CN102154377A - Use of oxidoreductase or recombinase thereof and recombinant oxidoreductase - Google Patents

Use of oxidoreductase or recombinase thereof and recombinant oxidoreductase Download PDF

Info

Publication number
CN102154377A
CN102154377A CN2010105993760A CN201010599376A CN102154377A CN 102154377 A CN102154377 A CN 102154377A CN 2010105993760 A CN2010105993760 A CN 2010105993760A CN 201010599376 A CN201010599376 A CN 201010599376A CN 102154377 A CN102154377 A CN 102154377A
Authority
CN
China
Prior art keywords
preferable
reductase
preferred
recombinase
oxidoreductase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2010105993760A
Other languages
Chinese (zh)
Other versions
CN102154377B (en
Inventor
许建和
王丽娟
潘江
倪燕
沈乃东
邱勇隽
邱立欢
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
East China University of Science and Technology
Original Assignee
East China University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by East China University of Science and Technology filed Critical East China University of Science and Technology
Priority to CN2010105993760A priority Critical patent/CN102154377B/en
Publication of CN102154377A publication Critical patent/CN102154377A/en
Application granted granted Critical
Publication of CN102154377B publication Critical patent/CN102154377B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts

Landscapes

  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses the use of an oxidoreductase having an amino acid sequence represented by SEQ ID No.2 in a sequence table or recombinase thereof as a carbonyl reductase catalyst in the asymmetric reduction of a prochiral carbonyl compound for preparing optically active chiral alcohol. The invention also discloses a recombinant oxidoreductase prepared by a method which is to culture a recombinant expression transformant having an oxidoreductase gene which has a base sequence represented by SEQ ID No.1 in a sequence table. The oxidoreductase the invention relates to is simple and convenient in preparation, and as a carbonyl reductase catalyst, the oxidoreductase is applicable to more prochiral carbonyl compounds. The oxidoreductase has high catalytic activity, can obtain optically active chiral alcohol with high conversion rate and high optical purity, realize the regeneration of own coenzyme NADH without requiring an extra coenzyme regeneration system. In whole reaction process, the pH control is not needed, the reaction conditions are mild, and the oxidoreductase has a bright industrial application and development prospect.

Description

The application of a kind of oxydo-reductase or its recombinase and a kind of reorganization oxydo-reductase
Technical field
The present invention relates to a kind of oxydo-reductase or its recombinase as the carbonyl reduction enzyme catalyst at asymmetric reduction prochirality carbonyl compound with the application in the preparation optical activity chirality alcohol, and a kind of reorganization oxydo-reductase.
Background technology
Optical activity chirality alcohol is medicine and fine chemicals synthetic important intermediate.At present, the preparation method of optical activity chirality alcohol mainly comprises the carbonyl method of asymmetrically reducing of chemical catalysis, the carbonyl method of asymmetrically reducing of biocatalysis and the racemization alcohol chiral separation method of biocatalysis.Wherein, the asymmetric reduction of chemical catalysis carbonyl needs expensive metal catalyst such as rhodium, ruthenium usually.These catalyst recovery difficulties, contaminate environment, and energy consumption of reaction height.The advantage of biocatalysis method of asymmetrically reducing is, ketone 100% ground can be converted into the chiral alcohol of single configuration on this theoretical method, and substrate utilization ratio height, product are easy to separate, and shortcoming is to need to add expensive coenzyme.The chiral separation of biocatalysis need not added coenzyme, can not surpass 50% but the shortcoming of this method is the highest yield of product of target configuration.
The asymmetric reduction of prochirality carbonyl compound is one of effective way of obtaining by optical activity chirality alcohol.Up to now, existing many reports that prepare optical activity alcohol about biocatalysis ketone asymmetric reduction.For example, (Construction and co-expression of a polycistronic plasmidencoding carbonyl reductase and glucose dehydrogenase for production of ethyl (S)-4-chloro-3-hydroxybutanoate.Bioresource Technology such as Qi Ye, 2010,101:6761-6767) use carbonyl reductase PsCR catalysis 4-chloroacetyl acetacetic ester (Ethyl 4-chloroacetoacetate from pichia stipitis (Pichia stipitis) CBS 6054, COBE) asymmetric reduction preparation (S)-4-chloro-ethyl 3-hydroxybutanoate (Ethyl 4-chloro-3-hydroxybutanoate, (S)-CHBE).Wherein (S)-CHBE is used for the treatment of hypercholesteremic statins---the important intermediate of hydroxy-methyl-glutaryl coenzyme A (HMG-CoA) inhibitor.The document adopts water/ethyl octylate two-phase reaction system and adds the strategy of substrate COBE and glucose in batches, and the concentration of (S)-CHBE reaches 1.26M in the organic phase, and optical purity is higher than 99%, and yield is 90%.But the shortcoming of this catalysis process is, needs to add the regeneration of glucose and Hexose phosphate dehydrogenase catalysis coenzyme NADP 11, in this case, needs in the reaction process accurately to control the pH value, has increased process complexity.(Purification andCharacterization of a Novel Alcohol Dehydrogenase from Leifsonia sp.StrainS749:a Promising Biocatalyst for an Asymmetric Hydrogen TransferBioreduction.Applied and environmental microbiology.2005 such as Inoue, 75:3633-3641) use alcoholdehydrogenase LsADH catalysis 2 from Lai Shi bacterium (Leifsonia sp.) strain S749,2, the 2-trifluoroacetophenone is produced (S)-2,2,2-trifluoro-benzene ethanol (a kind of potential chiral liquid crystal material), can reach 100g/L by catalytic concentration of substrate in single water react system, wherein alcoholdehydrogenase LsADH has the catalysis isopropanol oxidation, make the NAD+ reduction generate the ability of NADH simultaneously, reaction process does not need to control the pH value.
Yet, the carbonyl reduction enzyme catalyzer that has been used at present suitability for industrialized production is also few, its difficult point is that the carbonyl reductase with excellent catalytic performances such as high catalytic activity and highly selectivies is difficult to obtain, and related coenzyme costs an arm and a leg in the catalyzed reaction, has increased the cost of explained hereafter undoubtedly.Therefore, at the prochirality carbonyl compound, it is efficient special to need screening badly, especially can realize self coenzyme round-robin carbonyl reductase, to satisfy industrial needs.
Genbank has included a kind of oxydo-reductase ScCR (the Genbank accession number is NP 631416), its aminoacid sequence is shown in SEQ ID No.2, comprise 263 amino acid altogether, it can derive from streptomyces coelicolor (Streptomyces coelicolor) A3 (2) NRRL B-16638, its encoding gene (Genbank accession number NC 003888.3, REGION:8176680..8177471) nucleotide sequence comprises the 792bp base altogether shown in SEQ ID No.1.So far, do not see the report that this oxydo-reductase of bibliographical information carries out any practical application as yet.
Summary of the invention
Technical problem to be solved by this invention is still rare at existing high catalytic activity and highly selective carbonyl reductase, and need expensive coenzyme mostly, can not satisfy the defective of the desirable needs of industrial application, and provide a kind of oxydo-reductase or the new application of its recombinase in carbonyl compound asymmetric reduction field, and a kind of can efficient special catalysis of carbonyl compound, especially the asymmetric reduction of 4-chloroacetyl acetacetic ester, and can realize self coenzyme round-robin reorganization oxydo-reductase.
The present invention relates to a kind of oxydo-reductase or its recombinase as the carbonyl reduction enzyme catalyst at asymmetric reduction prochirality carbonyl compound with the application in the preparation optical activity chirality alcohol; The aminoacid sequence of described oxydo-reductase or its recombinase is shown in SEQ ID No.2 in the sequence table.
Among the present invention, the Genbank accession number of described oxydo-reductase is NP_631416, hereinafter referred oxydo-reductase ScCR, and it can derive from streptomyces coelicolor (Streptomyces coelicolor) A3 (2) NRRL B-16638.
Among the present invention, described recombinase can be made by following method: cultivate the recombinant expressed transformant that comprises the oxidoreductase gene of base sequence shown in SEQ ID No.1 in the sequence table, get final product.
Wherein, the method and the condition of the step of described cultivation do not have particular restriction, can carry out appropriate selection with the different of factor such as selected cultural methods by this area general knowledge according to host type, as long as make recombinant expressed transformant can grow and produce reorganization oxydo-reductase of the present invention.For substratum, the present invention preferably includes the substratum of following compositions: yeast extract paste 5～10g/L, peptone 10～20g/L and NaCl10g/L.
The present invention's one preferred embodiments is: the recombination bacillus coli that will comprise the oxidoreductase gene of base sequence shown in SEQ ID No.1 in the sequence table is inoculated in the LB substratum that contains kantlex and (comprises yeast extract paste 5g/L, peptone 10g/L and NaCl 10g/L) the middle cultivation, be inoculated in LB ' substratum afterwards and (comprise yeast extract paste 10g/L, peptone 20g/L and NaCl 10g/L) the middle cultivation, as nutrient solution OD 600When reaching 7.5～8.5 (preferred 8), be under the inducing of sec.-propyl-β-D-sulfo-galactopyranoside (IPTG) of 0.1～1mM (preferred 0.5mM) at final concentration, can efficiently express reorganization oxydo-reductase of the present invention.Wherein, what the temperature of described cultivation was preferable is 30～37 ℃, and better is 37 ℃.What described cultivation was preferable carries out under oscillating condition.Described preferable 5% the inoculum size inoculation by volume of step that is inoculated in LB ' substratum.What the described inductive time was preferable is 22～28 ℃, and better is 25 ℃.That the described inductive time is preferable is 10～15h, and that better is 12h.
After making reorganization oxydo-reductase of the present invention as stated above, can collect stand-byly by this area ordinary method, generally can be in the following manner any: (1) collects the cell in the nutrient solution, washing, lyophilize, freeze drying cell.Concrete operation is preferred: with medium centrifugal (rotating speed is generally 8000～10000rpm) and removes supernatant liquors, collecting cell, physiological saline washing (preferably twice), lyophilize, freeze drying cell.(2) cell in the nutrient solution of collecting is carried out cell wall breaking and handle, centrifugal, get supernatant liquor, promptly get crude enzyme liquid.Concrete operation is preferred: the cell in the nutrient solution of collecting is suspended in again in the damping fluid (as phosphate buffered saline buffer, phosphoric acid-sodium phosphate buffer of preferred pH6.5,100mM) of pH6.0～7.0 commonly used, this area, carries out cell wall breaking.The mode of described cell wall breaking can adopt ordinary method, and as supersound process, optimum condition is power 400W, ultrasonic 4s, and intermittently 6s repeats 99 and takes turns.That the centrifugal speed behind the cell wall breaking is preferable is 8000～10000rpm.(3) by mode (2) preparation crude enzyme liquid, the further lyophilize of crude enzyme liquid is got thick enzyme powder
Wherein, the described recombinant expressed transformant that comprises the oxidoreductase gene of base sequence shown in SEQ ID No.1 in the sequence table can make as follows: the recombinant expression vector that will comprise the oxidoreductase gene of base sequence shown in SEQ ID No.1 is converted in the host microorganism, gets final product.Described host microorganism can be the various host microorganisms of this area routine, as long as can satisfy duplicating voluntarily that recombinant expression vector can be stable, and entrained oxidoreductase gene of the present invention can be got final product by effective expression.The preferred intestinal bacteria of the present invention, more preferably colon bacillus (E.coli) BL21 (DE3).
The described recombinant expression vector that comprises the oxidoreductase gene of base sequence shown in SEQ ID No.1 in the sequence table can make as follows: the oxidoreductase gene of base sequence shown in SEQ ID No.1 in the sequence table is connected on the carrier, gets final product.Described carrier can be the various carriers of this area routine, as commercially available plasmid, clay, phage or virus vector etc., preferred plasmid pET-28a.Preferable, can make recombinant expression vector of the present invention by following method: with oxidoreductase gene and plasmid pET-28a restriction enzyme NdeI and the HindIII double digestion of base sequence shown in SEQ ID No.1 in the sequence table, connect with the T4DNA ligase enzyme then, get final product recombinant expression plasmid of the present invention.
The oxidoreductase gene of described base sequence shown in SEQ ID No.1 in the sequence table can pass through primer, genome with streptomyces coelicolor (Streptomyces coelicolor) A3 (2) NRRL B-16638 is a template, and (PCR) carries out gene amplification and make through the polymerase chain reaction; Described primer is: upstream primer is GGAGATTCATATGAGCACCACCGGAACCACC, and downstream primer is GTGAAGCTTTCAGACGGCGGTGTAGGCGC.
What application of the present invention was preferable carries out as follows: at NAD +And/or under the existence of NADH and Virahol, under the effect of described oxydo-reductase or its recombinase, will carry out asymmetric reduction reaction as the prochirality carbonyl compound of substrate, make optical activity chirality alcohol.
In the above-mentioned application, each condition of described asymmetric reduction reaction can be selected by the normal condition of this type of reaction of this area, specifically selects and the following introduction of optimum condition:
What described prochirality carbonyl compound was preferable is aryl ketones compounds or ketone ester compounds, and that better is R 1COR 2, R 3COCH 2COOCH 2CH 3Or R 4COCOOCH 2CH 3Wherein, R 1For-C 6H 5Or-C 6H 4X, R 2For-CH 3,-CH 2CF 3Or-CH 2X, R 3For-CH 3,-CH 2CH 3,-CH 2X or-CF 3, R 4For-CH 3,-C (CH 3) 2,-C 6H 4X or-(CH 2) 2C 6H 5, X is C1 or Br, the position that X replaces on phenyl can be ortho position, a position or contraposition.The amount of described prochirality carbonyl compound is selected according to concrete substrate, can be 10～200g/L reaction soln for single aqueous phase solvent system, can be 10～600g/L water for the two-phase transformation system of organic solvent phase/water.
According to a conventional method, described oxydo-reductase or its recombinase can adopt following form to add reaction system: crude enzyme liquid is directly added reaction system, perhaps will suspend or be dissolved with pH5～9 of freeze drying cell or thick enzyme powder, preferred 6～7 aqueous buffer solution adding reaction system.Described aqueous buffer solution kind can be this area various damping fluids commonly used, preferably phosphoric acid salt buffer.The concentration of described damping fluid can be 50～100mM.The present invention is phosphoric acid-sodium phosphate buffer of pH6.5,100mM most preferably.The amount of described oxydo-reductase or its recombinase is more than the catalytically effective amount, is generally 80～400U/g substrate (embodiment 3 is seen in the definition of the enzyme U of unit alive), preferred 200～400U/g substrate.
The amount of described Virahol is generally 1～45 times of prochirality carbonyl compound molar weight, preferred 1.6～1.8 times.Described NAD +And/or the amount of NADH can be 0.3～1.0mmol/L.Preferable, in reaction system, also add MgCl 2, to improve the enzyme activity of oxydo-reductase of the present invention or its recombinase.Described MgCl 2Amount preferable be 2mmol/L.Above-mentioned mmol/L is the mmol/L reaction soln in single aqueous phase solvent system, is mmol/L water in the two-phase transformation system of organic solvent phase/water.
The temperature of described asymmetric reduction reaction is generally 20～40 ℃, preferred 25～30 ℃.The time of described asymmetric reduction reaction is as the criterion to react completely, and is generally 1～36 hour.
The solvent system of described asymmetric reduction reaction can be common aqueous buffer solution system.Described aqueous buffer solution is with aforementioned.Substrate suppresses and product suppresses problem, the two-phase transformation system of the preferred organic solvent phase/water of the present invention in order to solve better.Described organic solvent can be 0.5～1.5 with the volume ratio of water: 1, and preferred 1: 1.Wherein, described water is aforementioned aqueous buffer solution.The preferred dibutyl phthalate of described organic solvent, octane-iso, normal heptane, ethyl octylate, normal hexane, n-Octanol, toluene or butylacetate, more preferably toluene.
Be similarly and solve substrate inhibition and product inhibition problem, the operation of preferably adopting substrate and Virahol in batches to add better.Concrete, what substrate and Virahol added in batches batch can be preferred 4 times 3～6 times.The add-on of every batch of substrate can be 1/6～1/3 of substrate total amount, and preferred 1/4.Virahol add-on first can be 2/5～3/5 of total amount, and preferred 2/5.The residue batch quantity of isopropanol be 1/10～3/10 of total amount, preferred 1/5.The time that every batch of substrate and Virahol add is that preceding batch of substrate reactions is advisable after fully.
Reaction behind the extraction separation, can obtain optical activity chirality alcohol after finishing according to a conventional method.
With substrate R 1COR 2Be example, reaction scheme is as follows.
Figure BSA00000394226800061
The invention further relates to a kind of reorganization oxydo-reductase, its recombinase: cultivate the recombinant expressed transformant that comprises the oxidoreductase gene of base sequence shown in SEQ ID No.1 in the sequence table, get final product for making by following method.The actual conditions of described method is with aforementioned.
On the basis that meets this area general knowledge, above-mentioned each optimum condition, but arbitrary combination promptly get the preferred embodiments of the invention.
Agents useful for same of the present invention and raw material are all commercially available to be got.
Positive progressive effect of the present invention is: the present invention is first with oxydo-reductase ScCR or its recombinase asymmetric reduction that be used for prochirality carbonyl compound of aminoacid sequence shown in SEQ ID No.2, with preparation optical activity chirality alcohol.This oxydo-reductase prepares easy, wide as carbonyl reduction enzyme catalyst prochirality carbonyl compound applicatory scope, has excellent catalytic activity, can obtain the optical activity chirality alcohol of high conversion, high-optical-purity, especially at 4-chloroacetyl acetacetic ester (COBE), reach in amount of substrate under the condition of 600g/L, reaction conversion ratio can reach 100%, (S)-(yield of (S)-CHBE) reaches 96% to 4-chloro-ethyl 3-hydroxybutanoate, and enantiomeric excess value is greater than 99%.And this enzyme has the activity of catalysis of carbonyl reduction and alcohol dehydrogenase two aspects, so only needs in the reaction system to add on a small quantity than NADP +Cheap NAD +And Virahol, just can realize the regeneration of reduced coenzyme NADH, need not to add in addition other regenerating coenzyme system.Entire reaction course need not controlled pH, and the reaction conditions gentleness can be used for preparing multiple optical activity chirality alcohol, particularly (S)-chiral alcohol, has good industrial application DEVELOPMENT PROSPECT.
Description of drawings
Fig. 1 is the plasmid construction synoptic diagram of recombinant expression plasmid pET-28a-ScCR among the embodiment 1.
Fig. 2 is the pcr amplification product electrophorogram of gene ScCR among the embodiment 1.
Fig. 3 is the pcr amplification electrophorogram of colon bacillus among the embodiment 1 (E.coli) BL21 (DE3)/pET28a-ScCR.
Fig. 4 is the polyacrylamide gel electrophoresis figure of the crude enzyme liquid of reorganization oxydo-reductase ScCR among the embodiment 2.
Embodiment
Mode below by embodiment further specifies the present invention, but does not therefore limit the present invention among the described scope of embodiments.The experimental technique of unreceipted actual conditions in the following example according to ordinary method and condition, or is selected according to catalogue.
Material source in the following example is:
Expression plasmid pET28a is available from Shanghai Novagen company.
Marker II, E.coli DH5 α and E.coli BL21 (DE3) competent cell, 2 * Taq PCRMasterMix, sepharose DNA reclaim test kit available from sky, Beijing root biochemical technology company limited.
The structure of embodiment 1 colon bacillus (E.coli) BL21 (DE3)/pET-28a-ScCR
1, the amplification of ScCR gene
According to the base sequence shown in SEQ ID No.1, the design primer sequence is as follows:
Upstream primer (ScCR-NdeI): GGAGATT CATATGAGCACCACCGGAACCACC;
Downstream primer (ScCR-HindIII): GTG AAGCTTTCAGACGGCGGTGTAGGCGC.
Genomic dna with streptomyces coelicolor (Streptomyces coelicolor) A3 (2) NRRL B-16638 is a template, carries out pcr amplification, obtains the ScCR gene.The PCR system is: 2 * Taq PCRMasterMix, 15 μ l, each 1 μ l (0.3 μ mol/L) of upstream primer and downstream primer, dna profiling 2 μ l (0.1 μ g) and ddH 2O 11 μ l.The pcr amplification step is: (1) 95 ℃, and pre-sex change 3min; (2) 94 ℃, sex change 1min; (3) 55 ℃ of annealing 30s; (4) 72 ℃ are extended 90s; Step (2)～(4) circulation 30 times; (5) 72 ℃, extend 10min, be cooled to 4 ℃ of preservations.The PCR product utilizes sepharose DNA to reclaim the target stripe that test kit reclaims 700～900bp interval, as shown in Figure 2 through the agarose gel electrophoresis purifying.
2, the preparation of recombinant expression plasmid pET-28a-ScCR
Under 37 ℃, with gained PCR product with restriction enzyme NdeI and HindIII double digestion 12h, simultaneously under similarity condition double digestion pET-28a carrier to prepare linear pET-28a carrier.Gene fragment behind the double digestion is connected for 4 ℃ with the T4DNA ligase enzyme with linear pET-28a carrier spends the night, obtain recombinant expression plasmid pET-28a-ScCR.Plasmid construction figure as shown in Figure 1.
3, the structure of colon bacillus (E.coli) BL21 (DE3)/pET-28a-ScCR
Recombinant expression plasmid pET-28a-ScCR is changed in colon bacillus (E.coli) the DH5 α competent cell, positive recombinant chou is screened containing on the resistant panel of kantlex, the picking mono-clonal, cultivate the reorganization bacterium, treat to extract plasmid behind the plasmid amplification, again be converted in colon bacillus (E.coli) BL21 (DE3) competent cell, promptly obtain recombinant expressed transformant colon bacillus (E.coli) BL21 (DE3)/pET28a-ScCR, bacterium colony PCR verifies positive colony (Fig. 3).
The preparation of embodiment 2 reorganization oxydo-reductase ScCR
Colon bacillus (E.coli) BL21 (the DE3)/pET28a-ScCR of embodiment 1 gained is inoculated in the LB substratum (comprising yeast extract paste 5g/L, peptone 10g/L and NaCl 10g/L) that contains kantlex (final concentration 50mg/L) 37 ℃ of shaking culture 8h.By the inoculum size of 5% (v/v) seed liquor is inoculated into and is equipped with in 3L LB ' the substratum 5L fermentor tank of (comprising yeast extract paste 10g/L, peptone 20g/L and NaCl 10g/L), 37 ℃ are cultured to OD 600Be about at 8 o'clock, adding final concentration is the IPTG of 0.5mM, induces 12h for 25 ℃.
With the centrifugal supernatant that goes of gained fermentation culture 9000rpm, collect wet cell.Get part wet cell physiological saline washed twice, lyophilize promptly gets freeze drying cell, and is standby.Other get in phosphoric acid-sodium phosphate buffer that the part wet cell is suspended in pH6.5,100mM (1g wet cell/10ml damping fluid) suspension, (power is 400W, ultrasonic 4s with ultrasonication suspension, 6s intermittently, repeating 99 takes turns), 9000rpm centrifuging and taking supernatant promptly gets crude enzyme liquid.With the crude enzyme liquid lyophilize, promptly get thick enzyme powder, standby.Crude enzyme liquid is through polyacrylamide gel electrophoresis map analysis (Fig. 4), and the recombinant protein overwhelming majority exists with soluble form.Polyacrylamide gel electrophoresis figure gets through the BandScan software analysis, and the target protein reorganization oxydo-reductase ScCR of expression accounts for 69% of crude enzyme liquid total protein.
The vitality test of embodiment 3 reorganization oxydo-reductase ScCR
The reduction reaction vitality test of oxydo-reductase ScCR: reaction system is 1ml, comprises pH 6.5,100mM sodium phosphate buffer, 0.1mM NADH, and 2mM COBE 30 ℃ of reactions down, uses the decline of spectrophotometric determination 340nm place light absorption value.Enzyme work is defined as, and the required enzyme amount of per minute oxidation 1 μ molNADH is the enzyme U of unit alive.Protein content adopts the Brandford method to measure.
Adopt aforesaid method to measure embodiment 2 gained reorganization redox enzyme activity, the result is: the reduction reaction vigor of reorganization oxydo-reductase ScCR is 10.4U/mg.
Embodiment 4～17 reorganization oxydo-reductase ScCR catalytic preparation optical activity chirality alcohol
Reaction system is 1ml: the thick enzyme powder that takes by weighing the oxydo-reductase ScCR that embodiment 2 makes in the ratio of 400U/g substrate is dissolved in the 0.85ml 100mM sodium phosphate buffer (pH 6.5), adds various substrates respectively, 1 μ mol NAD +(1mM), the Virahol of 0.15ml, 30 ℃, 900rpm oscillatory reaction 12h.Reaction finishes the back and adds equal volume of ethyl acetate twice, combining extraction liquid, spend the night with anhydrous sodium sulfate drying, by the optical purity of gas-chromatography (GC/CP-Chirasil-Dex CB) or liquid chromatography (chirality OD-H post) analytical reaction transformation efficiency and product, the result is as shown in table 1.
The detection method of transformation efficiency and product optical purity is as follows:
Embodiment 4～14 and 17 uses gas-chromatography (chiral capillary column CP-Chirasil-Dex CB) to analyze transformation efficiency and product optical purity, carrier gas nitrogen, 280 ℃ of injector temperatures, 280 ℃ of detector FID temperature; Embodiment 15～16 uses gas-chromatography (chiral capillary column CP-Chirasil-Dex CB) to analyze transformation efficiency, carrier gas nitrogen, and 280 ℃ of injector temperatures, 280 ℃ of detector FID temperature are used liquid chromatography (chirality OD-H post) assay products optical purity.Other conditions are as follows:
Embodiment 4: 120 ℃ of column temperatures.
Embodiment 5 and 6: 150 ℃ of column temperatures.
Embodiment 7: 140 ℃ of column temperatures.
Embodiment 8: 160 ℃ of column temperatures.
Embodiment 9: 160 ℃ of column temperatures.
Embodiment 10: column temperature keeps 2min for 90 ℃, is warming up to 120 ℃ with 1 ℃/min, keeps 5min.
Embodiment 11: 120 ℃ of column temperatures.
Embodiment 12: when analyzing transformation efficiency, and 140 ℃ of column temperatures; During the assay products optical purity, acetylate, column temperature keeps 2min for 110 ℃, is warming up to 126 ℃ with 2 ℃/min, keeps 2min, is warming up to 160 ℃ with 2 ℃/min, keeps 2min.The acetylize method is: get acetic acid ethyl acetate extract 0.2ml, place 5ml tool plug test tube, the normal temperature dried solvent that volatilizees.Splash into 2 diacetyl oxides and 2 pyridines then, place boiling water bath reaction 1 hour, cold slightly, add an amount of ethyl acetate dilution.Spend the night with anhydrous sodium sulfate drying then, treat GC detect (Baker ' s yeast:production of D-and L-3-hydroxy esters.Tetrahedron:Asymmetry, 1998,9:4395-4417).
Embodiment 13: 130 ℃ of column temperatures.
Embodiment 14: 80 ℃ of column temperatures.
Embodiment 15: use the gas chromatographic analysis transformation efficiency, 120 ℃ of column temperatures; Use liquid-phase chromatographic analysis product optical purity, moving phase: normal hexane/Virahol=98/2, flow velocity 0.5ml/min, detector wavelength 220nm.
Embodiment 16: use the gas chromatographic analysis transformation efficiency, 180 ℃ of column temperatures; Use liquid-phase chromatographic analysis product optical purity, moving phase: normal hexane/Virahol=97/3, flow velocity 1ml/min, detector wavelength 254nm.
Embodiment 17: 160 ℃ of column temperatures.
Table 1 reorganization oxydo-reductase ScCR catalytic preparation optical activity chirality alcohol
Figure BSA00000394226800111
Figure BSA00000394226800121
The asymmetric reduction of embodiment 18 reorganization oxydo-reductase ScCR catalysis COBE
Reaction system is 1ml: the thick enzyme powder (embodiment 2 preparations) of getting the reorganization oxydo-reductase ScCR of 40U (80U/g substrate) is dissolved in 0.85ml 100mM phosphoric acid-sodium phosphate buffer (pH6.5), add 200mg substrate COBE (200g/L reaction soln), 1 μ mol NAD +(1mM), the Virahol of 0.15ml (with the molar ratio of substrate be 1.6), under 30 ℃, 900rpm oscillatory reaction 4h, transformation efficiency are 96%, the optical purity ee of product＞99%.
Embodiment 19 reorganization oxydo-reductase ScCR catalysis COBE asymmetric reductions
Reaction system is 1ml: the ScCR freeze drying cell (embodiment 2 preparations) of getting 68U (340U/g substrate) is suspended in 0.85ml 100mM phosphoric acid-sodium phosphate buffer (pH6.5), adds 200mg substrate COBE (200g/L reaction soln), 1 μ mol NAD +(1mM), the Virahol of 0.15ml (with the molar ratio of substrate be 1.6), under 30 ℃, 900rpm concussion reaction 4h, transformation efficiency is 100%, the optical purity ee of product＞99%.
Embodiment 20 reorganization oxydo-reductase ScCR catalysis COBE asymmetric reductions
Reaction system is 10ml: the ScCR freeze drying cell (embodiment 2 preparations) of getting 680U (340U/g substrate) is suspended in 8.5ml 100mM phosphoric acid-sodium phosphate buffer (pH6.5), adds 2g substrate COBE (200g/L reaction soln), 10 μ mol NAD +(1mM), the Virahol of 1.5ml (with the molar ratio of substrate be 1.6), under 25 ℃, 900rpm concussion reaction 4h, transformation efficiency is 98%, the optical purity ee of product＞99%.
Reorganization oxydo-reductase ScCR catalysis COBE asymmetric reduction in embodiment 21 water-toluene two-phase system
The ScCR freeze drying cell (embodiment 2 preparation) of getting 1360U (227U/g substrate) is suspended in 10ml 100mM phosphoric acid-sodium phosphate buffer (pH6.5), adds 6g COBE (600g/L water), the 5ml Virahol (with the molar ratio of substrate be 1.8), 3 μ mol NAD +(0.3mM), 20 μ molMgCl 2(2mmol/L water), 10ml toluene, 30 ℃, 180rpm oscillatory reaction 24h, transformation efficiency are 100%, the optical purity ee of product＞99%.
Reorganization oxydo-reductase ScCR catalysis COBE asymmetric reduction in embodiment 22 water-toluene two-phase system
The ScCR freeze drying cell (embodiment 2 preparations) of getting 907U (227U/g substrate) is suspended in 10ml 100mM phosphoric acid-sodium phosphate buffer (pH6.5), add 4g COBE (400g/L water), 3.5ml Virahol (with the molar ratio of substrate be 1.8), 3 μ mol NAD +(0.3mM), 20 μ molMgCl 2(2mmol/L water), 10ml toluene, 30 ℃, 180rpm oscillatory reaction 24h, transformation efficiency are 100%, the optical purity ee of product＞99%.
Embodiment 23 substrates add reorganization oxydo-reductase ScCR catalysis COBE asymmetric reduction in batches
Get in ScCR freeze drying cell (embodiment 2 preparations) the 10ml 100mM phosphoric acid-sodium phosphate buffer (pH 6.5) of 1360U (227U/g substrate), add 3 μ mol NAD +(0.3mM), 20 μ molMgCl 2(2mmol/L water), 10ml toluene adds the Virahol of 2g COBE (200g/L water) and 3ml, and under 30 ℃, the 180rpm oscillatory reaction when reacting to 2h and 5h, is added the Virahol of 2g COBE (200g/L water) and 1ml.Transformation efficiency is 100% during reaction 24h, the optical purity ee of product＞99%.
Embodiment 24 substrates add reorganization oxydo-reductase ScCR catalysis COBE asymmetric reduction in batches
Get in ScCR freeze drying cell (embodiment 2 preparations) the 10ml 100mM phosphoric acid-sodium phosphate buffer (pH 6.5) of 1360U (227U/g substrate), add 3 μ mol NAD +(0.3mM), 20 μ molMgCl 2(2mmol/L water), 10ml toluene adds the Virahol of 1.5g COBE (150g/L water) and 2ml, under 30 ℃, the 180rpm oscillatory reaction, 1h adds the Virahol of 1.5g COBE (150g/L water) and 1ml respectively when 3h and 6h.Transformation efficiency is 100% during reaction 20h, the optical purity ee of product＞99%.The output of product (S)-CHBE is 5.75g, and yield reaches 96%.
Figure ISA00000394227000011
Figure ISA00000394227000021
Figure ISA00000394227000031
Figure ISA00000394227000041

Claims (10)

  1. An oxydo-reductase or its recombinase as the carbonyl reduction enzyme catalyst at asymmetric reduction prochirality carbonyl compound with the application in the preparation optical activity chirality alcohol; The aminoacid sequence of described oxydo-reductase or its recombinase is shown in SEQ ID No.2 in the sequence table.
  2. 2. application as claimed in claim 1 is characterized in that:
    Described oxydo-reductase derives from streptomyces coelicolor (Streptomyces coelicolor) A3 (2) NRRL B-16638;
    Described recombinase is made by following method: cultivate the recombinant expressed transformant that comprises the oxidoreductase gene of base sequence shown in SEQ IDNo.1 in the sequence table, get final product; What the used substratum of described cultivation was preferable is the substratum that comprises following compositions: yeast extract paste 5～10g/L, peptone 10～20g/L and NaCl 10g/L.
  3. 3. application as claimed in claim 2, it is characterized in that: described recombinase is made by following method: the recombination bacillus coli that will comprise the oxidoreductase gene of base sequence shown in SEQ ID No.1 in the sequence table is inoculated in the LB substratum that contains kantlex to be cultivated, be inoculated in afterwards in the LB ' substratum and cultivate, OD600 reaches 7.5～8.5 when nutrient solution, preferred 8 o'clock, at final concentration is 0.1～1mM, under the inducing of sec.-propyl-β-D-sulfo-galactopyranoside of preferred 0.5mM, get final product; Described LB substratum comprises yeast extract paste 5g/L, peptone 10g/L and NaCl 10g/L; Described LB ' substratum comprises yeast extract paste 10g/L, peptone 20g/L and NaCl 10g/L;
    What the temperature of described cultivation was preferable is 30～37 ℃; What described cultivation was preferable carries out under oscillating condition; Described preferable 5% the inoculum size inoculation by volume of step that is inoculated in LB ' substratum; What the described inductive time was preferable is 22～28 ℃; That the described inductive time is preferable is 10～15h.
  4. 4. as claim 2 or 3 described application, it is characterized in that: described recombinase is pressed any collection in the following mode: (1) collects the cell in the nutrient solution, washing, and lyophilize gets freeze drying cell; (2) cell in the nutrient solution of collecting is carried out cell wall breaking and handle, centrifugal, get supernatant liquor, promptly get crude enzyme liquid; (3) by mode (2) preparation crude enzyme liquid, the further lyophilize of crude enzyme liquid is got thick enzyme powder.
  5. 5. application as claimed in claim 2, it is characterized in that: the described recombinant expressed transformant that comprises the oxidoreductase gene of base sequence shown in SEQ ID No.1 in the sequence table is made by following method: pass through primer, genome with streptomyces coelicolor (Streptomyces coelicolor) A3 (2) NRRL B-16638 is a template, carry out gene amplification through the polymerase chain reaction and get the oxidoreductase gene of base sequence shown in SEQ ID No.1 in the sequence table, be connected in the recombinant expression vector that must comprise the oxidoreductase gene of base sequence shown in SEQ ID No.1 in the sequence table on the carrier afterwards, be converted into afterwards in the host microorganism, get final product;
    Described primer is:
    Upstream primer is GGAGATTCATATGAGCACCACCGGAACCACC,
    Downstream primer is GTGAAGCTTTCAGACGGCGGTGTAGGCGC;
    That described carrier is preferable is plasmid pET-28a; What described host microorganism was preferable is intestinal bacteria, and that better is colon bacillus (E.coli) BL21 (DE3).
  6. 6. as each described application of claim 1～5, it is characterized in that: described application is carried out as follows: at NAD +And/or under the existence of NADH and Virahol, under the effect of described oxydo-reductase or its recombinase, will carry out asymmetric reduction reaction as the prochirality carbonyl compound of substrate, make optical activity chirality alcohol.
  7. 7. as claim 1 or 6 described application, it is characterized in that: described prochirality carbonyl compound is aryl ketones compounds or ketone ester compounds, and that better is R 1COR 2, R 3COCH 2COOCH 2CH 3Or R 4COCOOCH 2CH 3Wherein, R 1For-C 6H 5Or-C 6H 4X, R 2For-CH 3,-CH 2CF 3Or-CH 2X, R 3For-CH 3,-CH 2CH 3,-CH 2X or-CF 3, R 4For-CH 3,-C (CH 3) 2,-C 6H 4X or-(CH 2) 2C 6H 5, X is Cl or Br, the position that X replaces on phenyl is ortho position or contraposition.
  8. 8. application as claimed in claim 7 is characterized in that: the amount of described prochirality carbonyl compound is 10～200g/L reaction soln in single aqueous phase solvent system, is 10～600g/L water in the two-phase transformation system of organic solvent phase/water;
    And/or, described oxydo-reductase or its recombinase adopt following form to add reaction system: crude enzyme liquid is directly added reaction system, perhaps will suspend or be dissolved with pH5～9 of freeze drying cell or thick enzyme powder, preferred 6～7 aqueous buffer solution adding reaction system; What described aqueous buffer solution was preferable is phosphate buffered saline buffer; That the concentration of described damping fluid is preferable is 50～100mM; Phosphoric acid-sodium phosphate buffer of the preferred pH6.5 of described aqueous buffer solution, 100mM;
    And/or the amount of described oxydo-reductase or its recombinase is 80～400U/g substrate, preferred 200～400U/g substrate;
    And/or the amount of described Virahol is 1～45 times of prochirality carbonyl compound molar weight, preferred 1.6～1.8 times;
    And/or, described NAD +And/or the amount of NADH is 0.3～1.0mmol/L;
    And/or, in the described asymmetric reduction reaction, in reaction system, also add MgCl 2, described MgCl 2Amount preferable be 2mmol/L;
    Described mmol/L is the mmol/L reaction soln in single aqueous phase solvent system, is mmol/L water in the two-phase transformation system of organic solvent phase/water.
    And/or the temperature of described asymmetric reduction reaction is 20～40 ℃, preferred 25～30 ℃;
    And/or the time of described asymmetric reduction reaction is as the criterion to react completely.
  9. 9. as claim 6 or 8 described application, it is characterized in that:
    The solvent system of described asymmetric reduction reaction is the two-phase transformation system of aqueous buffer solution system or organic solvent phase/water; What described organic solvent and the volume ratio of water were preferable is 0.5～1.5: 1, and better is 1: 1, and described water is an aqueous buffer solution; What described aqueous buffer solution was preferable is phosphate buffered saline buffer; That the concentration of described damping fluid is preferable is 50～100mM; Phosphoric acid-sodium phosphate buffer of the preferred pH6.5 of described aqueous buffer solution, 100mM; Described organic solvent is dibutyl phthalate, octane-iso, normal heptane, ethyl octylate, normal hexane, n-Octanol, toluene or butylacetate, more preferably toluene;
    And/or described substrate and Virahol add reaction system in the mode that adds in batches; What substrate and Virahol added in batches batch is 3～6 times, preferred 4 times; The add-on of every batch of substrate is 1/6～1/3 of a substrate total amount, preferred 1/4; Virahol add-on first is 2/5～3/5 of a total amount, preferred 2/5; The residue batch quantity of isopropanol be 1/10～3/10 of total amount, preferred 1/5; The time that every batch of substrate and Virahol add is that preceding batch of substrate reactions adds the back fully.
  10. 10. reorganization oxydo-reductase, it is characterized in that: it is the recombinase of claim 1～5 described in each.
CN2010105993760A 2010-12-17 2010-12-17 Use of oxidoreductase or recombinase thereof and recombinant oxidoreductase Active CN102154377B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2010105993760A CN102154377B (en) 2010-12-17 2010-12-17 Use of oxidoreductase or recombinase thereof and recombinant oxidoreductase

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2010105993760A CN102154377B (en) 2010-12-17 2010-12-17 Use of oxidoreductase or recombinase thereof and recombinant oxidoreductase

Publications (2)

Publication Number Publication Date
CN102154377A true CN102154377A (en) 2011-08-17
CN102154377B CN102154377B (en) 2013-11-06

Family

ID=44436049

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2010105993760A Active CN102154377B (en) 2010-12-17 2010-12-17 Use of oxidoreductase or recombinase thereof and recombinant oxidoreductase

Country Status (1)

Country Link
CN (1) CN102154377B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104894169A (en) * 2015-05-28 2015-09-09 苏州汉酶生物技术有限公司 Preparation method of (S)-1,1,1-trifluoroisopropanol
CN111676201A (en) * 2020-06-30 2020-09-18 宁波酶赛生物工程有限公司 Asymmetric synthesis method of ketoreductase with stereoselectivity and (S) -3-hydroxy ethyl butyrate

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040082043A1 (en) * 2002-10-29 2004-04-29 Yadav Jhillu Singh Enzymatic process for the preparation of optically active alcohols from ketones using tuberous root daucus carota
CN101120094A (en) * 2004-10-27 2008-02-06 Iep有限责任公司 Method for producing chiral alcohols

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040082043A1 (en) * 2002-10-29 2004-04-29 Yadav Jhillu Singh Enzymatic process for the preparation of optically active alcohols from ketones using tuberous root daucus carota
CN101120094A (en) * 2004-10-27 2008-02-06 Iep有限责任公司 Method for producing chiral alcohols

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
《Adv Synth Catal》 20081007 Menno J Sorgedrager et al Asymmetric carbonyl reductions with microbial ketoreductases 2322-2327 1-10 第350卷, *
《EBI UniProt》 20001001 EBI Q9KYM4，UniProtKB/TrEMBL 1-10 , *
《化学进展》 20071031 张文虎等 芳香酮的不对称还原 1537-1552 1-10 第19卷, 第10期 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104894169A (en) * 2015-05-28 2015-09-09 苏州汉酶生物技术有限公司 Preparation method of (S)-1,1,1-trifluoroisopropanol
CN104894169B (en) * 2015-05-28 2019-02-15 苏州汉酶生物技术有限公司 A kind of preparation method of (S) -1,1,1- Trifluoroisoproanol
CN111676201A (en) * 2020-06-30 2020-09-18 宁波酶赛生物工程有限公司 Asymmetric synthesis method of ketoreductase with stereoselectivity and (S) -3-hydroxy ethyl butyrate

Also Published As

Publication number Publication date
CN102154377B (en) 2013-11-06

Similar Documents

Publication Publication Date Title
CN102876734B (en) Carbonyl reductase, gene and applications of carbonyl reductase in asymmetric reduction of prochiral carbonyl compound
CN102618513B (en) Carbonyl reductase, gene and mutant and application thereof to asymmetrical reduced carbonyl compound
CN102492668B (en) Carbonyl reductase and gene thereof as well as application of carbonyl reductase in asymmetrical reductive carbonyl compound
US10526622B2 (en) Preparation method for (R)-3-hydroxyl-5-hexenoate
CN106995808B (en) A kind of recombination transaminase and its application
CN102206686B (en) Preparation method of methyl (R)-o-chloromandelate utilizing biocatalytic asymmetric reduction
CN106636020A (en) Mutant short-chain dehydrogenase, recombinant expression vector, genetic engineering bacterium and application
CN105349503A (en) Carbonyl reductase AcCR and encoding gene and application thereof
CN101857887A (en) Method for preparing optically pure aryl alcohol with cell-free extracts of recombinant strains by catalytic asymmetric conversion
CN102154377B (en) Use of oxidoreductase or recombinase thereof and recombinant oxidoreductase
CN102260657B (en) Lipase gene and recombinase thereof, and application of lipase gene in preparing optically active mandelic acid
CN108359626B (en) Engineering bacterium and application thereof in preparation of (R) -3-hydroxy-5-hexenoic acid ester
CN101407780B (en) Method for preparing (R)-styrene glycol by changing coenzyme specificity and stereoselectivity via site-directed mutagenesis
CN101979527B (en) Reductase, reductase gene, recombinant enzyme, preparation method of recombinant enzyme and application
CN104830921A (en) Enzymatic method for preparing statins intermediates
CN102242085B (en) Epoxy hydrolase, gene thereof and application thereof
CN102465159B (en) Synthesis process for preparing eslicarbazepine with microbial method
CN104531627A (en) Carbonyl reductase, engineering strain and application of carbonyl reductase
CN114891666A (en) Marine bacterial strain and application thereof in preparing tetrahydrocurcumin through catalysis
CN103409402B (en) Aldolase mutant
CN111424060A (en) Biological method for simultaneously preparing D-proline and L-1-pyrroline-5-carboxylic acid
CN102559623B (en) Reductase, gene and recombinase of reductase and preparation method and application of recombinase
CN110591995A (en) Co-expression recombinant bacterium and application thereof in synthesizing furan carboxylic acid
CN101724597B (en) Method for optimizing and improving biotransformation efficiency of (R)-carbonyl reductase by mRNA two-stage structure
CN104372039A (en) Two-enzyme method for preparing rosuvastatin intermediates with branched chains

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant