CN102154213B - Novel cytokine-induced killer (CIK) cells for carrying cytokine loaded double-regulated oncolytic adenovirus - Google Patents
Novel cytokine-induced killer (CIK) cells for carrying cytokine loaded double-regulated oncolytic adenovirus Download PDFInfo
- Publication number
- CN102154213B CN102154213B CN2011100207696A CN201110020769A CN102154213B CN 102154213 B CN102154213 B CN 102154213B CN 2011100207696 A CN2011100207696 A CN 2011100207696A CN 201110020769 A CN201110020769 A CN 201110020769A CN 102154213 B CN102154213 B CN 102154213B
- Authority
- CN
- China
- Prior art keywords
- oncolytic adenovirus
- cell
- virus
- cik
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses novel CIK cells for carrying interleukin-2 (IL-2) loaded double-regulated oncolytic adenovirus and belongs to a method for preparing the novel CIK cells. The CIK cell can carry oncolytic adenovirus loaded with a cytokine such as (IL-2). After the oncolytic adenovirus is modified, an E1A promoter is replaced by a human telomerase reverse transcriptase (hTERT) promoter while E1B55-kD is deleted from the shuttle plasmid of the oncolytic adenovirus, and thus, the double regulation of the selective propagation of the oncolytic adenovirus in tumor cells are realized. Then, the shuttle plasmid is recombined with the skeleton plasmid pBHG-fiber5/35 of adenovirus to form the chimeric dynein structure of the coat of the oncolytic adenovirus, so that the ability of infecting the CIK cells by the oncolytic adenovirus is improved. After the CIK cells enter a body and kill tumor cells, the released oncolytic adenovirus can play a secondary tumor cell killing effect, the secreted cytokine IL-2, at the same time, can improve the antitumor ability of the CIK cells, and thus, a 'cell-virus-gene' synergetic antitumor effect is achieved. The CIK cells also reduce the side effects of whole body cytokines and the oncolytic adenovirus.
Description
Technical field
The present invention relates to genetically engineered and tumor biotherapy field.Specifically, the present invention relates to utilize transgenation and recombinant technology, lack the cilia protein of viral E1B55-kD albumen, the proteic expression of the viral E1A of regulation and control, transformation oncolytic adenovirus, to improve the ability and the security of oncolytic adenovirus target infection CIK cell.In oncolytic adenovirus, insert therapeutic gene IL-2 simultaneously; Through the CIK cell two regulation oncolytic adenovirus of load IL-2 are carried to the tumor tissues position; The Synergistic killing function of tumor of performance CIK cell, oncolytic adenovirus and cytokine; In antitumor action, avoided the spinoff of whole body application at intensifier target.
Background technology
Oncolytic adenovirus is rapid as a kind of special anti-tumor medicine and gene therapy vector development in recent years, and many efficient, target venereal disease poison get into clinical trial in succession, demonstrate wide application prospect.At present, got in the oncolytic virus of clinical trial, E1B-55kD protein delation type adenovirus Onyx-015 is considered to curative effect the best, the most promising a kind of oncolytic adenovirus.
Onyx-015 is the adenoviral gene medicine by U.S. Onyx pharmaceuticals exploitation in 1996, behind the adenovirus disappearance E1B-55kD albumen, can not in normal cell, duplicate, and in the tumour cell of p53 inactivation massive duplication, and dissolving tumour cell.In the I clinical trial phase, Onyx-015 treats the head and neck cancer patient of 14 routine conventional treatment failures, has 6 routine tumours obviously to dwindle, and the some cases state of an illness is improved, and does not see obvious adverse reaction.Yet in the II clinical trial phase, Onyx-015 treatment carcinoma of the pancreas 43 examples, gastrointestinal cancer 19 examples, ovarian cancer 16 examples, colorectal cancer with liver metastases 33 examples, metastasis cancer 9 examples all do not have tangible objective curative effect [1-3].
For improving the curative effect of oncolytic virus, Liu Xin wall academician is transformed into the carrier pZD55 that can insert antioncogene to Onyx-015, and along with virus duplicating in tumour cell, the antioncogene expression amount improves greatly.Though the oncolytic adenovirus ZD55 of load antioncogene tests in vivo and in vitro and all demonstrates better antitumor curative effect [4-5], but still can't eliminate tumour fully.Major cause is can receive the machine-processed removing of panimmunity after oncolytic virus gets into human body.The main medication of virus is intratumor injection or intravenous injection at present, because the effect of various immunity, biochemistry or physical barriers causes viral delivery efficiency very low [6,7].So, very soon by destructions such as complement, antiviral antibody and various phagocytic cells, can not bring into play the effective antitumour effect after virus gets in the body.How virus being transported to tumour accurately and efficiently has to be solved.
The researchist expects utilizing the vehicle of cell as virus; Be that virus infection and entering have in the cell of tumour recognition capability; The intravenous injection cell utilizes the taxis of cell to tumor tissues, helps virus to cross complicated blood environment and transports virus to tumor tissues.Cell carrier commonly used at present mainly contains three types: tumour cell, stem cell and T lymphocyte; But there are problems in these cell carriers; As obtain difficulty, security is low, the blood vessel penetrance is poor, the tumour recognition capability is single and cell increases in a large number difficulty etc., can't satisfy clinical requirement [8-10].Therefore, seeking and a kind ofly can escape immune clearance, effectively penetrate the novel cell carrier of blood vessel and tumor tissues barrier tumor tissues wide spectrum identification, protection virus, be the key of guaranteeing oncolytic virus performance therapeutic action.
(cytokine-induced killer cells CIK) has to the local chemotactic accumulative of tumor tissues characteristic cytokine induced kill cell, the heavy dose of security [11,12] that feeds back of a large amount of clinical application proof CIK cell.Therefore, utilizing the CIK cell is that an ideal is selected as the carrier of virus.[13] such as Thorne existed in 2006
" Science "Reported the research that utilizes CIK cell delivery vaccinia virus (vvDD).The result shows that the CIK cell successfully accurately is carried to the mouse tumor tissue site with vvDD, and effect obviously is superior to other kind cell carriers.
Virus must have stronger infection ability to carrier cell, could get into cell smoothly, and reach antitumor needed titre.5 type adenovirus (Ad5) commonly used are through cell surface COxsackie-adenovirus receptor (CAR) cells infected.But the low CAR that expresses of CIK cell, therefore utilizing Ad5 to infect the CIK cell effect maybe be not good.Research shows that people's 35 type adenovirus (Ad35) cells infecteds do not rely on the CAR acceptor, can efficiently infect lymphocyte and tumour cell [14,15].Utilize the knob of Ad35 cilia protein and the knob and the shaft of shaft replacement Ad5 cilia protein, the recombinant virus with mosaic type cilia protein of structure can infect T lymphocyte and NK cell [16,17] efficiently.Therefore, replace the adenovirus right arm plasmid pBHGE3 skeleton plasmid that reorganization is packed as virus, make recombinant virus have mosaic type cilia protein structure, can improve the ability of virus infection CIK cell with pBHG-fiber5/35.
Behind oncolytic adenovirus infection and the entering CIK cell,, weaken the antitumor action of CIK cell, also can't virus be carried to tumor tissues if virus is duplicated the dissolved destruction that will inevitably cause the CIK cell too early.Before address, the oncolytic adenovirus ZD55 of E1B-55kD protein delation can optionally breed in tumour cell, and normal cell is not almost had influence.For further controlling its toxic side effect to CIK cell and healthy tissues; Be utilized in the E1A gene promoter of highly active hTRT (hTERT) gene promoter replacement ZD55 in the tumour cell; Hope through the multiplication capacity of the strict limiting virus of dual regulation and control, and do not influence its propagation in tumour cell at the CIK cell.
Before address, oncolytic adenovirus load antioncogene will further improve its antitumor curative effect.But discover propagation such as IL-2 irritation cell poison T lymphocyte, NK cell in a large number, thereby strengthen body's immunological function, the control tumor growth reduces recurrence [18].But IL-2 whole body heavy dose produces serious toxic side effect when using, even causes patient death.With IL-2 gene transfection tumour cell, the IL-2 of merocrine secretion at transfectional cell not only can avoid systemic side effects, and can induce body to produce anti tumor immune response [19].Simultaneously, IL-2 still stimulates and induces mononuclearcell to generate the indispensable cytokine of CIK cell.
Therefore, utilize the oncolytic adenovirus of CIK cell transportation load IL-2 to get in the body, can avoid the destruction of body oncolytic adenovirus; Behind the CIK cell killing tumour cell, the oncolytic adenovirus that discharges can be brought into play the effect of secondary target killing tumor cell; Secreted cytokine IL-2 can strengthen the anti-tumor capacity of CIK cell simultaneously, triple synergistic antitumor effects of performance " cell-virus-gene ".Can also play the spinoff that effective minimizing whole body application cell factor and oncolytic adenovirus are caused.
Summary of the invention
The present invention relates to a kind of novel C IK cell that delivers two regulation oncolytic adenovirus of load IL-2.More particularly, CIK is antineoplastic effector cell in the present invention, is again the vehicle of oncolytic adenovirus.The oncolytic adenovirus that is delivered has following characteristics after recombination is transformed: the CIK cell is had stronger infectivity; Can guarantee that viral is bred in tumour cell; Load therapeutic gene.In an embodiment, the oncolytic adenovirus of CIK delivery is two regulation and control and the load IL-2 oncolytic adenovirus as therapeutic gene.
Technical scheme of the present invention is: a kind of novel C IK cell that delivers two regulation oncolytic adenovirus of load IL-2; With the skeleton plasmid of pBHG-fiber5/35 as the virus reorganization; Replace the E1A promotor of the oncolytic adenovirus shuttle plasmid pZD55 of E1B-55kD protein delation with tumour-specific hTERT promotor; And insert the IL-2 gene, be reassembled as two regulation oncolytic adenovirus of load IL-2.Behind the recombination oncolytic adenovirus infection CIK cell, it is carried to tumor locus by CIK, treat CIK killing tumor cell self death after, discharge oncolytic virus, the antitumor action of performance oncolytic virus and IL-2 has been avoided the spinoff of whole body application.Simultaneously, the local IL-2 that discharges can further stimulate the propagation and the activation of CIK cell again, strengthens the antitumor action of CIK.
Above-mentioned explanation and following instance only are as illustrating, not constituting limitation of the scope of the invention.That is to say, all through to the oncolytic adenovirus transformation, and with CIK as the oncolytic virus carrier all in scope of the present invention.
The invention has the beneficial effects as follows: utilize transgenation and recombinant technology; Lack the cilia protein of viral E1B55-kD albumen, the proteic expression of the viral E1A of regulation and control, transformation oncolytic adenovirus, improved the ability and the security of oncolytic adenovirus target infection CIK cell.In oncolytic adenovirus, insert therapeutic gene IL-2 simultaneously; Through the CIK cell two regulation oncolytic adenovirus of load IL-2 are carried to the tumor tissues position; The Synergistic killing function of tumor of performance CIK cell, oncolytic adenovirus and cytokine; In antitumor action, avoided the spinoff of whole body application at intensifier target.
Description of drawings
Fig. 1-1 MTT detects the propagation that different CIK cells in vitro suppress lung cell A549;
Fig. 1-2 MTT detects the propagation that different CIK cells in vitro suppress liver cancer cell HepG2;
Fig. 1-3 MTT detects the propagation that different CIK cells in vitro suppress cervical cancer cell HeLa;
Fig. 1-4 MTT detects the propagation that different CIK cells in vitro suppress kidney cancer cell ACHN;
Fig. 2-1 Annexin V dyeing detects different CIK cell induction ACHN apoptosis of tumor cells;
Fig. 2-2 DAPI dyeing detects different CIK cell induction HeLa apoptosis of tumor cells.
Among the above-mentioned figure, Fig. 1-1 is to Fig. 1-the 4th, and MTT detects the propagation that different CIK cells in vitro suppress tumour cell; Fig. 2-1 is to being Fig. 2-the 2nd, and Annexin V dyeing and DAPI dyeing detect different CIK cell induction apoptosis of tumor cells respectively.
Embodiment
Describe the present invention below in conjunction with preferred specific embodiment, but do not constitute limitation of the scope of the invention.That is to say, all to the oncolytic adenovirus transformation, and with CIK as the oncolytic virus carrier all in the scope of this patent.Use the present invention to treat various tumor diseases etc. also all in scope of the present invention.
1 one kinds of novel C IK cells that deliver two regulation oncolytic adenovirus of load IL-2 of embodiment
(1) utilize the hTERT promotor to replace the e1a gene promotor of oncolytic virus ZD55
(1) clone of hTERT promotor:
Design primer: P1:5 '-AT
CTCGAGTGG CCC CTC CCT CGG GTT AC-3 '
Xho?I
P2：5’-GC?
TACGTA?CGC?GGG?GGT?GGC?CGG?GGC?CA-3’
SnaB?I
To contain the pGL3-hTERT plasmid is template, and the pcr amplification condition is 94 ℃ of 1min, 55 ℃ of 1min, 72 ℃ of 1min.Pcr amplification obtains hTERT promoter gene fragment, and induce one Xho I and SnaB I restriction enzyme site.
(2) the e1a gene promotor of hTERT promoter gene replacement virus:
1. lack the e1a gene promotor:
The design primer:
P3：5’-?TCC?TGT?
GGATCC?GGG?CCC?CCA?TTT?C?-3’
BamH?I
P4：5’-?TTCAG
TACGTAGTCGACCTCGAGATATTACGCGCTATGAGT?AAC?AC?-3’
Complementary with P3
P5：5’-?TAT
CTCGAGGTCGACTACGTACTGAAAATGAGACATATTATC?-3’
Complementary with P2
P6：5’-?TACT?ACT?ATT?GCA?TTC?
TCTAGA?CAC?A?-3’
Xba?I
With the pXC1 plasmid is the template of PCR reaction, and primer P3 and P4 carry out the PCR reaction first time, and electrophoresis reclaims 394 bp fragments.With the pXC1 plasmid is the template of PCR reaction, and primer P5 and primer P6 carry out the PCR reaction second time, and electrophoresis reclaims 830 bp fragments.The product of twice PCR reaction has the 26bp complementary sequence, mixes as template with the twice PCR product, carries out PCR reaction for the third time with primer P3 and primer P6, and electrophoresis reclaims 1198 bp fragments.Cut the PCR product of 1198 bp with BamH I+Xba I enzyme, the clone advances the pZD55 plasmid that BamH I+Xba I enzyme was cut.
2. the hTERT promotor is inserted among the plasmid pZD55 of E1A promoter deletion:
Cut pcr amplification with Xho I and SnaB I enzyme and obtain hTERT promoter gene fragment, the clone advances in the plasmid pZD55 of the E1A promoter deletion that same enzyme was cut, called after pTERT-ZD55.
(2) structure of two regulation oncolytic adenovirus shuttle plasmid pTERT-ZD55-IL-2 of load IL-2
(1) cDNA of clone IL-2:
Design primer: P1:5 '-AT
AGATCTATG CAA CTC CTG TC-3 '
Bgl?II
P2：5’-?TA?
AGATCT?TTA?TGT?TGA?GAT?GAT?GC-3’
Bgl?II
With the pcDNA3-IL-2 plasmid is template, and pcr amplification obtains the cDNA of IL-2, and induce one Kpn I and Bgl II restriction enzyme site.
(2) make up plasmid pTERT-ZD55-IL-2:
The cDNA gene fragment of IL-2 is cut through Bgl II enzyme, and the clone advances the pTERT-ZD55 plasmid after Bgl II enzyme is cut, called after pTERT-ZD55-IL-2.
(3) skeleton plasmid pBHG-fiber5/35 and pTERT-ZD55-IL-2 shuttle plasmid are recombinated, and are packaged into the evaluation of intact virus
293 cells are laid on the 10cm petridish; Shuttle plasmid pTERT-ZD55-IL-2, pTERT-ZD55 and pTERT-ZD55-EGFP are passed through Effectene cotransfection to 293 cell with Ad5/F35 mosaic type adenoviral skeleton plasmid pBHG-fiber5/35 respectively; Virus plaque appearred in 9-14 days; Through the virus plaque purifying, increase, extract the DNA of recombinant adenovirus.Through pcr analysis, confirm the virus that reorganization is correct, obtain TERT-ZD55/F35-IL-2, TERT-ZD55/F35 and TERT-ZD55/F35-EGFP.
With identifying that correct virus infects HEK293 cell amplification virus respectively, CsCl gradient centrifugation purification virus, 50% TCID (TCID50) method survey titre.
(4) virus infection CIK cell
(1) cultivation of CIK cell:
Extract the peripheral blood 20ml of health adult, the Ficoll lymphocyte separation medium separates mononuclearcell, after saline water washs 2 times, regulates cell count to 1～2 * 10 with RPMI1640 (containing 10% foetal calf serum)
6/ ml added IFN-γ (1000U/ml), and was positioned over 37 ℃ of 5% CO on the 0th day
2Cultivate 24h in the incubator case, added IL-1 (100U/ml) on the 1st day, CD3 monoclonal antibody (15 μ g/ml), recombinant human il-2 (300U/ml) continues to cultivate, the 4th day additional fresh medium, regulating cell count is 1 * 10
6/ ml adds IL-2 (100U/ml), gets cell with the numeration of trypan blue exclusion method in the 0th day, the 7th day and the 14th day, and harvested cell was measured CD3 with FCM in the 15th day
+CD56
+Two positive cell percentage ratios.
(2) virus infection CIK cell:
(titre is 1 * 10 with TERT-ZD55/F35-IL-2, TERT-ZD55/F35 and TERT-ZD55/F35-EGFP recombinant virus
11Pfu) add to cultivate respectively in the mature C IK cell, make virus infection and getting in the cell.
(5) detect the CIK cells in vitro killing tumor cells effect that encapsulates virus
The CIK cell that loads different virus is acted on tumour cell respectively, and mtt assay detects cell-proliferation activity, and Annexin V dyeing and DAPI staining detect apoptosis.The result shows that the CIK of two regulation oncolytic adenovirus of load IL-2 obviously is superior to the CIK of simple CIK and load oncolytic adenovirus to the lethal effect of tumour cell.See Fig. 1-1 to 1-4 and Fig. 2-1 to 2-2.
Claims (4)
1. CIK cell that delivers two regulation oncolytic adenovirus of load IL-2; It is characterized in that: with the CIK cell as virus vector; The virus that is delivered is the two regulation oncolytic adenovirus TERT-ZD55/F35-IL-2 through the load IL-2 that transforms; The method of the transformation of TERT-ZD55/F35-IL-2 is: 1. at first utilize round pcr to obtain the gene fragment of hTERT promotor; The clone advances among the oncolytic adenovirus shuttle plasmid pZD55 of E1B-55kD protein delation then, and the promotor of replacement E1A protein gene is with its called after pTERT-ZD55; 2. the IL-2 cDNA that obtains of clone and it is cloned among the pTERT-ZD55, with its called after shuttle plasmid pTERT-ZD55-IL-2; 3. utilize the knob of Ad35 cilia protein and the knob and the shaft of shaft replacement Ad5 cilia protein, make up the skeleton plasmid of virus reorganization, called after pBHG-fiber5/35; 4. pTERT-ZD55-IL-2 and pBHG-fiber5/35 are through Effectene cotransfection to 293 cell; Through the virus plaque purifying; Evaluation obtains the correct virus of recombinating, and promptly has two regulation oncolytic adenovirus TERT-ZD55/F35-IL-2 of mosaic type cilia protein, load IL-2.
2. CIK cell as claimed in claim 1; It is characterized in that: the mononuclearcell that is used to make up novel C IK cell derives from the patient; Have the local chemotactic accumulative of tumor tissues characteristic, patient tumors is had identification and kill capability, can deliver virus safely, efficiently.
3. CIK cell as claimed in claim 1; It is characterized in that: two regulation oncolytic adenovirus shuttle plasmid pTERT-ZD55-IL-2 of described load IL-2 are in disappearance E1B55-kD; Utilize the hTERT promotor to replace the promotor of E1A protein gene, realize the dual regulation and control of virus selective proliferative in tumour cell.
4. CIK cell as claimed in claim 3; It is characterized in that: two regulation oncolytic adenovirus of described load IL-2 are with skeleton plasmid pBHG-fiber5/35 and two regulation oncolytic adenovirus shuttle plasmid pTERT-ZD55-IL-2 reorganization; The complete oncolytic virus in reorganization back has mosaic type cilia protein structure, can improve the ability of virus infection CIK cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100207696A CN102154213B (en) | 2011-01-19 | 2011-01-19 | Novel cytokine-induced killer (CIK) cells for carrying cytokine loaded double-regulated oncolytic adenovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100207696A CN102154213B (en) | 2011-01-19 | 2011-01-19 | Novel cytokine-induced killer (CIK) cells for carrying cytokine loaded double-regulated oncolytic adenovirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102154213A CN102154213A (en) | 2011-08-17 |
| CN102154213B true CN102154213B (en) | 2012-07-25 |
Family
ID=44435888
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011100207696A Expired - Fee Related CN102154213B (en) | 2011-01-19 | 2011-01-19 | Novel cytokine-induced killer (CIK) cells for carrying cytokine loaded double-regulated oncolytic adenovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102154213B (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105307671B (en) * | 2013-04-18 | 2020-09-04 | 蒂尔坦生物制药有限公司 | Enhancing adoptive cell therapy |
| CN105616448B (en) * | 2015-12-25 | 2019-08-02 | 浙江省人民医院 | SNS-032 is inhibiting the purposes in Cell Proliferation of Pancreatic Cancer Cell |
| CN105617400B (en) * | 2015-12-25 | 2019-08-02 | 浙江省人民医院 | Inhibit the pharmaceutical composition of Cell Proliferation of Pancreatic Cancer Cell |
| CN106978397A (en) * | 2016-01-18 | 2017-07-25 | 上海宇研生物技术有限公司 | A kind of people DC-CIK immunocompetent cells and preparation method thereof |
| CN108342366B (en) * | 2017-01-25 | 2022-01-21 | 上海元宋生物技术有限公司 | Recombinant oncolytic gene-adenovirus of targeted cancer and construction method and application thereof |
| CN107189989A (en) * | 2017-06-30 | 2017-09-22 | 贵州医科大学 | Oncolytic virus that a kind of immune effector cell is loaded and its preparation method and application |
| CN108753738B (en) * | 2018-06-19 | 2021-11-12 | 大连医科大学 | Oncolytic virus and application thereof |
| CN110272917B (en) * | 2019-06-24 | 2023-08-22 | 江苏万戎生物医药科技有限公司 | Rapid and accurate three-plasmid oncolytic adenovirus recombination packaging system Ad5MixPlus and application thereof |
| CN110747228A (en) * | 2019-11-12 | 2020-02-04 | 复百澳（苏州）生物科技有限公司 | Construction method of oncolytic adenovirus |
| CN111518833B (en) * | 2020-04-29 | 2023-01-31 | 徐州医科大学 | Construction method and application of oncolytic adenovirus carrying AIM2 gene |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1621550A1 (en) * | 2004-07-29 | 2006-02-01 | Dompé S.P.A. | Tumor-homing cells engineered to produce tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) |
| CN101063108A (en) * | 2007-04-25 | 2007-10-31 | 哈尔滨医科大学 | Preparation method for CIK cell with high proliferation and high cell cytotoxic activity |
| CN101418283A (en) * | 2007-10-23 | 2009-04-29 | 范云峰 | A kind of method of simple high efficiently preparing CIK cell |
-
2011
- 2011-01-19 CN CN2011100207696A patent/CN102154213B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102154213A (en) | 2011-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102154213B (en) | Novel cytokine-induced killer (CIK) cells for carrying cytokine loaded double-regulated oncolytic adenovirus | |
| Apolonio et al. | Oncolytic virus therapy in cancer: A current review | |
| Hemminki et al. | Oncolytic viruses for cancer immunotherapy | |
| Russell et al. | The emerging role of oncolytic virus therapy against cancer | |
| Jhawar et al. | Oncolytic viruses—natural and genetically engineered cancer immunotherapies | |
| Pol et al. | Trial Watch—Oncolytic viruses and cancer therapy | |
| Guse et al. | Oncolytic vaccinia virus for the treatment of cancer | |
| Vacchelli et al. | Trial watch: Oncolytic viruses for cancer therapy | |
| Keller et al. | Oncolytic viruses—immunotherapeutics on the rise | |
| Yaghchi et al. | Vaccinia virus, a promising new therapeutic agent for pancreatic cancer | |
| Alemany | Viruses in cancer treatment | |
| Beljanski et al. | The use of oncolytic viruses to overcome lung cancer drug resistance | |
| Liu et al. | Strategy of Cancer Targeting Gene-Viro-Therapy (CTGVT) a trend in both cancer gene therapy and cancer virotherapy | |
| Tedcastle et al. | Virotherapy–cancer targeted pharmacology | |
| Satoh et al. | In situ gene therapy for prostate cancer | |
| Oliva et al. | Systemic virotherapy for multiple myeloma | |
| Wang et al. | Oncolytic virotherapy evolved into the fourth generation as tumor immunotherapy | |
| Wu et al. | ING4 expressing oncolytic vaccinia virus promotes anti-tumor efficiency and synergizes with gemcitabine in pancreatic cancer | |
| Huang et al. | Targeted genetic and viral therapy for advanced head and neck cancers | |
| Guo | The impact of hypoxia on oncolytic virotherapy | |
| Clayman et al. | Injectable modalities as local and regional strategies for head and neck cancer | |
| Dent et al. | Searching for a cure: gene therapy for glioblastoma | |
| Mohamadi et al. | The important role of oncolytic viruses in common cancer treatments | |
| Spencer et al. | Unlocking the promise of oncolytic virotherapy in glioma: combination with chemotherapy to enhance efficacy | |
| Yang et al. | Combinatory effects of vaccinia virus VG9 and the STAT3 inhibitor Stattic on cancer therapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120725 Termination date: 20130119 |