CN102154152B

CN102154152B - Laccase from Bacillus amyloliquefaciens LS05 and use thereof

Info

Publication number: CN102154152B
Application number: CN 201010599793
Authority: CN
Inventors: 卢磊; 赵敏; 王天女; 李泰仑; 杜美惠; 赵丽艳; 汪春蕾
Original assignee: Northeast Forestry University
Current assignee: Northeast Forestry University
Priority date: 2010-12-22
Filing date: 2010-12-22
Publication date: 2012-12-12
Anticipated expiration: 2030-12-22
Also published as: CN102154152A

Abstract

The invention discloses a preparation method, a catalytic property and use in dye decolorizing of spore laccase from Bacillus amyloliquefaciens LS05 (CGMCC No.4264). The invention also relates a nucleotide sequence for coding the spore laccase. In the invention, the Bacillus amyloliquefaciens LS05 ferments at 37 DEG C for 5 days on a solid sporulation culture medium, the spores are washed off with deionized water, and pore suspension with laccase activity can be obtained by series measures such as lysozyme treatment. The spore laccase has high catalytic activity under alkaline and high-temperature conditions, has good decolorizing effect on synthesized dyes of different structures under action of an amboceptor and can be used for treating industrial dye waste water.

Description

Bacillus amyloliquefaciens LS05 laccase and application thereof

Technical field

The present invention relates to a kind of bacterial laccase, be specifically related to the preparation and the catalytic property of the gemma laccase of a bacillus amyloliquefaciens LS05, and the nucleic acid fragment of this gemma laccase of encoding.In addition, the invention still further relates to the method that this gemma laccase makes the synthetic dyestuff decolouring, belong to the using microbe field.

Background technology

Laccase (EC 1.10.3.2) is a kind of copper bearing polyphenoloxidase, and the aromatic compound of the multiple structure of cupric ion catalyzed oxidation in its active site capable of using is reduced into water with molecular oxygen simultaneously.Because the catalytic substrate scope of laccase very extensively, so the laccase enzyme has been widely used in the fields such as biological prosthetic of paper industry, textile industry, foodstuffs industry and soil.

Laccase catalyzed oxidation substrate generally comprises two kinds of modes of action, first kind be substrate molecule directly and bunch reaction of laccase copper be oxidized to corresponding excited state molecule.Yet some substrate can not be by the laccase direct oxidation, and reason is that their molecules can not penetrate into the reactive site of enzyme too greatly, perhaps can not be by the laccase direct oxidation because its redox potential is higher.The second way of laccase oxidation substrates is to be media through some micromolecular amboceptor materials; Laccase is oxidized to excited state with the small molecules amboceptor earlier; Then the amboceptor of these excited state again with substrate reactions macromolecular or that redox potential is higher, this mode also is called as laccase-mediator system (LMS).The application of laccase-mediator system helps further to enlarge the substrate scope of laccase, improves the industrial applicability of laccase.

At occurring in nature, laccase is distributed widely in plant, fungi and the bacterium, and particularly fungi is the main producer of present laccase.Though at present the theoretical investigation of bacterial laccase is goed deep into not as fungal laccase, bacterium has the advantages that growth is fast, be easy to cultivate, bacterial laccase has better stability than the fungi laccase under alkaline environment and high temperature.Because general temperature such as industrial paper waste is higher, alkalescence is stronger, and fungal laccase receives the restriction of poor stability in practical application, so bacterial laccase has the better application prospect in industry.

The existence of laccase in bacterium mainly contains three kinds of forms, that is: laccase becomes laccase with groups of cells in extracellular laccase, the cell.The enzyme of three kinds of forms of this that obtains, the active and stability of enzyme is different.Because intracellular enzyme needs broken wall to obtain, the enzymic activity reduction in broken born of the same parents' process of the laccase of this form is more obvious, and along with the broken various cell components of cell mix with laccase, also can bring difficulty to the purifying of enzyme; By comparison; Then advantage is obvious for two kinds of form laccases in addition; Especially groups of cells becomes laccase; The bacterium of gemma Pseudomonas normally, because bacterial spore has stronger resistance to multiple unfavorable factors such as high temperature, high pressure, extreme pH and high salt, it is stable with pH that this kind laccase can show better temperature stability because of the characteristic of this special tectonic of gemma.

Along with the continuous development of Protocols in Molecular Biology, numerous laccase genes has obtained the clone and has analysed in depth.The expression and regulation mechanism of research laccase encoding sox helps to illustrate different genes role in developmental process, in addition, can also transform laccase gene through technology such as site-directed mutagenesises, improves laccase industrial application performance.

Dyestuff is widely used in industries such as weaving, printing and dyeing, leather, and the whole world is annual to produce after ten thousand kinds of the dyestuffs, and the dyestuff that has 10-15% at least, does great damage to the ecotope of water body in physical environment through discharge of wastewater.Mostly the synthetic dyestuff that industry is used are aromatics, complex structure, difficult degradation.The treatment process of waste water from dyestuff mainly contains physico-chemical processes and biological treatment at present, and materialization treatment technology expense is high, has secondary pollution, and biological process becomes the method for administering preferably because of its economic environmental protection.Wherein laccase is owing to have substrate-function scope widely, but the dyestuff of the multiple structure of catalyzed degradation has application promise in clinical practice on industrial dye waste water is handled.Existing much about the research of the laccases decolouring dyestuff of using whiterot fungi or other originated from fungus, but less about bacterial laccase and bacterial laccase-mediator system at the research report aspect dye decolored.Through the decolorizing effect of research bacterial laccase, can further promote the industrial application of bacterial laccase to different synthetic dyestuff

Summary of the invention

The object of the invention provides a kind of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) LS05; The present invention also aims to provide a kind of bacillus amyloliquefaciens (Bacillusamyloliquefaciens) LS05 to produce the preparation of gemma laccase simultaneously, and the method that provides a kind of gemma laccase that utilizes bacillus amyloliquefaciens (Bacillus amyloliquefaciens) LS05 to produce to decolour synthetic dyestuff.

Bacillus amyloliquefaciens provided by the invention (Bacillus amyloliquefaciens) LS05 has been preserved in (No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms common micro-organisms center on October 22nd, 2010; Institute of Microorganism, Academia Sinica), deposit number is CGMCCNo.4264.

Above-mentioned bacillus amyloliquefaciens bacterial strain is the forest topsoil separation acquisition from Heilongjiang Province of China Yichun cold water national natural reserves.Bacillus amyloliquefaciens LS05 bacterial strain Gram-positive is given birth to amphitrichous in the gemma.On solid Luria-Bertani (LB) substratum, cultivate 24h for 37 ℃, the little yellow of bacterium colony, flat rounded, bacterium colony surface drying, smooth, it is lobate that colony edge is, the opaque and positive and negative solid colour of bacterium colony.The optimum growth temperature of bacterial strain is 37 ℃, and the righttest growth pH is 7.0, can tolerate the NaCl of 1%-13%.

The invention provides bacillus amyloliquefaciens LS05 and produce the product spore culture medium prescription of gemma laccase and the preparation of gemma laccase.

Above-mentioned product spore culture medium prescription (g/L) is: nutrient broth 8; KCl 1; MgSO ₄7H ₂O 0.25; MnCl ₂4H ₂O 0.002; Agar 17; Autoclave sterilization behind the accent pH7.0, the 0.5mmol/LCaCl of adding filtration sterilization ₂And 0.001mmol/L FeSO ₄

The preparation method of above-mentioned gemma laccase is:

1) bacillus amyloliquefaciens LS05 streak inoculation is produced on the spore substratum in solid, after 5d is cultivated in 37 ℃ of inversions.

2) with aseptic deionized water the gemma on the solid medium is washed.

3) N,O-Diacetylmuramidase of adding final concentration 0.1mg/mL, 37 ℃ of water-bath 10min.

4) successively with the 1mol/L NaCl that contains 10mmol/L EDTA and 0.3mg/mL PMSF, 0.14mol/L NaCl and 0.1% (w/v) SDS cleans one time.

5) clean one time with aseptic deionized water.

6) clean three times with aseptic deionized water behind 80 ℃ of water-bath thermal shock 10min.

7) get a certain amount of suspension after, with all the other suspensions pack into the sterilization after triangular flask in, 4 ℃ keep in Dark Place.

8) suspension that takes out is placed in 80 ℃ of baking ovens dry to constant weight, calculate gemma suspension concentration (mg/ml), and record.

The gemma laccase that bacillus amyloliquefaciens LS05 of the present invention produces can play a role in pH value 2.2-10.0 scope, and the optimum pH of the different substrates of catalysis is different: when being substrate with ABTS, enzyme is lived the highest when pH3.0; When being substrate with the syringaldazine, enzyme is lived the highest when pH6.6; With 2, when the 6-syringol was substrate, enzyme was lived the highest when pH8.6.The gemma laccase that bacillus amyloliquefaciens LS05 of the present invention produces has stability preferably under alkaline condition, 30 ℃ of insulations active basic not loss in 10 days under the condition of pH10.0.Most fungal laccases can be lost enzyme under this alkaline condition alive, because paper industry much adopts alkaline process, makes paper waste alkalescence higher, and this gemma laccase fabulous stability under alkaline condition helps it and in processing such as paper waste, brings into play useful effect.

The enzymatic reaction TR of the gemma laccase that bacillus amyloliquefaciens LS05 of the present invention produces is wider; Its optimum temperuture is 70 ℃; Between 40-80 ℃, can keep higher activity; Even under 100 ℃ high temperature, still can keep 35.32% of the highest enzyme work, fungal laccase completely loses activity basically under this temperature.Simultaneously, this gemma laccase has thermostability preferably, and behind insulation 4h under 50 ℃, 60 ℃ and 70 ℃, its enzyme work is respectively 88.36%, 58.35% and 41.64% of initial activity, and remnant enzyme activity is 15.55% behind 80 ℃ of insulation 4h.This gemma laccase at high temperature satisfactory stability property has very big actual application value in industry.Metallic cation has bigger influence to the activity of said laccase, like Na ⁺, K ⁺, Li ⁺, Mg ²⁺And Ca ²⁺Its activity there is activation, and Ag ⁺, Cu ²⁺, Mn ²⁺, Fe ³⁺And Hg ²⁺Work has restraining effect to enzyme, wherein Ag ⁺, and Mn ²⁺Can make gemma laccase complete deactivation of the present invention.Gemma laccase activity change under the NaCl of different concns that bacillus amyloliquefaciens LS05 of the present invention produces is bigger; 0.01mol/L following NaCl has promoter action to the activity of said gemma laccase; Along with the increase activity of NaCl concentration descends gradually,, concentration still can keep 36.5% of original activity when existing up to the NaCl of 1mol/L.

The gemma laccase that bacillus amyloliquefaciens LS05 of the present invention is produced has decolorization preferably to the industrial synthetic dyestuff of chemical structures.In the presence of amboceptor Syringylethanone, when pH6.6, the percent of decolourization behind RBBR, HFGR REACTIVE Black HFGR KN-B, isatin and the Viola crystallina 6h is respectively 84.75%, 91.58%, 95.92% and 88.96%.When pH9.0, the percent of decolourization behind RBBR, HFGR REACTIVE Black HFGR KN-B, isatin and the Viola crystallina 6h is respectively 96.05%, 95.54%, 95.16% and 95.89%, explains that this gemma laccase has still kept higher decoloring ability to various dyestuffs under alkaline environment.

Bacillus amyloliquefaciens laccase gene provided by the present invention comes from bacillus amyloliquefaciens LS05, and CGMCC No.4264 is one of following nucleotide sequences:

1) dna sequence dna of SEQ ID No:1 in the sequence table;

2) polynucleotide of SEQ ID No:2 protein sequence in the code sequence tabulation;

3) dna sequence dna with sequence table SEQ ID No:1 qualification has the homology more than 90%, and coding identical function protein DNA sequence.

The present invention also relates to polypeptide, it has laccase activity and coded by the nucleic acid molecule of above-mentioned definition.The invention further relates to polypeptide, its aminoacid sequence is identical or homologous with the aminoacid sequence of SEQ ID No:2 in the above described manner.

Bacillus amyloliquefaciens provided by the present invention (Bacillus amyloliquefaciens) LS05 can prepare the gemma suspension with laccase activity through fermentation culture, and this preparation method is simple to operate, and cost is lower.Prepared gemma laccase has pH and temperature catalysis scope widely, under alkalescence and hot conditions, has preferably stablely, has more superior suitability than the laccase of originated from fungus.In the presence of amboceptor material Syringylethanone; This gemma laccase can effectively decolour to the synthetic dyestuff of chemical structures; Under alkaline condition, still kept decolorizing effect preferably, therefore gemma laccase provided by the invention has application promise in clinical practice in the processing of industrial dye waste water.

Description of drawings

Fig. 1 be when being substrate with ABTS pH to the influence of bacillus amyloliquefaciens LS05 gemma laccase activity;

Fig. 2 be when being substrate with the syringaldazine pH to the influence of bacillus amyloliquefaciens LS05 gemma laccase activity;

Fig. 3 is with 2, and pH was to the influence of bacillus amyloliquefaciens LS05 gemma laccase activity when the 6-syringol was substrate;

Fig. 4 is bacillus amyloliquefaciens LS05 gemma laccase enzyme under pH10.0 time history plot alive;

Fig. 5 is the influence of differing temps to bacillus amyloliquefaciens LS05 gemma laccase activity;

Fig. 6 is bacillus amyloliquefaciens LS05 gemma laccase active stability in the time of 50-80 ℃;

Fig. 7 is the influence of the NaCl of different concns to bacillus amyloliquefaciens LS05 gemma laccase activity;

Bacillus amyloliquefaciens LS05 gemma laccase was the decolouring result of amboceptor to RBBR, HFGR REACTIVE Black HFGR KN-B, isatin and Viola crystallina with the Syringylethanone when Fig. 8 was pH6.6

Bacillus amyloliquefaciens LS05 gemma laccase was the decolouring result of amboceptor to RBBR, HFGR REACTIVE Black HFGR KN-B, isatin and Viola crystallina with the Syringylethanone when Fig. 9 was pH9.0

Embodiment

Following embodiment is in order to understand the present invention better.

Used test materials in following examples like no specified otherwise, is the biochemical reagents that can buy.Wherein bacterial genomes extraction test kit and glue recovery test kit are the Omega Company products, and T carrier and other toolenzymes etc. are the TaKaRa Company products.

Said enzyme liquid in the following embodiment all is bacillus amyloliquefaciens LS05 gemma laccases of preparing according to gemma laccase preparation method.

The enzyme activity determination method is meant with absorbancy behind spectrophotometer detection laccase and the substrate reactions, calculates laccase activity.Described substrate is a syringaldazine, 2,2-azine-two (3-ethyl benzothiazole-6-sulfonic acid) (ABTS) or 2, the 6-syringol.

It is that the required enzyme amount of product is an enzyme activity unit that the activity of enzyme is defined as PM oxidation 1 μ mol substrate.Reaction system is following:

(1) ABTS: reaction system contains 1mmol/L ABTS, 100 μ L gemma suspensions, and Hydrocerol A-phosphate buffered saline buffer (0.1mol/L, pH 3.0), TV 3mL, behind 30 ℃ of reaction 3min at 420nm place the mensuration light absorption value.

(2) syringaldazine: reaction system contains the 0.1mmol/L syringaldazine, 100 μ L gemma suspensions, and Hydrocerol A-phosphate buffered saline buffer (0.1mol/L, pH 7.0), TV 3mL, behind 30 ℃ of reaction 3min at 525nm place the mensuration light absorption value.

(3) 2,6-syringol: the system of answering contains 2mmol/L 2, the 6-syringol, 100 μ L gemma suspensions, and Hydrocerol A-phosphate buffered saline buffer (0.1mol/L, pH 7.0), TV 3mL, behind 30 ℃ of reaction 5min at 468nm place the mensuration light absorption value.

The character of embodiment 1 bacillus amyloliquefaciens LS05 gemma laccase

1.pH value is to the influence of gemma laccase activity with stability

PH adopts pH2.2-7.8 Hydrocerol A-phosphate buffered saline buffer (0.1mol/L), pH7.4-9.0Tris-HCl (0.05mol/L) damping fluid and pH8.6-10.0 glycocoll-sodium hydrate buffer solution (0.05mol/L) to measure to the influence of laccase activity; PH to the influence of laccase stability through 30 ℃ the time with laccase and pH3.0, Hydrocerol A-phosphate buffered saline buffer of 7.0, measure remaining activity after mixing placement 1-10d in the Tris-HCl damping fluid of pH9.0 and the pH10.0 glycocoll-sodium hydrate buffer solution.Fig. 1-3 shows that gemma laccase provided by the invention catalysis is in extensive range, but all catalytic substrate reactions in the scope of pH2.2-10.0, and with ABTS, the ph optimum that syringaldazine and 2,6-syringol record during for substrate is respectively 3.0,6.6 and 8.6.Fig. 4 shows that bacillus amyloliquefaciens LS05 gemma laccase has better stability in the environment of pH10.0, still can keep 99.34% activity behind the 10d, does not have loss of activity basically.

2. temperature is to the influence of gemma laccase activity with stability

Temperature is being measured in 20-100 ℃ of scope under the ph optimum the influence of laccase activity.The thermal stability determination of laccase is measured remaining activity behind 50-80 ℃ of placement 0-10h in Hydrocerol A-phosphate buffered saline buffer of pH6.6.Fig. 5 shows; The optimal reactive temperature of bacillus amyloliquefaciens LS05 gemma laccase is 70 ℃; Can find out from Fig. 6, still can keep 67.92% activity, active residue 24.52% behind the insulation 10h even bacillus amyloliquefaciens LS05 gemma laccase is incubated 2h under 70 ℃ of high temperature.

3. metals ion is to the influence of gemma laccase activity

In reaction system, add common metals ion respectively, making its final concentration is 10mmol/L, at 30 ℃ of insulation 5min, is blank with the reaction system that does not add metals ion, is that substrate is surveyed enzymic activity with the syringaldazine by ordinary method then.

4.NaCl influence to the gemma laccase activity

With the NaCl solution uniform mixing of bacillus amyloliquefaciens LS05 gemma laccase and different concns, behind 30 ℃ of incubation 5min be that substrate is measured remaining activity with the syringaldazine.Fig. 7 result shows that the NaCl below the 0.01mol/L has promoter action to bacillus amyloliquefaciens LS05 gemma laccase activity property, and activity descends gradually when concentration increases.When NaCl concentration rose to 1mol/L, activity still can keep about 36.5%.

Embodiment 2 bacillus amyloliquefaciens LS05 gemma laccases are to the decolouring of synthetic dyestuff

1. the calculating of the reaction system of decolorization experiment and percent of decolourization

The experiment reaction system is 6ml, in system, adds pH 6.6 Hydrocerol As-phosphate buffered saline buffer (0.1 mol/L), dyestuff (kind and final concentration are seen table 1), bacillus amyloliquefaciens LS05 gemma laccase (final concentration is 1mg/ml) and Syringylethanone (final concentration is 0.1mmol/L) successively.Be blank with the reaction system that does not add bacillus amyloliquefaciens LS05 gemma laccase simultaneously.Timing sampling, 12000rpm surveys the light absorption value under each dyestuff maximum absorption wavelength (seeing table 1) behind the centrifugal 2min.All are measured equal triplicate and average.Calculate dye decolored rate afterwards.The percent of decolourization calculation formula of dyestuff is (A ₀-A)/A ₀* 100%, A wherein ₀Be initial dyestuff light absorption value, A is the light absorption value that sampling is regularly surveyed.

Table 1 dye type, final concentration and maximum absorption wavelength

The result shows that bacillus amyloliquefaciens LS05 gemma laccase demonstrates the ability of stronger decolouring dyestuff.In the presence of amboceptor Syringylethanone, decolour the percent of decolourization of synthetic dyestuff of back four kinds of different structures all more than 84% through 6h, wherein to the percent of decolourization of isatin up to 95.92% (Fig. 8).

2. the decolorization experiment of dyestuff under the alkaline condition

Because the advantage of bacterial laccase is to have the catalytic activity higher than fungal laccase under the alkaline condition; For further investigate bacterial laccase in alkaline environment to the decoloring ability of dyestuff, select of the decolouring of the condition research bacillus amyloliquefaciens LS05 gemma laccase of pH9.0 for use to four kinds of synthetic dyestuff.Through behind the 6h; RBBR,, the percent of decolourization of HFGR REACTIVE Black HFGR KN-B, isatin and Viola crystallina is respectively 96.05%, 95.54%, 95.16% and 95.89%; This result is higher than the percent of decolourization of various dyestuffs under the pH6.6; Show that this gemma laccase has still kept higher decoloring ability to various dyestuffs under alkaline environment, when handling the waste water from dyestuff of different pH values, have suitability preferably.

The clone of embodiment 3 bacillus amyloliquefaciens LS05 gemma laccase genes

1. the clone of bacterial strain laccase gene

Above-mentioned bacterial strains is chosen to 5mL LB liquid nutrient medium, 37 ℃, 200rpm, overnight cultures.Extract the genomic dna that the test kit specification sheets extracts above-mentioned bacterial strains with reference to Omega company bacterial genomes, and detect through 1% agarose gel electrophoresis.

The employing genomic dna is a template, with upstream primer " CGG GAATTCGGCACTGGAAAAATTTGCAGATG " (restriction enzyme site EcoR I) and downstream primer " CCG CTCGAGTTACTGCTTATCCGTGACGTCC " (restriction enzyme site Xho I) amplification bacterial strain bacillus amyloliquefaciens LS05 gemma laccase gene.

In 200 μ L PCR pipe, add following reagent: ddH ₂O 13.75 μ L, 10 * Ex Taq Buffer2 μ L, 10mmol/L dNTP mixture 1 μ L, 10 μ mol/L upstream primers, 1 μ L, 10 μ mol/L downstream primers, 1 μ L, dna profiling 1 μ L, Ex Taq enzyme 0.25 μ L, TV 20 μ L.Negative control is set simultaneously.The PCR reaction conditions: 94 ℃ of preparatory sex change of 4min, 94 ℃ of 45s, 53 ℃ of 45s, 72 ℃ of 2min, 30 circulations, 72 ℃ of 10min extend.Amplified production detects through 1% agarose gel electrophoresis.

Go out the purpose fragment of capacity through pcr amplification, separate the back through 1% agarose gel electrophoresis and downcut the purpose band, with Omega company glue recovery test kit with reference to specification sheets recovery purpose fragment.The segmental purity of purpose that reclaims detects with 1% agarose gel electrophoresis.

2. connect T carrier and conversion

1) follow these steps to add reaction solution: pMD18-T vector1 μ L, glue reclaims product 3 μ L, ddH ₂O 1 μ L, Solution I 5 μ L, TV 10 μ L, 16 ℃ of ligation 1h.

2) E.coli JM109 competent cell is melted in ice.

3) 10 μ L ligation liquid are joined in the 100 μ L competent cells, inhale gently and beat mixing, ice bath 30min, 42 ℃ of insulation 60s, ice bath 5min.

4) add 890 μ L LB liquid nutrient mediums, 200rpm cultivates 1h for 37 ℃.Negative control is set simultaneously.

5) get an amount of above-mentioned nutrient solution and be evenly coated on the LB/Amp/X-Gal/IPTG flat board, 37 ℃ of overnight cultures.

3. the screening and the evaluation of reorganization T carrier

1) through the positive transformant of blue hickie screening white, white colony is chosen to the 5mLLB/Amp liquid nutrient medium, 37 ℃, 200rpm, overnight cultures.

2) from the bacterium liquid of incubated overnight, extract plasmid with reference to specification sheets with plasmid extraction kit.

3) PCR identifies.

Add following reagent: ddH successively ₂O 13.75 μ L, 10 * Taq Buffer, 2 μ L, 10mmol/LdNTP mixture 1 μ L, 10 μ mol/L upstream primers, 1 μ L, 10 μ mol/L downstream primers, 1 μ L, plasmid template 1 μ L, Taq enzyme 0.25 μ L, TV 20 μ L.Negative control is set simultaneously.The PCR reaction conditions: 94 ℃ of preparatory sex change of 4min, 94 ℃ of 45s, 53 ℃ of 45s, 72 ℃ of 2min,, 30 circulations, 72 ℃ of 10min extend.Amplified production detects through 1% agarose gel electrophoresis.

4) enzyme is cut evaluation.

Add following reagent successively: 10 * H Buffer, 2 μ L, EcoR I 1 μ L, Xho I 1 μ L, plasmid 3 μ L, ddH ₂O 13 μ L, TV 20 μ L.37 ℃ of reaction 3h.1% agarose gel electrophoresis detects enzyme and cuts product.

4. the order-checking of laccase gene and sequential analysis

PCR and enzyme cut detect correct positive colony and be sent to the order-checking of Shanghai Ying Jun biotech company, sequencing result is seen sequence table SEQ ID No:1.

Claims

1. a bacillus amyloliquefaciens (Bacillus amyloliquefaciens) LS05; It is characterized in that; Said bacillus amyloliquefaciens is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center; Deposit number is CGMCC No.4264, and preservation date is on October 22nd, 2010.

2. gemma laccase, this laccase is characterized in that following these steps to carrying out by the described bacillus amyloliquefaciens CGMCC of claim 1 No.4264 preparation:

A. bacillus amyloliquefaciens CGMCC No.4264 streak inoculation is produced on the spore substratum in solid, and after 5d was cultivated in 37 ℃ of inversions, described product spore media components was: nutrient broth 8g/L; KCl 1g/L; MgSO ₄7H ₂O 0.25g/L; MnCl ₂4H ₂O0.002g/L; Agar 17g/L; Autoclave sterilization behind the accent pH7.0, the 0.5mmol/L CaCl of adding filtration sterilization ₂And 0.001mmol/L FeSO ₄

B. with aseptic deionized water the gemma on the solid medium is washed;

C. the N,O-Diacetylmuramidase that adds final concentration 0.1mg/mL, 37 ℃ of water-bath 10min;

D. clean one time with the 1mol/LNaCl that contains 10mmol/LEDTA and 0.3mg/mLPMSF, 0.14mol/LNaCl, 0.1%w/v SDS and aseptic deionized water successively;

E.80 after cleaning three times with aseptic deionized water behind ℃ thermal shock 10min, 4 ℃ keep in Dark Place in the triangular flask after the sterilization of packing into.

3. gemma laccase according to claim 2; Play a role at pH 2.2-10.0, the optimum pH of catalytic substrate ABTS is 3.0 in the time of 30 ℃, and the optimum pH of catalytic substrate syringaldazine is 6.6; Catalytic substrate 2, the optimum pH of 6-syringol are 8.6.

4. gemma laccase according to claim 2,20-100 ℃ of performance function, optimal reactive temperature is 70 ℃ when pH 6.6 is substrate with the syringaldazine.

5. gemma laccase according to claim 2 can be to the synthetic dyestuff RBBR of different structure, HFGR REACTIVE Black HFGR KN-B; Viola crystallina and isatin decolour, and decolorization condition is: 40 ℃, and pH 6.6 or 9.0; The final concentration of gemma laccase suspension is 1mg/ml, and the dyestuff final concentration is respectively RBBR 100mg/L, HFGR REACTIVE Black HFGR KN-B 40mg/L; Isatin 25mg/L, Viola crystallina 5mg/L, adding final concentration is the laccase amboceptor Syringylethanone of 0.1mmol/L.