CN102154238A - Lipase capable of effectively reducing cholesterol level and blood fat level of human body and application thereof - Google Patents

Abstract

The invention provides lipase capable of effectively reducing the cholesterol level and blood fat level of a human body and an application of the lipase in preparing anti-hypercholesterolemia and anti-hyperlipemia medicament. High-fat emulsion is injected into the stomach of a rat to obtain a non-alcoholic simple fatty liver model of the rat, and the preventive treatment effect of the lipase on the rat is checked. The result shows that compared with the model control group, the lipase dose group can effectively reduce the activity of ALT and triglyceride content of hepatic tissue, and can reduce the level of fatty degeneration of liver simultaneously, thereby having the value of popularizing and application.

Description

The lipase and the application thereof of a kind of effective reduction body's cholesterol, blood lipid level

Technical field

The present patent application relates to a kind of lipase and application thereof that can effectively reduce body's cholesterol, blood lipid level, belongs to biological technical field.

Background technology

Lipase, claim the triglyceride hydrolysis enzyme again, be the enzyme of class energy catalysis long-chain fat acid glyceride hydrolysis, also can catalysis be somebody's turn to do the reversed reaction of reacting, all right catalytic esterification of the lipase of many microorganism secretions, transesterification reaction, alcoholysis reaction, acidolysis reaction and ammonolysis reaction etc.

Fatty liver (Fatty Liver) is as a kind of pathology notion, means that intrahepatic fat content surpasses 5% of liver weight in wet base, or liver biopsy 1/3 above liver cell has steatosis and fills the air and is distributed in full liver.Its corresponding clinical concept is that (Fatty Liver Disease FLD) means the pathology main body at liver lobule to fatty liver disease, and becoming (mostly being bulla fat becomes) with diffusivity liver cell fat is the clinical syndrome of pathological characters.At present, by the medical diagnosis on disease standard of the relevant speciality council and relevant common recognition can be clear and definite be: 1, fatty liver disease has or not excessive drinking history according to the patient clinically, divides alcohol fatty liver (alcoholic fatty liver) and non-alcohol fatty liver; 2, the alcoholic liver disease clinical diagnosis is divided into light disease alcoholic liver disease, alcoholic fatty liver, alcoholic hepatitis, alcoholic fibrosis and alcoholic cirrhosis usually; 3, non-alcohol fatty liver generally is divided into simple fatty liver and by three types of the fat hepatitis (NASH) of its differentiation and liver cirrhosis on pathology.

Hypercholesterolemia and hyperlipidaemia are a kind of syndromes that extensively is present in the modern at present, and the trend of rejuvenation is gradually arranged, and it also is the important risk of hypertension, coronary heart disease and diabetes.At present, lack effective treatment means and medicine at hypercholesterolemia and hyperlipidaemia clinically, the result of treatment of medicine commonly used is also undesirable.

Summary of the invention

The present patent application promptly is at above-mentioned weak point, provides a kind of and can be applied to clinically, and can effectively reduce the lipase of body's cholesterol and blood lipid level.

Another purpose of the present patent application provides the application of this kind lipase in the medicine of preparation reduction body's cholesterol, blood lipid level.

Specifically, the lipase of the described a kind of effective reduction body's cholesterol of the present patent application, blood lipid level is characterized in that: described lipase is obtained by following method:

1, obtains hygromycin resistance expression cassette and being cloned on the target plasmid, obtain the recombinant plasmid of hygromycin resistance;

2, increase the respectively lipase gene (PEL) of mould, the strong promoter glyceraldehyde 3-phosphate dehydro-genase promotor (PgpdA) and the Aspergillus nidulans tryptophan synthetase terminator (TtrpC) of Aspergillus nidulans obtain the PEL expression casette that strong promoter drives;

3, this PEL expression casette is inserted in the recombinant plasmid of hygromycin resistance, has obtained to contain the PEL gene overexpression vector of hygromycin selection mark;

4, will contain the PEL gene overexpression vector conversion engineering Agrobacterium of hygromycin selection mark, and utilize the agrobacterium mediation converted method that the PEL expression casette is transformed in the penicillium bacterial strain, obtain the mould genetic engineering bacterium of high expression level lipase;

5, described mould genetic engineering bacterium is inserted seed culture medium with mycelium or spore suspension, under 25-35 ℃, 200-300rpm condition, cultivate after 24 hours, change fermention medium over to the 5%-20% inoculum size, after 2 days, obtain described lipase at 25-35 ℃, 150-300rpm condition bottom fermentation through separation and purification.

Wherein, the method for acquisition hygromycin resistance expression cassette comprises round pcr or Restriction Enzyme incision technology.

Obtain the lipase gene (PEL) of mould, the strong promoter glyceraldehyde 3-phosphate dehydro-genase promotor (PgpdA) of Aspergillus nidulans and the method for Aspergillus nidulans tryptophan synthetase terminator (TtrpC) and comprise pcr amplification or restriction enzyme clone or chemical synthesising technology clone.

Wherein said Penicillium notatum is a Penicilllum expansum.

Described target plasmid is one of following:

PCAMBIA1300, pCAMBIA2300, pCAMBIA3300 or pHB.

Wherein, so the composition of substratum is as follows:

1, seed culture medium (%): soybean cake powder 4, W-Gum 0.8, Na NO ₃0.3, Na ₂HPO ₄0.2, K ₂SO ₄0.25, MgSO ₄0.03, FeSO ₄0.003;

2, fermention medium (%): soybean cake powder 6, W-Gum 1, NaNO ₃0.4, Na ₂HPO ₄0.2, K ₂SO ₄0.3, MgSO ₄0.035, FeSO ₄0.02, CaCO ₃0.5, Na ₂CO ₃0.02.

The application of the described lipase of the present patent application in the medicine of preparation reduction body's cholesterol, blood lipid level.

Description of drawings

Fig. 1 is the structural representation of PV2+ carrier;

Fig. 2 is the structural representation of pCAMBIA2300 carrier;

Fig. 3 is the structural representation of pCAMBIA2302 carrier;

Fig. 4 is the structural representation of PMD18-T::gpdA-Lip-TtrpC carrier;

Fig. 5 is the structural representation of the final carrier of pCHAMBIA2302::PgpdA-Lip-TtrpC;

Fig. 6 is the structure route map of overexpression vector pCHAMBIA2302::PgpdA-PEL-TtrpC;

Fig. 7 identifies collection of illustrative plates for the PCR of the overexpression vector pCHAMBIA2302::PgpdA-PEL-TtrpC of structure;

Wherein, 1-6: independently Agrobacterium-mediated Transformation ,+: positive control ,-: negative control, M:DL-2000Marker;

Fig. 8 is that the PCR of mould transgenosis bacterial strain identifies collection of illustrative plates;

Wherein, 1-5: independently Agrobacterium-mediated Transformation ,+: positive control ,-: negative control, M:DL-2000Marker.

Embodiment

Below in conjunction with specific embodiment to the described a kind of effective reduction body's cholesterol of the described the present patent application of the present patent application; the lipase of blood lipid level is described further; purpose is better to understand technology contents of the present invention for the public; rather than to the restriction of described technology contents; in fact; in spirit of the present invention; improvement to the described method of the present patent application; the replacement of target plasmid and restriction enzyme all is that persons skilled in the art need not performing creative labour and can obtain, therefore all within the present patent application technical scheme required for protection.

The structure of embodiment one, overexpression vector

Adopt following step:

(1) utilize restriction enzyme Sac I, Kpn I with the hygromycin resistance expression cassette from plasmid PV2 ⁺Last enzyme cuts out (as shown in Figure 1), and fragment reclaims through gel, is cloned on the corresponding restriction enzyme site of pCAMBIA2300 plasmid (as shown in Figure 2), obtains to have the recombinant plasmid pCHAMBIA2302 (as shown in Figure 3) of hygromycin resistance; The Totomycin expression cassette also can contain any DNA of this sequence or directly synthetic from other, the plasmid that is used to make up PEL gene overexpression vector is gone back plasmid such as pCAMBIA serial carrier and pHB carriers such as pCAMBIA1300, pCAMBIA3300 that available energy is expressed in filamentous fungus except that pCAMBIA2300;

(2) according to the sequences Design primer (forward primer: TG of the lipase gene PEL (AF330635) of penicillium expansum P.expansium ACTAGTThe sequence of ATGTTGTTCAACTACCAATCTTT underscore is Restriction Enzyme Spe I point of contact; Reverse primer: TGGATCC GCGGCCGCThe sequence of TTATCAGCTCAGATAGC underscore is Restriction Enzyme Not I point of contact), utilize round pcr amplification complete genome sequence, the PCR reaction conditions is: 95 ℃ of 5min; 95 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 90s, 35 circulations; 72 ℃ of 10min;

(3) according to the sequences Design primer (forward primer: GCTATCTGAGCTGATAA of plasmid pPAN7-1 (Punt et al.1987 Gene 56:117-124) GCGGCCGCGGATCCACTTAACGTTA, the sequence of underscore is Restriction Enzyme Not I point of contact; Reverse primer: GTTTAAACTCGAGTGGAGATGTGGAGTGGGCGC, the sequence of underscore is Restriction Enzyme PmeI point of contact), utilize round pcr to amplify tryptophan synthetase terminator TtrpC, the PCR reaction conditions is: 95 ℃ of 5min; 95 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 60s, 35 circulations; 72 ℃ of 10min;

(4) each the 1 μ L of reaction solution that gets (2) and (3) is as template, with (TG ACTAGTATGTTGTTCAACTACCAATCTTT) as forward primer; With ( GTTTAAACTCGAGTGGAGATGTGGAGTGGGCGC) as reverse primer, carry out pcr amplification, the reaction conditions of PCR is: 95 ℃ of 5min; 95 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 150s, 35 circulations; 72 ℃ of 10min.After reaction finishes, pcr amplification product is carried out gel column reclaim, and be cloned into PMD-18-T: carrier obtains intermediate carrier PMD-18-T::PEL-TtrpC;

(5) according to the plasmid pPAN7-1 (sequences Design primer (forward primer: GA of Punt et al.1987 Gene 56:117-124 GTCGACThe sequence of GAATTCCCTTGTATCTCTACACAC underscore is Restriction Enzyme Not I point of contact; Reverse primer: GA ACTAGTThe sequence of CTGCTCAAGCGGGGTAGCTGTTAGT underscore is Restriction Enzyme PmeI point of contact) utilize round pcr amplification strong promoter PgpdA.The PCR reaction conditions is: 95 ℃ of 5min; 95 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 150s, 35 circulations; 72 ℃ of 10min.The corresponding site that utilizes restriction enzyme Sal I and Spe I that PgpdA is cloned into carrier PMD-18-T::PEL-TtrpC obtains intermediate carrier PMD-18-T::PgpdA-PEL-TtrpC (as shown in Figure 4);

(6) utilize restriction restriction endonuclease Sal I and Pme I that carrier PMD-18-T::PgpdA-PEL-TtrpC is digested, reclaim expression cassette PgpdA-PEL-TtrpC, be cloned into the corresponding site of pCHAMBIA2302 then, obtain final carrier pCHAMBIA2302::PgpdA-PEL-TtrpC (as shown in Figure 5), whole building process as shown in Figure 6;

(7) bacterium that contains final carrier pCHAMBIA2302::PgpdA-PEL-TtrpC is carried out enlarged culturing, and extracting plasmid, utilize freeze-thaw method to transform engineering Agrobacterium EHA105, random choose 6 strain transformants, with (TGACTAGT ATGTTGTTCAACTACCAATCTTT) as forward primer; As reverse primer, with the positive contrast of carrier PMD-18-T::PEL-TtrpC, the negative contrast of empty EHA105 is carried out PCR to this 6 strain bacterium and is identified that the result shows that this 6 strain bacterium is all positive, sees Fig. 7 with (TGGATCCGCGGCCGCTTATCAGCTCAGATAGC).

The acquisition of embodiment two, mould genetic engineering bacterium

The activity of described mould genetic engineering bacterium comprises following step:

(1) the wild-type mould after the picking separation and purification is inoculated on the PDA flat board, in 28 ℃ of cultivations about 20 days, washes ripe spore with sterilized water;

(2) the engineering Agrobacterium EHA105 that contains whole carrier pCHAMBIA2302::PgpdA-PEL-TtrpC in the example one is inoculated in the LB liquid nutrient medium that contains Streptomycin sulphate, kantlex (being 100 μ g/ml) 28 ℃, the 200rpm incubated overnight, reactivate with the MM substratum that contains Streptomycin sulphate and kantlex (being 100 μ g/ml), 28 ℃, 220rpm cultivated 48 hours.Draw the centrifugal supernatant that goes of an amount of culture 5000rpm, and, be diluted to OD600=0.15 with the IM liquid nutrient medium at last,, cultivated 6-8 hour under the condition of 220rpm, to OD600=0.5-0.6 then at 28 ℃ with the washing of IM liquid nutrient medium;

(3) the fresh spore that (1) step was obtained is mixed with 1 * 10 ⁷The suspension of individual/mL concentration, getting above-mentioned spore suspension subsequently mixes with engineering Agrobacterium equal-volume in the step (2), getting 200 μ L evenly is applied on the IM solid medium (containing AS 200 μ g/mL) that is covered with glassine paper, cultivate 60h altogether for 28 ℃, then counter being taped against of glassine paper contained Totomycin (100 μ g/mL transform and select microbiotic), cynnematin (500 μ g/mL, inhibition Agrobacterium growth microbiotic) cultivated 2 days for 28 ℃ on the PDA substratum, take glassine paper off, under 28 ℃ of conditions, cultivated 1-3 days, with the transformant of moisture resistance mycin choose be inoculated into two the sieve substratum on, go down to posterity as stable, promptly be described mould genetic engineering bacterium, so obtained 30 strain mould genetic engineering bacteriums.Random choose 5 strain transformants carry out enlarged culturing, and difference extracting genomic dna, with (TG ACTAGTATGTTGTTCAACTACCAATCTTT) as forward primer; With ( GTTTAAACTCGAGTGGAGATGTGGAGTGGGCGC) as reverse primer, with the positive contrast of carrier PMD-18-T::PEL-TtrpC, the negative contrast of wild-type mould genomic dna is carried out PCR to this 5 strain bacterium and is identified that the result shows that this 5 strain bacterium is all positive, sees Fig. 8.

The composition of MM substratum is as described below:

1M K ₂HPO ₄-KH ₂PO ₄(PH7.0) 10mL, M-N (MgSO ₄7H ₂O 30g/L, NaCl 15g/L) 20mL, 1%CaCl ₂2H ₂O 1mL, 20% glucose 10mL, 0.01%FeSO ₄10mL, Spore element (ZnSO ₄7H ₂O 100mg/L, CuSO ₄5H ₂O 100mg/L, H ₃BO ₃100mg/L, MnSO ₄H ₂O 100mg/L, Na ₂MoO ₄2H ₂O 100mg/L) 5mL, 20%NH ₄NO ₃2.5mL, sterilized water 941.5mL.

The composition of IM substratum is as described below:

1M K-buffer (PH4.9) 10mL, M-N (MgSO ₄7H ₂O 30g/L, NaCl 15g/L) 20mL, 1%CaCl ₂2H ₂O 1mL, 20% glucose 10mL, 0.01%FeSO ₄10mL, Spore element (ZnSO ₄7H ₂O 100mg/L, CuSO ₄5H ₂O 100mg/L, H ₃BO ₃100mg/L, MnSO ₄H ₂O 100mg/L, Na ₂MoO ₄2H ₂O 100mg/L) 5mL, 20%NH ₄NO ₃2.5mL, 50% glycerine 10mL, 1M MES (PH5.5) 40mL, 100mM AS (Syringylethanone) 2mL, sterilized water 898.7mL

The CM substratum: add the glucose amount of half IM substratum, add 1.5% agar, other composition is with the IM substratum.

PDA substratum (g/L): potato, 200; Sucrose, 20; Agar, 15; The PH nature.

Embodiment three, yielding lipase ability contrast experiment

The mould genetic engineering bacterium of random choose example 2 gained is inoculated on the PDA substratum, cultivate and insert respectively among the seed culture medium 50mL after 10 days, at 28 ℃, the 210rpm shaking table is cultivated 24h, change fermention medium (the bottled 30mL fermention medium of 250mL triangle) respectively over to 10% inoculum size then, at 28 ℃, 210rpm condition bottom fermentation 48h; Then that fermented liquid is centrifugal, get supernatant liquor and carry out the lipase activity detection.

Utilize acid base titration that lipase activity is detected.

Step:

Get 20 of 100mL triangular flasks, add Gly-NaOH damping fluid and the 5.0mL sweet oil emulsion of 4.0mL pH9.4 respectively; Put into concussion thermostat water bath 36 ℃ of water-bath preheatings 5 minutes. after enzyme liquid filters, dilute with the Gly-NaOH damping fluid of 0.05mol/L pH9.4 that to make enzyme work be to measure behind the 4-5u/mL.Toward wherein two respectively add 1mL and dilute good enzyme liquid, slowly vibration (60 times/min) 10 minutes (accurately timing). do blank for other two bottles. add 95% alcohol 20mL (blank adds 1mL and dilutes good enzyme liquid) immediately, shake up, add the sodium chloride solution of 10mL30%, shake up; Make its pH identical with 0.01mol/LNaOH drips of solution random sample product, write down the 0.01mol/LNaOH consumption with blank.

Calculate

X＝A×B×1/T×n

In the formula:

The enzyme activity of X---sample (u/g or u/mL);

A---the volume of quota of expenditure 0.01mol/LNaOH (mL) during the titration sample;

B---the titration concentration (μ mol/mL) of NaOH

T---time of enzymatic reacting (min),

N---extension rate;

Do simultaneously two parts parallel, results averaged, gained is the result represent to integer.The parallel test relative error must not surpass 5.0%.

PDA substratum (g/L): potato, 200; Sucrose, 20; Agar, 15; The PH nature

Seed culture medium (%): soybean cake powder 4, W-Gum 0.8, Na NO ₃0.3, Na ₂HPO ₄0.2, K ₂SO ₄0.25, MgSO ₄0.03, FeSO ₄0.003

Fermention medium (%): soybean cake powder 6, W-Gum 1, NaNO ₃0.4, Na ₂HPO ₄0.2, K ₂SO ₄0.3, MgSO ₄0.035, FeSO ₄0.02, CaCO ₃0.5, Na ₂CO ₃0.02

Producing of sweet oil emulsion: 4%PVA solution and sweet oil are 2: 1 (v/v), are put into (outsourcing ice cube) in the little triangular flask, and being adjusted into rotating speed is 10000 rev/mins, an emulsification 3 minutes, and 3 minutes at interval, emulsification was 3 times altogether.

The enzyme activity determination of transgenosis mould and non-transgenic mould the results are shown in following table

Wherein, WT is the mould wild type strain, T1, and T2, T3, T4, T5: be mould transformant independently, as seen from the figure, the enzyme activity of transgenosis mould is significantly higher than the enzyme activity of non-transgenic mould.

Embodiment four, described lipase control rat non-alcoholic fatty liver disease experimental study

One, test materials

1. be subjected to reagent thing and reagent

Lipase (ZFM) is subjected to reagent, the 0.4g/ grain, and 40 every bottle, everyone each 3～4,3 times on the one, promotion association provides lot number by Chinese Medicine industry scientific research and development: 081223.Adult's (calculating with the 60Kg body weight) day dosage is 4800mg, and promptly people's per kg body weight per day consumption is 80mg/kg.Grind earlier during experiment, use 0.5% Xylo-Mucine (CMC) to press design concentration again and prepare with an amount of tween.

Positive drug: Essentiale N/Essentiale Forte N (Polyene Phosphatidylcholine capsule), 228mg/ grain, 2/time, 3 times/d, 24/box.Sai Nuofeianwante (Beijing) pharmaceutical Co. Ltd, lot number: D8139, the accurate word of traditional Chinese medicines: H20059010.Grind earlier during experiment, use 0.5% Xylo-Mucine (CMC) to press design concentration again and prepare with an amount of tween.

Cholesterol (analytical pure level), the Long Huagongshijichang of Chengdu section, lot number: 20071229; Tween-80 (chemical pure), the Long Huagongshijichang of Chengdu section, lot number: 20050402; Sodium cholic acid (Sodium Taurochlate), Shanghai Solarbio, lot number: 20060826; The propylthiouracil sheet, 100 slices/bottle of 50mg/ sheet X, Shanghai Fosun Zhaohui Pharmaceutical Co., Ltd., lot number: 071105, the accurate word H31021082 of traditional Chinese medicines, 1,2 propylene glycol (analytical pure), Tianjin Da Mao chemical reagent factory, lot number: 20051128; Xylo-Mucine, Shanghai San Pu chemical industry company limited, lot number: 20010911.

2. experiment grouping and dosage design

The dosage grouping sees Table 1

Table 1 rat fat liver test dose and grouping

Annotate:, a dosage only can be set because of the ZFM investigational agent that provides is provided with three dosage groups unavoidably according to the administration cycle.

3. laboratory animal and place

The SD rat, male and female half and half, physique amount 230-250g carries arch by Beijing Vital River Experimental Animals Technology Co., Ltd.;

Experiment place: new drug portion of Chengdu Diao Pharmaceutical Group Co., Ltd pharmacological evaluation chamber.

4. key instrument

The LD2-5 medical centrifuge, Beijing Medical Centrifugal Machine Factory; The SHA-C constant temperature oscillator, Changzhou state Electrical Appliances Co., Ltd; The TMS-1024i automatic clinical chemistry analyzer, Japan's Tokyo medical company; BP221 type electronic balance, SARTORIOU.

5. statistical method

Carry out statistical study with the SPSS11.5 statistical software.So that (relatively, the nonparameter test analytical procedure was used in the test of significance of hepatopathy reason group difference between x ± s) data of ecbatic were organized with single factor variance analysis.

Two, experimental technique and result

1. experimental technique

Get the SD rat, body weight 230～250g, 64, male and female half and half are divided into 4 groups at random, 16 of every treated animals.After 3 days, every morning is respectively organized rat respectively by table 1 design dosed administration with the raising of rat adaptability, and blank group gives corresponding C MC suspension; All the other were respectively organized rat and irritated stomach respectively and give high fat liquor (20% lard, 8% cholesterol, 1.2% Sodium cholic acid and 0.6% propylthiouracil) 1ml/100g except that the blank group afternoon.Fasting 16 hours (can't help water) after the back last administration of the 4th week, eye socket is got blood, centrifugal and separation of serum, the serum biochemistry index after 4 weeks of dynamic measurement administration.

Fasting 16 hours (can't help water) after the back last administration of the 6th week takes by weighing rat body weight, and femoral artery is got blood, centrifugal and separation of serum ,-30 ℃ of cryopreservation, the biochemical indicator in the test serum; Other wins liver and weighs, after observing general appearance, every rat is downcut the 2g hepatic tissue in same area and places the physiological saline of precooling to make 10% liver homogenate, 4 ℃ leave standstill 48h after, 10000r/min, centrifugal 20min gets supernatant liquor, measures the content of triglyceride level in the hepatic tissue with full automatic biochemical apparatus; Other gets 1 of left lobe of liver and is put in 10% neutral formalin solution, waits to do liver histopathology inspection (after fixing, paraffin embedding is cut into slices and done HE dyeing).

2. experimental result

2.1 normal observation

The blank treated animal activity of experimental session, normal, bright clean and tidy, the body weight sustainable growth of fur of diet, all the other each groups give high fat liquor and engender after two weeks that in various degree One's spirits are drooping, movable reduces, weight increase is slow, unable, roll up, diet reduces, fur is in disorder, sallow etc. irritating stomach.

2.2 body weight and liver device coefficient determination

Results suggest, after the filling stomach gives high fat liquor some cycles, the model control group weight increase is slow, with the blank group significant difference (* * P＜0.01) is arranged relatively, all there is the increase of opposing rat body weight to act on trend slowly in ZFM dosage group and Essentiale N/Essentiale Forte N group 4 weeks before administration, but not statistically significant.

The liver index of fatty liver rat model is than obvious raise (* * P＜0.01) of blank group in addition; ZFM dosage group and Essentiale N/Essentiale Forte N group all have the effect trend of the liver device coefficient that reduces the fatty liver rat model, but meaningless.The results are shown in Table 2

Table 2 lipase is to the influence of rat fat liver body weight and liver device coefficient (X ± S)

Annotate: and model group is relatively, * P＜0.05, * * P＜0.01.

2.3 the content dynamic measurement of serum alt, AST the results are shown in Table 3

Table 3 lipase is to the influence of the content of rat fat liver serum alt, AST (X ± S)

Annotate: and model group is relatively, * P＜0.05, * * P＜0.01.

ALT mainly is present in the liver cytoplasm, and the specific activity serum of this enzyme is high 100 times in the liver, is that the most responsive liver function detects one of index.AST content in cardiac muscle is the highest, and liver is second, and AST mainly distributes in the hepatocellular plastosome, and when liver injury took place, its leakage was low than ALT.

When acute hepatitis and chronic hepatitis and light-duty, though hepatocellular damage is arranged, hepatocellular plastosome still is kept perfectly, thus be released into blood only be present in ALT in the liver cytoplasm, so that ALT raises is obvious; Hepatitis gravis and chronic hepatitis medium-sized and heavy, hepatocellular plastosome has also suffered serious destruction, and AST disengages in plastosome and endochylema, and SAT also obviously raises.

Results suggest is giving high 4 weeks of fat liquor, after 6 weeks, and active obviously blank organize obviously raise (* * P＜0.01) of fatty liver rat model serum alt; Compare with model control group, ZFM dosage group and Essentiale N/Essentiale Forte N group all can obviously reduce rat model ALT activity (* P＜0.05), show that ZFM has certain effect of reducing enzyme levels.

But AST obviously raises in the fatty liver rat model serum, the nonalcoholic fatty liver model that reason may cause by high fat liquor for us, and this model degree is lighter, and serious destruction is suffered at hepatocellular plastosome end.

2.4 liver naked eyes general appearance changing conditions

The visual inspection of blank group liver is bright red, clear-cut margin, smooth surface.Fatty liver model control group naked eyes see that liver volume increases, the edge rust, and color is milk yellow, and the greasy shape of tangent plane has obvious fat particle, and prompting pathology basis is the liver cell fat generation; ZFM administration tissue and the visual inspection of Essentiale N/Essentiale Forte N group liver have the part liver to be bright red.

2.5 the content results of triglyceride level sees Table 4 in the hepatic tissue

Table 4 lipase is to the influence of TG in the fatty liver liver tissues of rats (X ± S)

Annotate: and model group is relatively, * P＜0.05, * * P＜0.01.

A kind of pathological change that fatty liver master is the triglyceride level bulk deposition due to the liver, therefore the content of measuring triglyceride level in the hepatic tissue is particularly important, the result represents, content of triglyceride obviously raises in the non-alcoholic fatty liver disease rat hepatocytes, compare with the blank group, difference has highly significant (* * P＜0.01), ZFM dosage group and Essentiale N/Essentiale Forte N group, all can significantly reduce the content (* P＜0.05) of triglyceride level in the liver tissues of rats, show that ZFM has certain adipohepatic effect of reduction rat.

2.6 the liver histopathology analysis (HE dyeing, 100 *)

Table 5 hepatic tissue pathology damage judging criterion

Table 6 hepatopathy reason classification results (number is the example number in the table)

Table 7 lipase is to the influence of fatty liver rat liver pathology

Annotate: compare with model group: * P＜0.05, * * P＜0.01

By table 6 table 7 as can be known, model group and blank group relatively hepatocellular steatosis occurred, through nonparameter test, have utmost point significant difference (* * P＜0.01), show the modeling success; Compare with model group, lipase dosage group and Essentiale N/Essentiale Forte N group all can significantly reduce fatty degeneration of liver degree (* P＜0.05), show that lipase has the effect of certain reduction fatty liver rat fat sex change.

This experimental study is intended to irritate the stomach rat by high fat liquor, cause the non-alcohol simple fatty liver of rat model, examine or check the preventive and therapeutic effect of this investigational agent to the non-alcohol simple fatty liver of rat, experimental result shows, model control group and blank group are relatively, liver device coefficient, ALT activity, hepatic tissue content of triglyceride all significantly raise, the hepatopathy reason has also shown certain steatosis simultaneously, according to the Case definition of Professional Committee, this model belongs to non-alcohol simple fatty liver model; Lipase dosage group and model control group relatively can significantly reduce ALT activity and hepatic tissue content of triglyceride, also can alleviate adipohepatic degree simultaneously.

Claims (4)

1. lipase that effectively reduces body's cholesterol, blood lipid level, it is characterized in that: described lipase is obtained by following method:

(1) obtains hygromycin resistance expression cassette and being cloned on the target plasmid, obtain the recombinant plasmid of hygromycin resistance;

(2) increase the respectively lipase gene (PEL) of mould, the strong promoter glyceraldehyde 3-phosphate dehydro-genase promotor (PgpdA) and the Aspergillus nidulans tryptophan synthetase terminator (TtrpC) of Aspergillus nidulans obtain the PEL expression casette that strong promoter drives;

(3) this PEL expression casette is inserted in the recombinant plasmid of hygromycin resistance, has obtained to contain the PEL gene overexpression vector of hygromycin selection mark;

(4) the PEL gene overexpression vector that will contain the hygromycin selection mark transforms the engineering Agrobacterium, utilizes the agrobacterium mediation converted method that the PEL expression casette is transformed in the penicillium bacterial strain, obtains the mould genetic engineering bacterium of high expression level lipase;

(5) described mould genetic engineering bacterium is inserted seed culture medium with mycelium or spore suspension, under 25-35 ℃, 200-300rpm condition, cultivate after 24 hours, change fermention medium over to the 5%-20% inoculum size, after 2 days, obtain described lipase at 25-35 ℃, 150-300rpm condition bottom fermentation through separation and purification.

2. the lipase of a kind of effective reduction body's cholesterol according to claim 1, blood lipid level, it is characterized in that: wherein said Penicillium notatum is a penicillium expansum.

3. the lipase of a kind of effective reduction body's cholesterol according to claim 1, blood lipid level, it is characterized in that: described target plasmid comprises pCAMBIA1300, pCAMBIA2300, pCAMBIA3300 or pHB.

4. the application of the described lipase of claim 1 in the medicine of preparation reduction body's cholesterol, blood lipid level.

Images