: U.S. scientist KL Heddleston separates acquisition time from the turkey heart: in April, 1962

2: intestinal bacteria K5 strains A TCC23500( Escherichia coli(Migula) Castellani and Chalmers, serotype O2a, 2b:K5 (L): H4; Genetic resources is taken from: U.S.'s typical case's culture is preserved center (ATCC) obtain manner: buy, price 225 U.S. dollars, acquisition time: in September, 2008 primary source: the Center for Disease Control (CDC) scientist Kauffmann separates from people urine, and acquisition time: July nineteen forty-three.

Sequence table

SEQUENCE LISTING

＜110〉Yunnan Province's microbial fermentation engineering research centre company limited

＜120〉efficiently produce the hyaluronic acid engineering colon bacillus

<130> /

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 2919

<212> DNA

<213> Pasteurella multocida subsp. Multocida(ATCC15742)

<400> 1

atgaatacat tatcacaagc aataaaagca tataacagca atgactatca attagcactc 60

aaattatttg aaaagtcggc ggaaatctat ggacggaaaa ttgttgaatt tcaaattacc 120

aaatgcaaag aaaaactctc agcacatcct tctgttaatt cagcacatct ttctgtaaat 180

aaagaagaaa aagtcaatgt ttgcgatagt ccgttagata ttgcaacaca actgttactt 240

tccaacgtaa aaaaattagt actttctgac tcggaaaaaa acacgttaaa aaataaatgg 300

aaattgctca ctgagaagaa atctgaaaat gcggaggtaa gagcggtcgc ccttgtacca 360

aaagattttc ccaaagatct ggttttagcg cctttacctg atcatgttaa tgattttaca 420

tggtacaaaa agcgaaagaa aagacttggc ataaaacctg aacatcaaca tgttggtctt 480

tctattatcg ttacaacatt caatcgacca gcaattttat cgattacatt agcctgttta 540

gtaaaccaaa aaacacatta cccgtttgaa gttatcgtga cagatgatgg tagtcaggaa 600

gatctatcac cgatcattcg ccaatatgaa aataaattgg atattcgcta cgtcagacaa 660

aaagataacg gttttcaagc cagtgccgct cggaatatgg gattacgctt agcaaaatat 720

gactttattg gcttactcga ctgtgatatg gcgccaaatc cattatgggt tcattcttat 780

gttgcagagc tattagaaga tgatgattta acaatcattg gtccaagaaa atacatcgat 840

acacaacata ttgacccaaa agacttctta aataacgcga gtttgcttga atcattacca 900

gaagtgaaaa ccaataatag tgttgccgca aaaggggaag gaacagtttc tctggattgg 960

cgcttagaac aattcgaaaa aacagaaaat ctccgcttat ccgattcgcc tttccgtttt 1020

tttgcggcgg gtaatgttgc tttcgctaaa aaatggctaa ataaatccgg tttctttgat 1080

gaggaattta atcactgggg tggagaagat gtggaatttg gatatcgctt attccgttac 1140

ggtagtttct ttaaaactat tgatggcatt atggcctacc atcaagagcc accaggtaaa 1200

gaaaatgaaa ccgatcgtga agcgggaaaa aatattacgc tcgatattat gagagaaaag 1260

gtcccttata tctatagaaa acttttacca atagaagatt cgcatatcaa tagagtacct 1320

ttagtttcaa tttatatccc agcttataac tgtgcaaact atattcaacg ttgcgtagat 1380

agtgcactga atcagactgt tgttgatctc gaggtttgta tttgtaacga tggttcaaca 1440

gataatacct tagaagtgat caataagctt tatggtaata atcctagggt acgcatcatg 1500

tctaaaccaa atggcggaat agcctcagca tcaaatgcag ccgtttcttt tgctaaaggt 1560

tattacattg ggcagttaga ttcagatgat tatcttgagc ctgatgcagt tgaactgtgt 1620

ttaaaagaat ttttaaaaga taaaacgcta gcttgtgttt ataccactaa tagaaacgtc 1680

aatccggatg gtagcttaat cgctaatggt tacaattggc cagaattttc acgagaaaaa 1740

ctcacaacgg ctatgattgc tcaccacttt agaatgttca cgattagagc ttggcattta 1800

actgatggat tcaatgaaaa aattgaaaat gccgtagact atgacatgtt cctcaaactc 1860

agtgaagttg gaaaatttaa acatcttaat aaaatctgct ataaccgtgt attacatggt 1920

gataacacat caattaagaa acttggcatt caaaagaaaa accattttgt tgtagtcaat 1980

cagtcattaa atagacaagg cataacttat tataattatg acgaatttga tgatttagat 2040

gaaagtagaa agtatatttt caataaaacc gctgaatatc aagaagagat tgatatctta 2100

aaagatatta aaatcatcca gaataaagat gccaaaatcg cagtcagtat tttttatccc 2160

aatacattaa acggcttagt gaaaaaacta aacaatatta ttgaatataa taaaaatata 2220

ttcgttattg ttctacatgt tgataagaat catcttacac cagatatcaa aaaagaaata 2280

ctagccttct atcataaaca tcaagtgaat attttactaa ataatgatat ctcatattac 2340

acgagtaata gattaataaa aactgaggcg catttaagta atattaataa attaagtcag 2400

ttaaatctaa attgtgaata catcattttt gataatcatg acagcctatt cgttaaaaat 2460

gacagctatg cttatatgaa aaaatatgat gtcggcatga atttctcagc attaacacat 2520

gattggatcg agaaaatcaa tgcgcatcca ccatttaaaa agctcattaa aacttatttt 2580

aatgacaatg acttaaaaag tatgaatgtg aaaggggcat cacaaggtat gtttatgacg 2640

tatgcgctag cgcatgagct tctgacgatt attaaagaag tcatcacatc ttgccagtca 2700

attgatagtg tgccagaata taacactgag gatatttggt tccaatttgc acttttaatc 2760

ttagaaaaga aaaccggcca tgtatttaat aaaacatcga ccctgactta tatgccttgg 2820

gaacgaaaat tacaatggac aaatgaacaa attgaaagtg caaaaagagg agaaaatata 2880

cctgttaaca agttcattat taatagtata actctataa 2919

<210> 2

<211> 1179

<212> DNA

<213> Escherichia coli K5(ATCC23500)

<400> 2

atgttcggaa cactaaaaat aactgtttca ggcgctggtt acgttgggct ttcaaatgga 60

attctaatgg ctcaaaatca tgaagtggtt gcatttgata cccatcaaaa aaaagttgac 120

ttacttaatg ataaactctc tcctatagag gataaggaaa ttgaaaatta tctttcaact 180

aaaatactta attttcgcgc aactactaac aaatatgaag cctataaaaa tgccaattac 240

gttattattg ctacaccaac gaattatgac ccaggttcaa attactttga tacatcaagc 300

gttgaagctg tcattcgtga cgtaacggaa atcaacccaa acgcaattat ggtggttaaa 360

tctacggtcc cagtaggttt cacaaaaaca attaaagaac atttaggtat taataatatt 420

atcttctctc cagaattttt acgagaagga agagccctat acgataatct ccatccatct 480

cgcattatta tcggtgaatg ttctgaacgg gcagaacgtt tggcagtgtt atttcaggaa 540

ggagcgatta aacaaaatat acccgtttta tttacagatt ctacggaagc ggaagcgatt 600

aagttatttt caaatactta tttggctatg cgagttgcat tttttaatga attggatagt 660

tacgcagaaa gttttggtct gaatacgcgt cagattattg acggtgtttg tttggatccg 720

cgcattggta attactacaa taatccttct tttggttatg gtggctactg tttgccaaaa 780

gataccaagc aattattagc caactatcag tctgttccga ataaacttat atctgcaatt 840

gttgatgcta accgtacacg taaggacttt atcactaatg ttattttgaa acatagacca 900

caagttgtgg gggtttatcg tttgattatg aaaagtggtt cagataattt tagagattct 960

tctattcttg gtattataaa gcgtatcaag aaaaaaggcg tgaaagtaat tatttatgag 1020

ccgcttattt ctggagatac attctttaac tcacctttgg aacgggagct ggcgatcttt 1080

aaagggaaag ctgatattat tatcactaac cgaatgtcag aggagttgaa cgatgtggtc 1140

gacaaagtct atagtcgcga tttgtttaaa tgtgactaa 1179

<210> 3

<211> 31

<212> DNA

＜213〉artificial-synthetic DNA

<400> 3

taggatccat gaacacatta tcacaagcaa t 31

<210> 4

<211> 32

<212> DNA

＜213〉artificial-synthetic DNA

<400> 4

tagagctctt atagagttat actattaata at 32

<210> 5

<211> 34

<212> DNA

＜213〉artificial-synthetic DNA

<400> 5

tggagatcta tgttcggaac actaaaaata actg 34

<210> 6

<211> 34

<212> DNA

＜213〉artificial-synthetic DNA

<400> 6

ttctcgagtt agtcacattt aaacaaatcg cgac 34

<210> 7

<211> 29

<212> DNA

＜213〉artificial-synthetic DNA

<400> 7

tagagctccc tttcgtcttc acgtcgaga 29

<210> 8

<211> 30

<212> DNA

＜213〉artificial-synthetic DNA

<400> 8

tactcgagtt ctgaggtcat tactggatct 30

<210> 9

<211> 1423

<212> DNA

＜213〉engineering makes up fragment

<400> 9

tagagctccc tttcgtcttc acgtcgagaa atcataaaaa atttatttgc tttgtgagcg 60

gataacaatt ataatagatt caattgtgag cggataacaa tttcacacag aattcattaa 120

agaggagaaa ttaactatga gaggatcgca tcaccatcac catcacggat ctatgttcgg 180

aacactaaaa ataactgttt caggcgctgg ttacgttggg ctttcaaatg gaattctaat 240

ggctcaaaat catgaagtgg ttgcatttga tacccatcaa aaaaaagttg acttacttaa 300

tgataaactc tctcctatag aggataagga aattgaaaat tatctttcaa ctaaaatact 360

taattttcgc gcaactacta acaaatatga agcctataaa aatgccaatt acgttattat 420

tgctacacca acgaattatg acccaggttc aaattacttt gatacatcaa gcgttgaagc 480

tgtcattcgt gacgtaacgg aaatcaaccc aaacgcaatt atggtggtta aatctacggt 540

cccagtaggt ttcacaaaaa caattaaaga acatttaggt attaataata ttatcttctc 600

tccagaattt ttacgagaag gaagagccct atacgataat ctccatccat ctcgcattat 660

tatcggtgaa tgttctgaac gggcagaacg tttggcagtg ttatttcagg aaggagcgat 720

taaacaaaat atacccgttt tatttacaga ttctacggaa gcggaagcga ttaagttatt 780

ttcaaatact tatttggcta tgcgagttgc attttttaat gaattggata gttacgcaga 840

aagttttggt ctgaatacgc gtcagattat tgacggtgtt tgtttggatc cgcgcattgg 900

taattactac aataatcctt cttttggtta tggtggctac tgtttgccaa aagataccaa 960

gcaattatta gccaactatc agtctgttcc gaataaactt atatctgcaa ttgttgatgc 1020

taaccgtaca cgtaaggact ttatcactaa tgttattttg aaacatagac cacaagttgt 1080

gggggtttat cgtttgatta tgaaaagtgg ttcagataat tttagagatt cttctattct 1140

tggtattata aagcgtatca agaaaaaagg cgtgaaagta attatttatg agccgcttat 1200

ttctggagat acattcttta actcaccttt ggaacgggag ctggcgatct ttaaagggaa 1260

agctgatatt attatcacta accgaatgtc agaggagttg aacgatgtgg tcgacaaagt 1320

ctatagtcgc gatttgttta aatgtgacta actcgaccca agcttaatta gctgagcttg 1380

gactcctgtt gatagatcca gtaatgacct cagaactcga gta 1423

<210> 10

<211> 33

<212> DNA

＜213〉artificial-synthetic DNA

<400> 10

tggtgtcgac cttgccagcc cgtggatatg tgg 33

<210> 11

<211> 35

<212> DNA

＜213〉artificial-synthetic DNA

<400> 11

aggtgtcgac tctgtgatgg cttccatgtc ggcag 35

<210> 12

<211> 3266

<212> DNA

<213> pBBR122

<400> 12

gtcgaccttg ccagcccgtg gatatgtgga cgatggccgc gagcggccac cggctggctc 60

gcttcgctcg gcccgtggac aaccctgctg gacaagctga tggacaggct gcgcctgccc 120

acgagcttga ccacagggat tgcccaccgg ctacccagcc ttcgaccaca tacccaccgg 180

ctccaactgc gcggcctgcg gccttgcccc atcaattttt ttaattttct ctggggaaaa 240

gcctccggcc tgcggcctgc gcgcttcgct tgccggttgg acaccaagtg gaaggcgggt 300

caaggctcgc gcagcgaccg cgcagcggct tggccttgac gcgcctggaa cgacccaagc 360

ctatgcgagt gggggcagtc gaaggcgaag cccgcccgcc tgccccccga gacctgcagg 420

gggggggggg cgctgaggtc tgcctcgtga agaaggtgtt gctgactcat accaggcctg 480

aatcgcccca tcatccagcc agaaagtgag ggagccacgg ttgatgagag ctttgttgta 540

ggtggaccag ttggtgattt tgaacttttg ctttgccacg gaacggtctg cgttgtcggg 600

aagatgcgtg atctgatcct tcaactcagc aaaagttcga tttattcaac aaagccgccg 660

tcccgtcaag tcagcgtaat gctctgccag tgttacaacc aattaaccaa ttctgattag 720

aaaaactcat cgagcatcaa atgaaactgc aatttattca tatcaggatt atcaatacca 780

tatttttgaa aaagccgttt ctgtaatgaa ggagaaaact caccgaggca gttccatagg 840

atggcaagat cctggtatcg gtctgcgatt ccgactcgtc caacatcaat acaacctatt 900

aatttcccct cgtcaaaaat aaggttatca agtgagaaat caccatgagt gacgactgaa 960

tccggtgaga atggcaaaag cttatgcatt tctttccaga cttgttcaac aggccagcca 1020

ttacgctcgt catcaaaatc actcgcatca accaaaccgt tattcattcg tgattgcgcc 1080

tgagcgagac gaaatacgcg atcgctgtta aaaggacaat tacaaacagg aatcgaatgc 1140

aaccggcgca ggaacactgc cagcgcatca acaatatttt cacctgaatc aggatattct 1200

tctaatacct ggaatgctgt tttcccgggg atcgcagtgg tgagtaacca tgcatcatca 1260

ggagtacgga taaaatgctt gatggtcgga agaggcataa attccgtcag ccagtttagt 1320

ctgaccatct catctgtaac atcattggca acgctacctt tgccatgttt cagaaacaac 1380

tctggcgcat cgggcttccc atacaatcga tagattgtcg cacctgattg cccgacatta 1440

tcgcgagccc atttataccc atataaatca gcatccatgt tggaatttaa tcgcggcctc 1500

gagcaagacg tttcccgttg aatatggctc ataacacccc ttgtattact gtttatgtaa 1560

gcagacagtt ttattgttca tgatgatata tttttatctt gtgcaatgta acatcagaga 1620

ttttgagaca caacgtggct ttcccccccc cccctgcagg tcccgagcct cacggcggcg 1680

agtgcggggg ttccaagggg gcagcgccac cttgggcaag gccgaaggcc gcgcagtcga 1740

tcaacaagcc ccggaggggc cactttttgc cggaggggga gccgcgccga aggcgtgggg 1800

gaaccccgca ggggtgccct tctttgggca ccaaagaact agatataggg cgaaatgcga 1860

aagacttaaa aatcaacaac ttaaaaaagg ggggtacgca acagctcatt gcggcacccc 1920

ccgcaatagc tcattgcgta ggttaaagaa aatctgtaat tgactgccac ttttacgcaa 1980

cgcataattg ttgtcgcgct gccgaaaagt tgcagctgat tgcgcatggt gccgcaaccg 2040

tgcggcaccc taccgcatgg agataagcat ggccacgcag tccagagaaa tcggcattca 2100

agccaagaac aagcccggtc actgggtgca aacggaacgc aaagcgcatg aggcgtgggc 2160

cgggcttatt gcgaggaaac ccacggcggc aatgctgctg catcacctcg tggcgcagat 2220

gggccaccag aacgccgtgg tggtcagcca gaagacactt tccaagctca tcggacgttc 2280

tttgcggacg gtccaatacg cagtcaagga cttggtggcc gagcgctgga tctccgtcgt 2340

gaagctcaac ggccccggca ccgtgtcggc ctacgtggtc aatgaccgcg tggcgtgggg 2400

ccagccccgc gaccagttgc gcctgtcggt gttcagtgcc gccgtggtgg ttgatcacga 2460

cgaccaggac gaatcgctgt tggggcatgg cgacctgcgc cgcatcccga ccctgtatcc 2520

gggcgagcag caactaccga ccggccccgg cgaggagccg cccagccagc ccggcattcc 2580

gggcatggaa ccagacctgc cagccttgac cgaaacggag gaatgggaac ggcgcgggca 2640

gcagcgcctg ccgatgcccg atgagccgtg ttttctggac gatggcgagc cgttggagcc 2700

gccgacacgg gtcacgctgc cgcgccggta gcacttgggt tgcgcagcaa cccgtaagtg 2760

cgctgttcca gactatcggc tgtagccgcc tcgccgccct ataccttgtc tgcctccccg 2820

cgttgcgtcg cggtgcatgg agccgggcca cctcgacctg aatggaagcc ggcggcacct 2880

cgctaacgga ttcaccgttt ttatcaggct ctgggaggca gaataaatga tcatatcgtc 2940

aattattacc tccacgggga gagcctgagc aaactggcct caggcatttg agaagcacac 3000

ggtcacactg cttccggtag tcaataaacc ggtaaaccag caatagacat aagcggctat 3060

ttaacgaccc tgccctgaac cgacgaccgg gtcgaatttg ctttcgaatt tctgccattc 3120

atccgcttat tatacttatt caggcgtagc accaggcgtt taagggcacc aataactgcc 3180

ttaaaaaaat tacgccccgc cctgccactc atcgcagtac tgttgtaatt cattaagcat 3240

tctgccgaca tggaagccat cacaga 3266

Claims (2)

1. hyaluronic preparation method is characterized in that producing with engineering colon bacillus pHK/JM109 that hyaluronic shake-flask culture is synthetic to be undertaken by following: in the 500ml-2500ml triangular flask, contain 25-50 mM K with cumulative volume 100ml-500ml ₂HPO ₄3H ₂O, pH6.5-7.2,2-4mM g/L MgSO47H2O, 20-40 mM/L citric acid, 1-2 mM MnCl ₂, 300-400 mM glucose 50-75 mM nitrogen acetylglucosamine adds in the system of 5-10 mM lactose, 10-30 g/L glycerine, 3-5g/L caseinic acid hydrolyzate (Casamino acid) and expresses PmHasWith KfiThe pHK/JM109 of D makes somatic cells concentration reach 4-5% W/V, and fermentation condition is 30-33 ℃, 250 rpm, and it is extremely neutral to regulate pH with the ammoniacal liquor of 28% V/V, the fermentation reaction time is 30-36 hour.

2. hyaluronic preparation method, it is characterized in that producing that hyaluronic fermentor cultivation is synthetic is undertaken by following: provoke 3-5 through the single bacterium colony of the pHK/JM109 of line and incubated overnight from the LB flat board of Amp50-100ug/ml+Km25-100ug/ml with engineering colon bacillus pHK/JM109, place 100ml TB substratum (Terrific Broth), incubated overnight; This culture is through centrifugal collection thalline, thalline suspends with 20-50ml TB, all changes the fermentor tank of 1-5L over to, and fermentation tank culture medium is the TB substratum and contains Amp50-100 ug/ml+Kmn25-100 ug/ml, cumulative volume is 600-3000 ml, 37 ℃ of controlled temperature, rotating speed 1200 rpm, feeding flow is the mixed gas of 60 ml/min, be oxygen: air 1:10 v/v, and, cultivated 4 hours, as culture OD with 28% V/V ammoniacal liquor and 4 mol/L HCl adjusting pH to 6.8-7.2 ₆₀₀Reach at 5 o'clock, adding IPTG makes its final concentration reach 0.5-1 mM, simultaneously temperature of reaction being adjusted to 30-33 ℃ cultivated 2 hours, add 50% W/V glucose and 10% W/V ammonium phosphate pH6.8 this moment, make that glucose and ammonium phosphate content are respectively 50 g/L and 1 g/L in the fermented liquid, cultivate after 10 hours for 30 ℃, adding IPTG, glucose and ammonium phosphate once more makes its concentration be respectively 0.5 mM, 50 g/L and 1 g/L, mixed solution is cultivated after 14-30 hour for 30 ℃ and is finished fermentation, obtains the hyaluronic acid of 2-3 g/L concentration.

Images