CN102102121A

CN102102121A - Fluorescent PCR kit for detecting ureaplasma urealyticum

Info

Publication number: CN102102121A
Application number: CN2009102012854A
Authority: CN
Inventors: 穆海东; 汪宁梅; 穆宇豪; 黎飒
Original assignee: SHANGHAI YULONG CLINICAL TESTING CENTER CO Ltd
Current assignee: SHANGHAI YULONG CLINICAL TESTING CENTER CO Ltd
Priority date: 2009-12-17
Filing date: 2009-12-17
Publication date: 2011-06-22

Abstract

The invention discloses a fluorescent polymerase chain reaction (PCR) kit for detecting ureaplasma urealyticum, and belongs to the field of in-vitro diagnostic kit for nucleic acid. The kit comprises a positive reference, a negative reference, fluorescent polymerase chain reaction liquid, PCR primers and a specific fluorescent probe, polyethylene glycol (PEG) precipitation solution and lysis solution. The invention comprises a PCR system based on a fluorescent PCR technology, contains forward and reverse primers and the fluorescent probe for detecting the gene sequence of the ureaplasma urealyticum, can detect the nucleotide sequence of the URE gene of the ureaplasma urealyticum (UU) under proper PCR condition, can easily and quickly detect the infection of the UU in clinical samples and is high in specificity.

Description

Detect the fluorescent PCR kit of Ureaplasma urealyticum

Technical field

The invention belongs to external detection of nucleic acids field, relate in particular to a kind of fluorescent PCR (polymerase chain reaction) test kit that in clinical sample, detects ureaplasma urealyticum infection.

Background technology

(ureaplasma urealyticum, the UU) ureaplasma urealyticum that is otherwise known as is a kind of prokaryotic micro-organisms to Ureaplasma urealyticum, for unique a kind of in the Ureaplasma, because of growth needs urea is gained the name.Ureaplasma urealyticum can cause urogenital infections, and is closely related with female reproduction health.

Ureaplasma urealyticum is the common symbiotic microorganism of human urogenital tract, is pathogenic more weak condition pathogenic mycoplasma.In the main trafficability characteristic contact transmission of adult, when then being given a birth by mother's reproductive tract, the newborn infant infects.The adult male sex's infection site is at mucous membrane of urethra, and women's infection site is at uterine neck.After women's gestation, because the increase of progestogen has suppressed cellular immunization, collective's resistibility descends, and is more vulnerable to the infection of Ureaplasma urealyticum.Mainly cause nongonococcal urethritis, endometritis, chorioamnionitis, spontaneous abortion, premature labor, prostatitis, testitis, infertility, under-weight newborn infant, pneumonia of newborn, meningitis and septicemia etc.

The fluorescent PCR technology was taken the lead in succeeding in developing by U.S. PE company in nineteen ninety-five, and it has the high sensitivity of PCR, the specificity of DNA hybridization and the advantage of spectroscopic techniques accurate quantification concurrently, and visual result can directly be monitored the variation in the PCR process.Compare with regular-PCR, but its result's Real Time Observation, product does not need detected through gel electrophoresis, and stopped pipe is operated fully, has reduced the risk of PCR product pollution effectively.

The fluorescent probe of fluorescent PCR technology forms broad variety with development, as the Taqman probe, and FRET probe etc., what present method related to is the Taqman probe technique.Its principle of work is: it can be cut active the degraded by 5 ' → 3 ' enzyme of DNA synthetic enzyme (for example Taq enzyme), 5 ' end of probe has a fluorescence report group, 3 ' end has a fluorescent quenching group, when two groups are earlier close mutually, because the transmission ofenergy effect takes place, reporter group can not send fluorescence, but carrying out along with amplified reaction, the reporter group of 5 ' end splits away off along with the hydrolysis of probe, no longer with the effect of cancellation generation transmission ofenergy, thereby can send fluorescence, be caught by signal sensor.Often the group that combines with probe 5 ' end has FAM (6-Fluoresceincarboxylic acid), TET (tetrachloro-6-Fluoresceincarboxylic acid), JOE (2,7-dimethyl-4,5-two chloro-6-Fluoresceincarboxylic acids), HEX (chlordene-6-methyl fluorescein) or VIC etc., often the fluorescent quenching group that combines with 3 ' end often is TAMRA (6-carboxyl tetramethylrhodamin) or DABCYL (4-(4 '-oxane amino-benzene azo) phenylformic acid) etc.

Summary of the invention

For overcoming that traditional method (as electrophoretic method etc.) to the shortcoming that UU (Ureaplasma urealyticum) detects, the invention provides a specific specificity height, cost is low and can making the testing product of qualitative detection.

The invention provides fluorescent PCR (polymerase chain reaction) test kit that a kind of detection by quantitative UU (Ureaplasma urealyticum) infects, comprise qualitative reference material, negative reference material, positive reference substance, UNG enzyme, Taq polysaccharase, fluorescent PCR reaction solution, and DNA extraction liquid; Described fluorescent PCR reaction solution comprises PCR primer, specificity fluorescent probe.

Described qualitative reference material is to contain the PMD18-T vector plasmid that inserts the UU distinguished sequence, and described insertion sequence is as follows:

tgaagttagacgacaagttagggaatgctgaagtaatggacttagttattacaaacgcattaattcttgactacacaggtatctacaaagctgatatcgg

Described positive reference material is 1.0 * 10 for depositing concentration ⁶-1.0 * 10 ⁷The recombinant plasmid of copy/microlitre.

Described negative reference material is a PMD18-T empty carrier plasmid diluent.

Described PCR primer sequence is as follows:

The forward primer TGAAGTTAGACGACAAGTTAGGGAATG 27 of augmentation detection UU;

The reverse primer CAATTTTTCCGTTTTTAATACCGATATC 28 of augmentation detection UU;

Described specificity fluorescent probe sequence is as follows:

Detect the probe TAATGGACTTAGTTATTACAAACG 24 of UU;

Described specificity fluorescent probe is the Taqman probe, and what label probe 5 ' was held is a kind of fluorescence report group, can be FAM, TET, JOE, VIC, HEX, ROX, TAMRA, CY3, CY5; 3 ' end be a kind of fluorescent quenching group, can be TAMRA, DABCYL, BHQ0, BHQ1, BHQ2.

The present invention compared with prior art has the following advantages and effect:

1. quantitatively accurately, have the high sensitivity of PCR, the specificity of DNA hybridization and the advantage of spectroscopic techniques accurate quantification concurrently, visual result can be monitored the variation in the PCR process in real time.Compare with regular-PCR, but its result's Real Time Observation, product does not need detected through gel electrophoresis, and stopped pipe is operated fully, has reduced the risk of PCR product pollution effectively;

2. sensitivity and specificity height.Because take the double insurance design of specificity and primer and probe, sensitivity and specificity all improve a lot, can before occurring, clinical symptom detect the infection of virus;

3. detection speed is fast, adds that sample extraction only needs 2-3 hour altogether;

4. step is simple;

5. can carry out high-throughout pattern detection simultaneously.

Fluorescent PCR sensitivity height in a word, specificity is good, monitoring reaction process in real time, reaction times can be controlled in two and one-half-hours, and be the stopped pipe operation, need not subsequent disposal, can avoid reaction product to pollute to greatest extent, can replace conventional cell detection or regular-PCR detection the carrying out early diagnosis of UU.

Description of drawings:

Fig. 1 is the fluorescent PCR amplification curve of the positive reference material of UU: the positive reference material curve of curve, negative reference material curve;

Fig. 2 is the fluorescent PCR amplification curve of UU clinical sample: measured positive reference material Ct value is between 20～28, and negative reference material Ct value is Undet, and positive sample Ct value is between 20～38.

Embodiment:

Be to be understood that, unaccounted normal condition and method among the following embodiment, usually according to the conventional employing method of affiliated field experimenter: as " molecular cloning experiment guide " third edition of Sa nurse Brooker and Russell chief editor, or the step and the condition of advising according to manufacturer.

Embodiment 1: the preparation of test kit

1. primer and probe design and synthetic

Use Primer Express 3.0,, be in the primer of conserved regions, the probe of design UU on the primer basis that chooses at the URE gene regions of UU.Primer and probe all entrust specialized company's (giving birth to the worker) synthetic, and wherein primer is the PAGE purifying, and probe is the HPLC purifying, probe 5 ' end flag F AM fluorophor, 3 ' end mark TAMRA fluorophor.

Extension increasing sequence such as table 1:

Table 1. specific probe and primer sequence

The sequence title	Oligonucleotide sequence (5 '-3 ')	Base length (bp)
			The UU probe	TAATGGACTTAGTTATTACAAACG	24
The UU forward primer	TGAAGTTAGACGACAAGTTAGGGAATG	27
			The UU reverse primer	CAATTTTTCCGTTTTTAATACCGATATC	28

2.UU the preparation of the qualitative reference material of plasmid positive template

The UU plasmid is used to prepare quantitative reference material as positive template in the present embodiment.

Use synthetic amplification UU primer amplified URE gene regions target sequence in the step 1, purified PCR product is connected on the PMD18-T carrier (buying from TAKARA); Be converted into then in the bacillus coli DH 5 alpha competent cell (purchase) from TAKARA; By blue hickie screening, make up the UU recombinant plasmid dna as positive reference material.The UU recombinant plasmid that makes up is identified through two-way dna sequencing.Extract plasmid, ultraviolet spectrophotometer is quantitative, and is stored in-20 ℃.

3. reference material is selected

Use no Ureaplasma urealyticum to insert segmental empty carrier plasmid as negative reference material; Contain and separate urea and prop up former recombinant plasmid (1.0 * 10 ⁶-1.0 * 10 ⁷Copy/microlitre) positive reference material.

4. the fluorescent PCR reaction solution is formed

Table 2.PCR reaction solution is formed

Material name	Final concentration
		PCR?Buffer	1×
MgCl ₂	2-5mM
		dNTP	0.1-0.5mM
The UU primer	0.1-0.50μM
		The UU probe	0.1-0.50μM
The UNG enzyme	0.05-1U
		The Taq enzyme	0.5-5U
H ₂O	In right amount
		The DNA masterplate	4μL

Cumulative volume

50μL

Embodiment 2: the use of test kit

1. sample extraction

Use the UU nucleic acid in the DNA extraction liquid extraction testing sample

1) sample pre-treatment: wipe away clean uterine neck many secretory product of making a slip of the tongue, be close to the uterine neck oral mucous membrane with the cotton swab of physiological saline infiltration and slightly firmly rotated for 2 weeks to obtain secretory product and cast-off cells, cotton swab after the sampling is put into the fully rinsing of EP pipe that has the 1ml stroke-physiological saline solution, adherent extracting.Use the PEG precipitation, alkaline lysis method of extracting UU gene.

PEG precipitated liquid prescription: 30%PEG8000.

The lysate prescription: 60mmol/L TrisHCl, pH 8.0; 0.5%SDS; 200mmol/L NaCl; 1M/L NaOH.

2) operation steps: get 500 μ l secretory product and equal-volume PEG precipitated liquid concussion mixing in the centrifugal 10min of 13000rpm, abandon supernatant; Add 50 μ l lysates, 100 ℃ of insulation 20min, the centrifugal 10min of 13000rpm gets supernatant 4 μ l and does the PCR reaction.

2. pattern detection

Get the nucleic acid that extracts in the step 1 respectively, the positive reference material that obtains in the test kit, negative reference material is as dna profiling, add UNG enzyme, Taq polysaccharase and contain the specific PCR primer and the fluorescent quantitation reaction solution of specificity fluorescent probe in, form the PCR reaction system.Standard as the sample qualitative judgement.

Each main component of this system is as follows:

4. response procedures

The fluorescence detection channel of collecting the FAM fluorescent signal is set, reaction tubes is put into fluorescent PCR instrument (ABI7500) begin amplification, response procedures is as follows:

Table 3.PCR response procedures

5. the result judges

The Ct value (cycle number) of baseline scope is selected automatically for 3-15 or by software, and setting threshold makes it to surpass the maximum of random amplification curve.Fluorescent PCR instrument difference, the Ct value of gained baseline scope can be different.

6. reference material standard

(1) all kinds of control reference product product judged results such as following table:

Table 4. reference material standard testing result

	Quality control product	The standard test result
			1	Negative reference material	Ct value 〉=40
2	Positive reference material	20≤Ct value≤28

Fig. 1 is positive reference material and the negative reference material fluorescent PCR amplification curve diagram of UU.Measured positive reference material Ct value is between 20～28, and negative reference material Ct value is that Undet. (undetect does not detect) or Ct value are 40.

7. result's report:

Fig. 2 is the UU fluorescent PCR amplification curve of clinical sample.Measured positive reference material Ct value is between 20～28, and measured positive sample Ct value is between 20～38.

The judging criterion of sample results is as follows:

Table 4. report pattern detection result

Sequence table

＜110〉Shanghai Yue Loong Clinical Laboratory center company limited

＜120〉fluorescent PCR kit of detection Ureaplasma urealyticum

<160>4

<210>1

<211>120

<212>DNA

＜213〉Ureaplasma urealyticum (ureaplasma urealyticum)

<400>1

tgaagttaga?cgacaagtta?gggaatgctg?aagtaatgga?cttagttatt?acaaacgcat 60

taattcttga?ctacacaggt?atctacaaag?ctgatatcgg?tattaaaaac?ggaaaaattg 120

<210>2

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉according to nucleic acid base pairing mechanism and the design of gene chip hybridization condition, with forward primer as the fluorescent PCR kit augmentation detection UU that detects Ureaplasma urealyticum.

<400>2

tgaagttaga?cgacaagtta?gggaatg 27

<210>3

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜223〉according to nucleic acid base pairing mechanism and the design of gene chip hybridization condition, with reverse primer as the fluorescent PCR kit augmentation detection UU that detects Ureaplasma urealyticum.

<400>3

caatttttcc?gtttttaata?ccgatatc 28

<210>4

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉according to nucleic acid base pairing mechanism and the design of gene chip hybridization condition, with probe as detection UU in the fluorescent PCR kit that detects Ureaplasma urealyticum.

<400>4

taatggactt?agttattaca?aacg 24

Claims

1. a fluorescent PCR kit that detects Ureaplasma urealyticum comprises negative reference material, positive reference material, UNG enzyme, Taq polysaccharase, fluorescent PCR reaction solution, and DNA extraction liquid; Described fluorescent PCR reaction solution comprises PCR primer, specificity fluorescent probe.

2. test kit as claimed in claim 1 is characterized in that, described positive reference material is to contain the PMD18-T vector plasmid that inserts the Ureaplasma urealyticum distinguished sequence, and the distinguished sequence of described insertion is as follows:

tgaagttaga?cgacaagtta?gggaatgctg?aagtaatgga?cttagttatt?acaaacgcat

taattcttga?ctacacaggt?atctacaaag?ctgatatcgg?tattaaaaac?ggaaaaattg 120。

3. test kit as claimed in claim 1 or 2 is characterized in that: described positive reference material is 1.0 * 10 for depositing concentration ⁶-1.0 * 10 ⁷The recombinant plasmid of copy/microlitre.

4. test kit as claimed in claim 1 is characterized in that: described negative reference material is a PMD18-T empty carrier plasmid diluent.

5. test kit as claimed in claim 1 is characterized in that, described PCR primer sequence is as follows:

The forward primer TGAAGTTAGACGACAAGTTAGGGAATG 27 of augmentation detection Ureaplasma urealyticum;

The reverse primer CAATTTTTCCGTTTTTAATACCGATATC 28 of augmentation detection Ureaplasma urealyticum.

6. test kit as claimed in claim 1 is characterized in that, described specificity fluorescent probe sequence is as follows:

Detect the probe TAATGGACTTAGTTATTACAAACG 24 of Ureaplasma urealyticum.

7. as claim 1 or 6 described test kits, it is characterized in that, described specificity fluorescent probe is the Taqman probe, and what label probe 5 ' was held is a kind of fluorescence report group, can be FAM, TET, JOE, VIC, HEX, ROX, TAMRA, CY3, CY5; 3 ' end be a kind of fluorescent quenching group, can be TAMRA, DABCYL, BHQ0, BHQ1, BHQ2.