CN102134568A - Promoter for MADS-box gene in maize and application thereof - Google Patents
Promoter for MADS-box gene in maize and application thereof Download PDFInfo
- Publication number
- CN102134568A CN102134568A CN2010101004872A CN201010100487A CN102134568A CN 102134568 A CN102134568 A CN 102134568A CN 2010101004872 A CN2010101004872 A CN 2010101004872A CN 201010100487 A CN201010100487 A CN 201010100487A CN 102134568 A CN102134568 A CN 102134568A
- Authority
- CN
- China
- Prior art keywords
- response
- responsive
- gene
- dna
- box
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a promoter for MADS-box gene in maize and application thereof. The promoter for the MADS-box gene in maize can respond to various environmental stress signals, and has the nucleotide sequence shown as a sequence 1 in a sequence table, or a DNA sequence of a promoter of a gene having over 85 percent of consistence with the sequence 1; and the promoter is used for constructing vectors for inducing response to one or more of drought or deaquation, abscisic acid (ABA, ABscisic Acid), potassium ion (K+) inflow, coldness, salt, germs, light, sugar, heavy metals and wounds, so as to be applied to breeding transgenic stress-resistant plants.
Description
Technical field
The present invention relates to the promotor of plant MADS-box gene, relate in particular to the promotor and the application thereof of corn MADS-box gene.
Background technology
Corn is one of global of paramount importance food crop.Arid is the essential environmental factors of the global Maize Production of restriction.According to conservative estimation, only in the torrid areas, because the corn that arid causes loss reaches 2,000 ten thousand tons every year at least, rate of loss is at least 17%.According to another conservative estimation, corn accounts for 21.1% of China total output of grain state food crop output formation.For many years, in national Program for Tackling Key Problems, maize breeding is always emphasized high-quality, high yield, multiresistance, but reality is to be unalterable quota with the corn yield when examination, and this objectively will induce the breeding expert to ignore the quality and the adaptability of corn breeding.In addition, the drought-resistant character of corn is the quantitative character of a controlled by multiple genes, and drought resisting mechanism is very complicated, and is therefore limited to its understanding, in the difficulty that has objectively caused the drought-resistant maize breeding again.
For a long time, place hope on drought both at home and abroad and coerce the evaluation of responsive genes and expression study is resolved corn as the breach drought resisting mechanism thereof.Development and application along with DNA chip or microarray technology, found that a large amount of plant droughts coerce responsive genes and range gene express spectra, these expression of gene have when tangible, empty specificity, tissue specificity and condition specificity, form the network regulation system of a complexity, still do not make proper explanations but express regulation mechanism for these responsive genes.
Studies show that in a large number, genetic expression the time, empty specificity, tissue specificity and condition specificity depend on the promotor of gene to a great extent.The formation of heterogeneic promotor changes greatly, for example it is generally acknowledged that the promotor by the identification of Yeast Nucleic Acid (RNA, Ribonucleic Acid) polymerase II contains a TATA box and or initial startup factor of control specific transcriptional.For many years, the TATA box is considered to control the main core parts of basal transcription mechanism, contain one but the promotor of many other genes lacks the TATA box element and start the factor, even same promotor, because the variation (epigenetic alteration) of the back life of promotor inside for example methylates or the supermethylation meeting causes the heterogeneic effect of transcribing.In addition, many genes, particularly some family genes do not have significant difference on functional domain, but its transcription is but very different, the thermal excited transcryption factor HSF1 of for example human and muroid, HSF2, HSF3 and HSF4, wherein HSF1 is relevant with the expression of heat shock protein with HSF3, HSF2 does not have any reaction to the stressor of classics, though HSF4 is similar with HSF2 to HSF1, to express in the tissue specificity mode, one of reason is the heat shock element difference in these thermal excited transcryption factors HSFs promotor separately.
In addition, because for example degeneration-resistant proterties of many proterties of corn is subjected to controlled by multiple genes, rely on to transform the systemic resistance that term single gene is difficult to realize the corn complete stool.Studies have shown that, transform a spot of gene and be difficult to give the resistance trait that crop meets the production needs, also attempt transforming simultaneously the gene more than 2 in the world, in addition, owing to be subject to present transgenic technology, the winner that trial transforms 2 above genes simultaneously is very few.
The research to the promotor of corn gene has both at home and abroad obtained certain progress.On January 7th, 2009, the plant promoter of including in (The Eukaryotic Promoter Database) in the promotor private database has 198, and wherein the promotor of corn has 21.21 corn promotors having reported have comprised 11 alcohol soluble protein gene promotors, the promotor of 2 light harvesting protein genes, 1 sucrose synthase gene promotor, 1 uridine diphosphate (UDP) (UDP, Uridine DiphosPhate)-glucose-starch Transglucosylase gene promoter, 3 anthocyanidin synthesis related gene promotors, 2 alcohol dehydrogenase gene promotors and 1 heat shock protein memory promotor.
At present, paid attention to as yet for the promotor research of the plant transcription factor of coercing response (TFs, Transcription Factors) gene both at home and abroad, do not coerced the research report of promotor of the TFs gene of response about the drought of corn.In the research in early days, expressed sequence tag (the ESTs of corn expressing gene is coerced down in this laboratory to drought, Expressed Sequence Tags) carried out the large scale sequencing analysis, made the cDNA microarray of 11855 genes, with this microarray large scale analysis drought coerce the genetic expression of corn in following seedling stage, found that drought coerces down the gene that the TFs with remarkable up-regulated expression feature is a class MADS-box (data not shown).The gene of MADS-box is proved in the Eukaryotic growth control of nearly all research and signal conduction and works.Therefore, the clone of the gene promoter of corn MADS-box provides theoretical foundation for further illustrating corn adversity gene expression network adjustment and drought resisting mechanism, also has its using value in transgenic corns drought resisting breeding.
Reference:
Li Wanchen, Rong Tingzhao (2000) China 21 century maize genetic breeding engineering prospect, corn science 8:10-14.
Xu Yawei, Chai Xiaojie, Wang Piwu, Zuo Yanting, the clone and the expression vector establishment of Lv Pin (2006) corn starch branching enzyme sbe II b gene promoter, corn science, 14:84-87.
Zhang Shihuang, Hu Ruifa (2000) maize breeding induce innovation factor, corn science, 8:3-7.
Becker?A，Theissen?G(2003)The?major?clades?of?MADS-box?genes?and?theirrole?in?the?development?and?evolution?of?flowering?plants.Mol?Phyl?Evol?29，464-489.
Bray EA，Bailey-Serres J，Weretilnyk?E?(2000)Responses?to?abioticstresses.Chapter?22.In?W?Gruissem，B?Buchannan，R?Jones，eds，Responses?toAbiotic?Stresses.American?Society?of?Plant?Physiologists，Rockville，MD，pp1158-1249.
Bruce?WB，Edmeades?GO，Barker?TC(2002)Molecular?and?physiologicalapproaches?to?maize?improvement?for?drought?tolerance.J?Exp?Bot?53：13-25.
Comelli?RN，Viola?IL，Gonzalez?DH(2009)Characterization?of?promoterelements?required?for?expression?and?induction?by?sucrose?of?the?ArabidopsisCOX5b-1?nuclear?gene，encoding?the?zinc-binding?subunit?of?cytochrome?c?oxidase.Plant?Mol?Biol.Jan?1.
Durieux?AC，Bonnefoy?R，Freyssenet?D(2005)Kinetic?of?transgeneexpression?after?electrotransfer?into?skeletal?muscle：importance?of?promoterorigin/strength.Biochim?Biophys?Acta.1725(3)：403-409.
Hoagland?DR，Arnon?DA(1938)The?water-culture?method?of?growing?plantswithout?soil.California?Agricultural?Experiment?Station?Circular.347：1-32.
Hoisington?D(2001)Application?of?biotechnology?to?maize?improvement：Past，Present?and?Future?Prospects.Seventh?Eastern?and?Southern?Africa?RegionalConference，pp.7-11.
Jefferson?RA(1987)Assaying?chimeric?genes?in?plants：the?GUS?gene?fusionsystem.Plant?Mol?Biol?Rep，5：387-405.
Kim?K?N，Fisher?DK(1998)Molecular?cloning?and?characterization?of?theAmylose-Extender?gene?encoding?starch?branching?enzyme?II?B?in?maize.Plant?MolBiol，38：945-956.
Liu?YG，Mitsukawa?N，Oosumi?T，et?al.(1995)Efficient?isolation?andmapping?of?Arabidopsis?thaliana?T-DNA?insert?junctions?by?thermal?asymmetricinterlaced?PCR.Plant?J.8(3)：457-462.
Pirkkala?L，
P，Sistonen?L(2001)Roles?of?the?heat?shock?transcriptionfactors?in?regulation?of?the?heat?shock?response?and?beyond.FASEB?J.15(7)：1118-1131.
Wang?W，Vinocur?B，Altman?A(2003)Plant?responses?to?drought，salinity?andextreme?temperatures：towards?genetic?engineering?for?stress?tolerance.Planta218：1-14
Welchen?E，Viola?IL，Kim?HJ，Prendes?LP，Comelli?RN，Chan?Hong?J，Gonzalez?DH(2008)A?segment?containing?a?G-box?and?an?ACGT?motif?confersdifferential?expression?characteristics?and?responses?to?the?Arabidopsis?Cytc-2?gene，encoding?an?isoform?of?cytochrome?c.J?Exp?Bot.Dec?19
Wong?J，Liang?V?CT，Sachs?L?M.，and?Shi?YB(1998)Transcription?from?thethyroid?hormone-dependent?promoter?of?the?Xenopus?laevis?thyroid?hormonereceptor?bA?gene?requires?a?novel?upstream?element?and?the?initiator，but?not?aTATA?box.Journal?of?Biological?Chemistry，273：14186-14193.
Zare?M，Jazii?FR，Alivand?MR，Nasseri?NK，Malekzadeh?R，Yazdanbod?M(2009)Qualitative?analysis?of?Adenomatous?Polyposis?Coli?promoter：hypermethylation，engagement?and?effects?on?survival?of?patients?with?esophagealcancer?in?a?high?risk?region?of?the?world，a?potential?molecular?marker.BMC?Cancer.9：24.
Summary of the invention
Technical problem to be solved by this invention provides a kind of promotor and application thereof of corn MADS-box gene, can respond multiple environment-stress signal, to make up the expression vector of multiple environment-stress signal induction response.
In order to solve the problems of the technologies described above, the invention provides a kind of corn MADS-box gene promoter is one of following nucleotide sequences:
(1) dna sequence dna of sequence 1 in the sequence table;
(2) dna sequence dna with described sequence 1 qualification has conforming dna sequence dna more than 85%.
Preferably, described gene promoter contains the dna sequence dna element of multiple environment-stress signal response.
Preferably, the dna sequence dna element of described multiple environment-stress signal response comprises:
3 lack of water response (dehydration-responsive) elements;
1 lack of water or dormin (ABA) or cold response (dehydration, ABA, cold-responsive) element;
1 wound response (wounding-responsive) element;
1 potassium ion flows into control (K
+Influx) element;
1 ABA response (ABA-responsive) element;
1 enhanser (enhancer) element that improves genetic expression intensity;
1 copper response (copper-responsive) element;
1 pathogenic bacteria or salt response (pathogen, salt-responsive) element;
2 photoresponses (light-responsive) element;
1 sugar response (sugar-responsive) element;
1 pathogenic bacteria response (pathogenesis-responsive) element;
1 cold or lack of water response (cold, dehydration-responsive) element;
4 elements relevant with transcription rate wherein have 3 TATA boxes (TATA box) and 1 CAAT box (CAAT box).
In order to solve the problems of the technologies described above, the invention provides the application of foregoing corn MADS-box gene promoter aspect the breeding of transgenosis adversity resistant plant.
Preferably, described gene promoter is used for making up and comprises arid or lack of water, dormin (ABA), potassium ion (K
+) flow into, the carrier of one or more evoked responses in cold, salt, germ, light, sugar, heavy metal and the wound, thereby be applied to the breeding of described transgenosis adversity resistant plant.
The corn that comes from provided by the invention can be contained arid (or lack of water), dormin (ABA, ABscisic Acid), K by the promotor of the MADS-box gene of lack of water abduction delivering in this promotor
+Flow into, the dna sequence dna element of cold, salt, germ, light, sugar, heavy metal and wound response, thereby may be subjected to arid (or lack of water), ABA, K at corn
+Flow into, induce under cold, salt, germ, light, sugar, heavy metal and the wound stress conditions expression of promotor gene.This promotor does not almost have homology with the existing corn gene promotor of having reported, so be the promotor of the newfound a kind of corn gene of the present invention, it is significant in the transgenic plant breeding for stress tolerance.
Description of drawings
Fig. 1 uses the method embodiment schema of chromosome walking corn clone MADS-box gene promoter for the present invention;
Fig. 2 is the chromosomal dna fragment of chromosome walking pcr amplification MADS-box upstream region of gene;
Fig. 3 is the response element that contains of the dna sequence dna of the present invention clone's corn MADS-box gene promoter (Pro66) and predictability thereof;
The method that Fig. 4 makes up for the expression that detects corn MADS-box gene promoter;
Fig. 5 is startup glucuronidase (GUS, the glucuronidase) histochemical stain of the genetic expression detection of the Pro66 of amplification.
Embodiment
The promotor of corn MADS-box gene provided by the invention is a kind of promotor that can respond multiple environment-stress signal, is used for making up comprising arid or lack of water, dormin (ABA, ABscisic Acid), potassium ion (K
+) flow into, the carrier of cold, salt, germ, light, sugar, heavy metal and wound-induced response, thereby be applied to the breeding of transgenosis adversity resistant plant.
Specifically, the present invention is to provide a kind of corn that comes from can be by the promotor of the MADS-box gene of lack of water abduction delivering, and this promotor contains arid or lack of water, ABA, K
+Flow into, the dna sequence dna element of cold, salt, germ, light, sugar, heavy metal and wound response, thereby may be subjected to inducing under the corresponding stress conditions expression of promotor gene plant.This promotor does not almost have homology with existing gene promoter of having reported for work, thereby is the promotor of the newfound a kind of plant gene of the present invention.
Below in conjunction with accompanying drawing and preferred embodiment technical scheme of the present invention is at length set forth.The embodiment that below exemplifies only is used for description and interpretation the present invention, and does not constitute the restriction to technical solution of the present invention.
Used in an embodiment of the present invention material comprises:
MADS-box expression of gene sequence label (ESTs) sequence is from this laboratory corn EST order-checking planning studies problem, and is filed in the gene pool (GenBank, call number is EC864166) of the U.S. state-run biotechnology information center (NCBI).
Intestinal bacteria (Escherichia coli) strain DH5 α preserves for this laboratory.
Restriction enzyme, T4 ligase enzyme and pcr amplified dna cloning vector pGEM-T easy Vector are available from Promega company.
X-gluc (import packing) and gel DNA reclaim test kit available from perseverance because of biotech firm.
DNA Marker, general T aq enzyme etc. are available from Fermentas company.
Glue recovery test kit and PCR product purification test kit are available from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
The helper plasmid pRK2073 that shifts between thalline as helper plasmid DNA in Agrobacterium (Agrobacterium tumefacien) bacterial strain LBA4404, plant expression vector pCambial301 and the three parents combination is that preservation is collected in this laboratory.
Chromosome walking test kit Genome Walking Kit is available from TAKARA company; The chromosomal localization of the EST of corn MADS-box gene adopts the BLASTN-HTG program in the database of Plant Genome website (PlantGDB, its network address is http://www.plantgdb.org/).
The dna sequencing of MADS-box gene promoter entrusts Shanghai Sangon Biological Engineering Technology And Service Co., Ltd to carry out.The prediction of genetic transcription initiation site adopts NNPP version 2.2 programs (http://www.fruitfly.org/seq_tools/promoter.html) to carry out.Take advantage of a situation routinely controlling element prediction of plant gene promoter is carried out according to the method that provides in PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) and PLACE (PlantCis-acting Regulatory DNA Elements, the http://www.dna.affrc.go.jp/PLACE/) database.
Water culture is adopted in the cultivation of plant, and nutrient solution is Hoagland solution (Hoagland and Arnon1938).
Agrobacterium and intestinal bacteria substratum be common LA (peptone 10 grams, yeast powder 5 grams, NaCl5 gram, agar powder 15 grams, 1000 milliliters in water, pH7.0) and LB (LA that does not add agar powder) substratum.
3 used in first round chromosome walking pcr amplification Auele Specific Primers are:
SP1：5’-CCTGAGCTGAATCTGCATGTTGTCG-3’，
SP2：5’-CCATTCGTCTTGTGCATC?CTCCAG-3’，
SP3：5’-TATCCGATC?TCCAGCTCC?CTCATG-3’。
Second takes turns the step moves 3 used in pcr amplification Auele Specific Primers and is:
Pro-SP1：5’-TGGGTCTTTGCGATCAGTTTTGCTTG-3’，
Pro-SP2：5’-AATGAGAGGGGCAATGGACAGA?CGAG-3’，
Pro-SP3：5’-TGCCGGTTGGTAGAGTTCTCGATC-3’。
The 3rd takes turns the specific PCR primer to being
ProF：5’-GGGGTCGACTTGCCGGTTGGTAG?AG-3’，
ProR：5’-GGGCCATGGACTGCG?TTCTCCACTC-3’
The method that adopts Jefferson (1987) detects in the histological chemistry of genetic expression.
As shown in Figure 1, the method embodiment flow process for corn clone MADS-box gene promoter of the present invention comprises the steps:
10: the est sequence of corn MADS-box gene is positioned on the karyomit(e) of corn;
According to the free BLASTN-HTG programanalysis in PlantGDB (http://www.plantgdb.org/) database, the est sequence of corn MADS-box gene is positioned on No. 8 karyomit(e)s of corn.
20: with localized chromosome walking;
The est sequence of MADS-box gene once was positioned on No. 8 karyomit(e)s of corn, carry out the chromosome walking pcr amplification according to localized maize chromosome dna sequence dna, this chromosome walking pcr amplification adopts TAIL-PCR (Liu et al., 1995) amplification method carries out, and the dna fragmentation that at every turn amplifies sees also Fig. 2.
Shown in Fig. 2 A, be first round chromosome walking: the coding region sequence according to No. 8 that are positioned at corn on chromosomal is according to reverse downstream primer of 3 ' → 5 ' direction design, and with have 5 ' → 3 ' direction random primer and form the primer of first round PCR carrying out first round pcr amplification.
Shown in Fig. 2 B, be second to take turns chromosome walking: according to the sequence of the DNA of first round PCR near 5 ' end, according to reverse downstream primer of 3 ' → 5 ' direction design and with have 5 ' → 3 ' direction random primer and form second primer of taking turns PCR and take turns pcr amplification carrying out second.
Shown in Fig. 2 C, be the upstream of the target gene on karyomit(e) amplification successively as stated above, promptly taking turns the TAIL-PCR product that produces in the chromosome walking with the 2nd is template, carries out the specific PCR amplification with sequence specific primers.
M represents 1kb dna ladder type (DNA Ladder) among Fig. 2; The 1st, 2,3 corresponding amplified productions among swimming lane on the topic head 1,2, the 3 expression TAIL-PCR among A and the B among Fig. 2.The negative control of the pcr amplification that swimming lane 1 on the topic head among Fig. 2 among the C and 2 expressions are done with PCR reaction solution and sequence specific primers; Swimming lane 3 and 4 expressions be that to take turns the TAIL-PCR product that produces in the chromosome walking with the 2nd be template, the specific PCR amplified production that carries out with sequence specific primers.
30: the PCR product that chromosome walking is produced is connected with the plant gene expression vector that contains reporter gene;
Under the effect of T4 ligase enzyme, check order to being cloned into pGEM-T easy Vector plasmid vector, obtain the dna sequence dna of corn MADS-box gene promoter (being numbered Pro66).
40: the examining report expression of gene, and the dna fragmentation of the promotor of corn MADS-box gene identified.
Above-mentioned evaluation comprises to be predicted the dna sequence dna and the contained response element sequence thereof of clone's corn MADS-box gene promoter.
Obtained the dna fragmentation (shown in Fig. 2 C) of one section sequence-specific pcr amplification according to method flow shown in Figure 1, promptly the dna fragmentation of corn MADS-box gene promoter is determined its long 106lbp through checking order.Adopt neural network promotor predictor version 2 .2 (Neural Network PromoterPrediction, NNPP version 2.2) prediction MADS-box gene transcription initiation site, the method forecast analysis that provides in PlantCARE and the PLACE database is provided, find that this DNA section comprises the dna sequence dna element of following response, as shown in Figure 3:
3 lack of water response (dehydration-responsive) elements;
1 lack of water or ABA or cold response (dehydration, ABA, cold-responsive) element;
1 wound response (wounding-responsive) element;
1 K
+Flow into control (K
+Influx) element;
1 ABA response (ABA-responsive) element;
1 enhanser (enhancer) element that improves genetic expression intensity;
1 copper response (copper-responsive) element;
1 pathogenic bacteria or salt response (pathogen, salt-responsive) element;
2 photoresponses (light-responsive) element;
1 sugar response (sugar-responsive) element;
1 pathogenic bacteria response (pathogenesis-responsive) element;
1 cold or lack of water response (cold, dehydration-responsive) element;
4 elements relevant, wherein 3 TATA boxes (TATA box) and 1 CAAT box (CAAT box) with transcription rate.
The dna sequence dna of corn MADS-box gene promoter is shown in sequence 1.
The commentaries on classics beta-Glucuronidase (GUS, β-Glucuronidase) structure and the gus gene detection of expression thereof of expression vector that have corn MADS-box gene promoter (Pro66)
With the dna clone of the plan promotor (Pro66) of pcr amplification among the embodiment 1 after on the pGEM-T easyVector plasmid vector, again through Sal I/Nco I double digestion and reclaim corresponding endonuclease bamhi.Gene expression in plants plasmid vector pCAmbia1301 removes the preceding 35S promoter DNA of gus gene in this expression vector (gus) through Sal I/Nco I double digestion.The dna fragmentation of the plan promotor Pro66 that under the ligase enzyme effect Sal I/Nco I double digestion is also reclaimed connects and is cloned among the pCAmbia1301 of Sal I/Nco I double digestion, and constructing with gus is the new recombinant expression plasmid of reporter gene.Wherein whether the expression of gus reporter gene depends on whether the dna fragmentation that is connected this upstream region of gene has the startup effect of genetic expression.Use the same method the recombinant plasmid of the non-promoter DNA that constructs the one section 672bp that has peanut as the negative control plasmid, and the methods and strategies of structure is referring to Fig. 4.
The recombinant plasmid that constructs imports Agrobacterium LBA4404 thalline by three parents in conjunction with (bacillus coli DH 5 alpha that contains helper plasmid pRK2073 contains between the bacillus coli DH 5 alpha and Agrobacterium LBA4404 thalline of recombinant plasmid).Utilize disposable syringe (to have 4
#Syringe needle) will be cultured to OD
600=0.6 Agrobacterium LBA4404 thalline that has recombinant plasmid is injected into corn vein in tri-leaf period.26 ℃ of 1/5Hoagland nutritive mediums, 12h illumination/24h cultivates and carries out histochemical stain according to the method for Jefferson (1987) after 2 days.
The histochemical stain concrete grammar is: will be soaked in X-gluc staining fluid (100mM (pH 7.0) phosphoric acid buffer; 0.1% (V/V) Triton-X 100; 10mM EDTA; 0.5mg/ml X-Gluc; 1% (V/V) dimethyl sulfoxide (DMSO)) in, 37 ℃ are spent the night, 70% ethanol decolorization.Tissue staining the results are shown in Figure 5.
Wherein:
A: negative control.Utilize one section non-promoter DNA of 672bp of peanut to replace the upward plasmid construction of the upstream CaMV35S promotor of gus gene of pCambia1301.
B: primary pCambia1301 positive control.
C: the corn MADS-box gene promoter (Pro66) that the chromosome walking pcr amplification is gone out.The Pro66 promotor (containing initiator codon, length overall 1068bp) of amplification has replaced the upward structure of the upstream CaMV35S promotor of gus gene of expression of plants pCambia1301.
Detect the agriculture bacillus mediated method that infects the transient expression and the conjunctive tissue chemical staining of maize leaf that adopts.The result of histochemical stain referring to Fig. 5 C, shows that Pro66 can start the expression of reporter gene gus, is a real promotor.
The purpose of present embodiment is the expression that checking corn MADS-box gene promoter Pro66 can start reporter gene gus, is a real promotor.
The gene order table
Sequence 1: the promoter DNA sequence of corn MADS-box gene
1?TTGCCGGTTGGTAGAGTTCTCGATCAGTTTTGCTTGGTGATGAAGGGTATCCTTTGATCCTGCC 64
65?TTCCATATGAAGGACTTTAGGATCTTTTTTATGACTTTGTCTTCCATTTAAAGAACTTCAAAGT 128
129?CTTTTACACTCGAAGGCGCAACAACAAAAGAAGACTGTTCGTTCTTTTGGGGATGGTTGCCCTT 192
193?ATATTTACTGGGCGATTACAATTTTTACAAAGACGGTACCATTAAAAATCCCTACTCTCTGTCT 256
257?TTTTTACGAAGAACCCCGTAAGGAAAAATGGTGTTATCTTGAAACAAAAATTAAAAAAGAAAAG 320
321?AAAAAGAAACATCGCTACGTATCTACACAAAATAACCTTGGAGACCGTGTATTCCACAACCTCG 384
385?GGACTTTATTTGTCTCCATATACTTTAGTCTATATGATCGGATCAAAGCCGTTACGAGGAAGGG 448
449?CTCTTCCCACTTGAATTGTAGTTTGCCTGTGTTGTCTAGATTTGCTATCTTTCAAAGGACAAGA 512
513?TTTTCTGTAGCTATATGTTTACGTTTTACTTTTTCGTCCCTCCATTTCCTTATTTTTATGTGCC 576
577?TAGATTTATGATTCGTGTTCATACGAGCTAGAATAATTCATATCCAATAATATAAGTCAGATTT 640
641?CAACATATATTGCATGCAATGTATGGACATGTTGGCTAGTAAAAAGAAAAAAAGATAAAAACGT 704
705?AGGGCCTAGTGATCAGCACAGGGCCACAGGCATGCAGATGTAGCGCACATGCGAACGTAACAAA 768
769?CACAGCAACGCGCCCACGCTAGCGGTTTCCATTTCCGGCCCTGCAATCCTGCACCGGCGCGAAA 832
833?GCCCCCTCACGGCCTCACCTCCACTCCGGTGATGGCCGCATCTCCTTTACTTCTCAGTGCTCAC 896
897?GCCGTCCACGGTCCACTAGTTGCATCGGTTAGCTCCCGCATAAAGATCCACACCACTTGAGCAG 960
961?CAGCTAGCTCAAGGGAAGGAGAAGGCTGGAAGTGGAAAGAAGTGGGTTCTTGCTTGAGCTGAGC 1024
1025?TCTTGCTGCCCTTGGATCTGTTTGGGAGTGGAGAACGCAGTATG 1068
Claims (5)
1. a corn MADS-box gene promoter is one of following nucleotide sequences:
(1) dna sequence dna of sequence 1 in the sequence table;
(2) dna sequence dna with described sequence 1 qualification has conforming dna sequence dna more than 85%.
2. according to the described gene promoter of claim 1, it is characterized in that, contain the dna sequence dna element of multiple environment-stress signal response.
3. according to the described gene promoter of claim 2, it is characterized in that the dna sequence dna element of described multiple environment-stress signal response comprises:
3 lack of water response (dehydration-responsive) elements;
1 lack of water or dormin (ABA) or cold response (dehydration, ABA, old-responsive) element;
1 wound response (wounding-responsive) element;
1 potassium ion flows into control (K
+Influx) element;
1 ABA response (ABA-responsive) element;
1 enhanser (enhancer) element that improves genetic expression intensity;
1 copper response (copper-responsive) element;
1 pathogenic bacteria or salt response (pathogen, salt-responsive) element;
2 photoresponses (light-responsive) element;
1 sugar response (sugar-responsive) element;
1 pathogenic bacteria response (pathogenesis-responsive) element;
1 cold or lack of water response (cold, dehydration-responsive) element;
4 elements relevant with transcription rate wherein have 3 TATA boxes (TATA box) and 1 CAAT box (CAAT box).
4. the application of the described corn MADS-box of claim 1 gene promoter aspect the breeding of transgenosis adversity resistant plant.
5. according to the described application of claim 4, it is characterized in that described gene promoter is used for making up and comprises arid or lack of water, dormin (ABA), potassium ion (K
+) flow into, the carrier of one or more evoked responses in cold, salt, germ, light, sugar, heavy metal and the wound, thereby be applied to the breeding of described transgenosis adversity resistant plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010100487 CN102134568B (en) | 2010-01-25 | 2010-01-25 | Promoter for MADS-box gene in maize and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010100487 CN102134568B (en) | 2010-01-25 | 2010-01-25 | Promoter for MADS-box gene in maize and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102134568A true CN102134568A (en) | 2011-07-27 |
| CN102134568B CN102134568B (en) | 2012-12-26 |
Family
ID=44294496
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010100487 Expired - Fee Related CN102134568B (en) | 2010-01-25 | 2010-01-25 | Promoter for MADS-box gene in maize and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102134568B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102417910A (en) * | 2011-11-16 | 2012-04-18 | 吉林大学 | Corn drought-inducible promoter and activity analysis |
| CN105441459A (en) * | 2015-12-29 | 2016-03-30 | 上海大学 | Corn transcription factor ZmMaDS47 gene and application thereof |
| CN106893725A (en) * | 2015-12-18 | 2017-06-27 | 深圳市农科集团有限公司 | A kind of Plant Light regulation type promoter and application |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070270578A1 (en) * | 2004-11-25 | 2007-11-22 | Cropdesign N.V. | Plants Having Increased Yield and a Method for Making the Same |
| CN100366744C (en) * | 2005-09-15 | 2008-02-06 | 复旦大学 | Butterfly orchid pPI15 encoding sequence and its uses |
| CN101200723B (en) * | 2007-10-18 | 2010-12-15 | 复旦大学 | Butterfly orchid PhPI9 gene coded sequence and uses thereof |
-
2010
- 2010-01-25 CN CN 201010100487 patent/CN102134568B/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102417910A (en) * | 2011-11-16 | 2012-04-18 | 吉林大学 | Corn drought-inducible promoter and activity analysis |
| CN106893725A (en) * | 2015-12-18 | 2017-06-27 | 深圳市农科集团有限公司 | A kind of Plant Light regulation type promoter and application |
| CN105441459A (en) * | 2015-12-29 | 2016-03-30 | 上海大学 | Corn transcription factor ZmMaDS47 gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102134568B (en) | 2012-12-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chauvin et al. | A leaf-specific gene stimulated by light during wheat acclimation to low temperature | |
| Zhu et al. | TRANSLUCENT GREEN, an ERF family transcription factor, controls water balance in Arabidopsis by activating the expression of aquaporin genes | |
| Shan et al. | Cotton GhDREB1 increases plant tolerance to low temperature and is negatively regulated by gibberellic acid | |
| Djemal et al. | Isolation and molecular characterization of a novel WIN1/SHN1 ethylene-responsive transcription factor TdSHN1 from durum wheat (Triticum turgidum. L. subsp. durum) | |
| Zhou et al. | Genome-wide identification and characterization of R2R3-MYB family in Hypericum perforatum under diverse abiotic stresses | |
| Proietti et al. | Cross activity of orthologous WRKY transcription factors in wheat and Arabidopsis | |
| Huang et al. | A cotton dehydration responsive element binding protein functions as a transcriptional repressor of DRE-mediated gene expression | |
| Rerksiri et al. | Expression and promoter analysis of six heat stress‐inducible genes in rice | |
| Dezar et al. | The promoter of the sunflower HD-Zip protein gene Hahb4 directs tissue-specific expression and is inducible by water stress, high salt concentrations and ABA | |
| Hu et al. | Cloning and characterization of the Oryza sativa wall-associated kinase gene OsWAK11 and its transcriptional response to abiotic stresses | |
| Wu et al. | Synergistic effects of HSE and LTR elements from hsp70 gene promoter of Ulva prolifera (Ulvophyceae, Chlorophyta) upon temperature induction1 | |
| Fang et al. | Characterization of FeDREB1 promoter involved in cold-and drought-inducible expression from common buckwheat (Fagopyrum esculentum) | |
| Li et al. | Genome-scale mining of root-preferential genes from maize and characterization of their promoter activity | |
| Xu et al. | Identification of transcription factors interacting with a 1274 bp promoter of MaPIP1; 1 which confers high-level gene expression and drought stress Inducibility in transgenic Arabidopsis thaliana | |
| Kavas et al. | Ectopic expression of common bean ERF transcription factor PvERF35 promotes salt stress tolerance in tobacco | |
| Yin et al. | Isolating the promoter of a stress-induced gene encoding betaine aldehyde dehydrogenase from the halophyte Atriplex centralasiatica Iljin | |
| Zhou et al. | CgMYB1, an R2R3-MYB transcription factor, can alleviate abiotic stress in an annual halophyte Chenopodium glaucum | |
| CN102134569B (en) | Maize MAPK gene promoter and application thereof | |
| Hu et al. | Functional roles of the birch BpRAV1 transcription factor in salt and osmotic stress response | |
| CN102134568B (en) | Promoter for MADS-box gene in maize and application thereof | |
| Aguilar-Hernández et al. | Spliceosomal introns in the 5′ untranslated region of plant BTL RING-H2 ubiquitin ligases are evolutionary conserved and required for gene expression | |
| Jindal et al. | Promoters of AaGL2 and AaMIXTA-Like1 genes of Artemisia annua direct reporter gene expression in glandular and non-glandular trichomes | |
| Zhou et al. | Cloning and characterization of a gene, AsEXP1, encoding expansin proteins inducible by heat stress and hormones in creeping bentgrass | |
| Zhu et al. | Construction and functional characteristics of tuber-specific and cold-inducible chimeric promoters in potato | |
| CN108866056B (en) | Promoter for specific expression of IbCBF3 gene abiotic stress of sweet potato and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121226 Termination date: 20220125 |