CN102094043A - Construction and application of recombinant pig chemotactic factor CXCL12 mammalian cell expression plasmid - Google Patents
Construction and application of recombinant pig chemotactic factor CXCL12 mammalian cell expression plasmid Download PDFInfo
- Publication number
- CN102094043A CN102094043A CN 201010573214 CN201010573214A CN102094043A CN 102094043 A CN102094043 A CN 102094043A CN 201010573214 CN201010573214 CN 201010573214 CN 201010573214 A CN201010573214 A CN 201010573214A CN 102094043 A CN102094043 A CN 102094043A
- Authority
- CN
- China
- Prior art keywords
- cxcl12
- pig
- expression plasmid
- mammalian cell
- chemotactic factor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to a construction and application of recombinant pig chemotactic factor CXCL12 mammalian cell expression plasmid. The construction method is as follows: the pig CXCL12 gene prepared through polymerase chain reaction (PCR) and the mammalian cell expression plasmid pcDNA3.1V5-HisA are recombined to construct a expression plasmid (pcDNA3.1/CXCL12) which can express the recombinant pig chemotactic factor CXCL12 in the mammalian cell. The constructed pcDNA3.1/CXCL12 mammalian cell expression plasmid of the invention is transfected into the host cell to prepare the recombinant pig chemotactic factor CXCL12 protein; and the recombinant pig chemotactic factor CXCL12 protein can be used as molecular adjuvant to increase the inoculation effects of the vaccines of animal viruses such as blue ear disease.
Description
(1) technical field
The present invention relates to a kind of structure and application of the pig chemokine CXCL12 mammalian cell expression plasmid of recombinating, belong to biological technical field.
(2) background technology
Chemokine CXCL12 claims stroma cell derivative factor-1 (SDF-1) again, is micromolecular cytokine, is made of 116 amino-acid residues, belongs to chemokine protein family.It has two kinds of forms, SDF-1 α/CXCL12a and SDF-1 β/CXCL12b.The CXCL12 chemokine has four conserved cysteine residue to form two pairs of disulfide linkage to constitute the special construction of chemokine.Between the one the second cysteine residues across an intervening amino acid residue.
Chemokine CXCL12 has the intensive chemotaxis to lymphocyte and plays an important role in growth.CXCL12 guiding hemopoietic stem cell migrating from the fetal liver to marrow in fetal development.The mouse of CXCL12 gene knockout usually dies from the tire or was born back 1 hour in.SDF-1 α/CXCL12a can also affect the nerves the unit electric physiology.CXCL12 can express in many tissues (comprising brain, thymus gland, the heart, lung, liver, kidney, marrow, spleen).
PcDNA3.1V5-HisA is the 5.5kb plasmid of Invitrogen company design, is used for expressing the external source goal gene at mammal cell line, contains V5 and His label and penbritin and neomycin resistance gene.
(3) summary of the invention:
First purpose of the present invention be pig CXCL12 gene that pcr amplification is obtained and mammalian cell expression plasmid pcDNA3.1V5-HisA recombination to construct a kind of can be in mammalian cell the expression plasmid (pcDNA3.1/CXCL12) of express recombinant pig chemokine CXCL12.
Another object of the present invention is the application of reorganization pig chemokine CXCL12 albumen in strengthening the vaccine immunity reaction.
The present invention is achieved through the following technical solutions:
A kind of reorganization pig chemokine CXCL12 mammalian cell expression plasmid, its nucleotides sequence tabulation is shown in SEQ ID NO:1.Its CXCL12 Argine Monohydrochloride sequence is shown in SEQ ID NO:2.
A kind of pig chemokine CXCL12 mammalian cell expression plasmid of recombinating is to utilize the Auele Specific Primer that contains initiating sequence: upstream primer: CGGGATCCATGGGTGTCAAGGTCC; Downstream primer: CGGAATTCGCTCCTGCTGGTGATG.By the RT-PCR method from the total RNA of pig splenic lymphocyte amplification pig CXCL12 gene.Pig CXCL12 gene and the reorganization of commercialization pcDNA3.1V5-HisA expression plasmid constitute reorganization pig chemokine CXCL12 mammalian cell expression plasmid (pcDNA3.1/CXCL12).The intestinal bacteria that contain the pcDNA3.1/CXCL12 plasmid, be deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center (CCTCC) on November 06th, 2009, deposit number is CGMCC NO:3416, classification name: colon bacillus (Escherichia coli).
The present invention also comprises the application of above-mentioned reorganization pig chemokine CXCL12 mammalian cell expression plasmid aspect chemotactic different animals white corpuscle.
Reorganization pig chemokine CXCL12 mammalian cell expression plasmid is transfected behind host cell (as the HEK293 cell), pig chemokine CXCL12 gene can be expressed pig chemokine CXCL12 recombinant protein, expresses reporter gene V5 and 6* Histidine polypeptide simultaneously in the host cell slurry.Utilize V5 or 6*His affinity column, can prepare the reorganization pig chemokine CXCL12 albumen of purifying, but the multiple pig leucocyte of reorganization pig chemokine CXCL12 albumen chemotactic arrives antigen or vaccine entry site, thereby strengthen the vaccine immunity reaction.
The invention has the beneficial effects as follows: the pcDNA3.1/CXCL12 mammalian cell expression plasmid transfection HEK293 cell that utilizes the present invention to make up, preparation reorganization pig chemokine CXCL12 albumen.Because the multiple white corpuscle of CXCL12 chemotactic arrives antigen or vaccine entry site, reorganization pig chemokine CXCL12 albumen can be used as the effect of inoculation that molecule adjuvant strengthens animal virus vaccines such as blue otopathy.
(4) description of drawings
Fig. 1 is by the CXCL12 gene electrophoresis result of pcr amplification
M:DNA molecular weight standard 2000;
The CXCL12 gene (364bp) of 1:RT-PCR amplification.
The enzyme of Fig. 2 .pcDNA3.1-CXCL12 recombinant plasmid is cut evaluation
M:DNA molecular weight standard 2000;
1:BamH I/EcoR I enzyme is cut pcDNA3.1-CXCL12
The IFA of Fig. 3 .pcDNA3.1-CXCL12 transient expression in the HEK293FT cell detects
The contrast of A:HEK293FT cell;
The contrast of B:pcDNA3.1/V5HISA empty plasmid;
C:pcDNA3.1/CXCL12 recombinant plasmid transfection HEK293FT cell.
Fig. 4 pig chemokine CXCL12 mammalian cell expression plasmid structure iron of recombinating
CMV promotor (CMV promoter): bases 209-863
T7 promotor (T7 promoter/priming site): bases 863-882
Multiple clone site (Multiple cloning site): bases 902-924
Pig chemokine CXCL12 (SCXCL12): bases 925-1273
V5 label (V5 epitope): bases1331-1372
Polyhistidyl (Polyhistidine (6xHis) tag): bases 1382-1399
Ox somatomedin poly A (BGH polyadenylation signal): bases 1421-1635
F1 replication origin (f1 origin of replication): bases 1688-2111
SV40 promotor and replication origin (SV40 promoter and origin): bases2176-2500
Neomycin resistance gene (Neomycin resistance gene): bases 2536-3330
SV40 poly A (SV40 polyadenylation signal): bases 3349-3587
Plasmid skeleton (pUC origin): bases 4019-4692
Ampicillin resistance gene (Ampicillin resistance gene): bases 4837-5697
The western blot of the reorganization pig chemokine CXCL12 fusion rotein of Fig. 5 purifying
1:pcDNA3.1/V5HISA empty plasmid contrast
2: the CXCL12 albumen (17Kd) of purifying;
(5) embodiment
1. the extraction of the total RNA of pig spleen cell
Extract total RNA with the Trizol method.Add 1mLTrizol in the spleen tissue that 100mg shreds, with pipettor pressure-vaccum repeatedly, incubated at room 5 minutes adds chloroform 0.2mL, and room temperature is placed 5min behind the thermal agitation mixing.4 ℃ of centrifugal 15min of 12000r/min draw the upper strata water, and another centrifuge tube of dislocation adds the 0.5ml Virahol, puts upside down mixing, and room temperature leaves standstill 10min, and 4 ℃, the centrifugal 15min of 12000r/min abandons upper phase.Add freezing 75% ethanol 1mL, thorough washing precipitation, 4 ℃, the centrifugal 10min of 12000r/min.Abandon supernatant, (15~20min), precipitation is dissolved in the DEPC water of no Rnase, carries out reverse transcription immediately, or puts in-80 ℃ of refrigerators and preserve to put air drying.
2RT-PCR
The RNA that gets 2 μ g becomes the cDNA of pig CXCL12 with the reverse transcription of AMV ThermoScript II, and as template, carries out pcr amplification CXCL12 gene.Reaction system: 10 * buffer 2.5 μ L, MgCl
22.0 μ L, 2.5mmol/L dNTP0.5 μ L, each 0.5 μ L of primer, 5U/ μ L Taq enzyme 0.2 μ L, ddH
2O 18.3 μ L, template 0.5 μ L counts 25 μ L reaction systems.Amplification condition: 94 ℃ of pre-sex change 10min, 94 ℃ of 30s sex change, 58 ℃ of 30s annealing, 72 ℃ of 1min extend; Circulate 30 times; Last 72 ℃ are extended 10min.Pcr amplification product electrophoresis (seeing accompanying drawing 1) reclaims the purpose fragment.
3.pcDNA3.1/CXCL12 construction of recombinant plasmid and evaluation
With BamH I and EcoR I difference enzyme pcDNA3.1/V5HisA and CXCL12 gene fragment, dna gel reclaims test kit and reclaims endonuclease bamhi.To reclaim fragment is 3: 1 by goal gene and carrier concn, reaction system 10 μ L, and 4 ℃ connect 12h under the effect of T4 ligase enzyme, transform DH5 α competence bacteria.Through the penbritin screening, picking positive colony bacterium colony shakes bacterium and extracts plasmid, carries out BamH I and EcoR I double digestion and identifies (seeing accompanying drawing 2), and enzyme is cut evaluation and correctly carried out dna sequencing again, and right-on plasmid is pcDNA3.1/CXCL12 (seeing accompanying drawing 4).
4. increase bacterium and extract plasmid
The a large amount of cultivation utilized QIAGEN DNA plasmid purification test kit, extracts plasmid, and electrophoresis is identified.Detailed process is as follows:
(1) screening and cloning is drawn plate again, picking list bacterium colony is inoculated in the test tube that contains 10mL LB substratum, and 37 ℃ of concussion overnight incubation are got the 1mL culture and are inoculated in the test tube that contains 100mLLB (containing 100 μ g/mL) substratum, 37 ℃ of concussion overnight incubation.
(2) utilize QIAGEN DNA plasmid purification test kit to extract plasmid:
1) gets the 30mL bacterial cultures in the 50mL centrifuge tube, the centrifugal bacterial precipitation that makes.
2) add 1mL lysate I, thermal agitation, suspension thalline.
3) add 1mL lysate II, mixing gently, ice bath is no more than 5 minutes.
4) add 1mL lysate III, vibration up and down, ice bath 10 minutes.
5) the centrifugal 10min of 12000r/min.
6) supernatant liquor is packed in the chromatography column, vertically leave standstill, treat that supernatant liquor passes through chromatography column fully.
7) add the 2mL wash-out, vertically leave standstill, treat that elutriant passes through chromatography column fully.
8) collect elutriant, detect DNA concentration ,-20 ℃ of refrigerators are preserved standby.
5. recombinant plasmid transfection HEK293FT cell
Merge HEK293FT cell with Opti-MEM nutrient solution washing, carry out transfection by liposome Lipolectamine TM2000Reagent operation instruction to 70%, plasmid DNA with Opti-MEM dilution mixing after room temperature effect 5min.With room temperature effect 5min behind the mixing in another pipe of liposome Lipofeetamine 2000 addings Opti-MEM substratum, will dilute plasmid DNA and liposome nutrient solution mixing, room temperature effect 20min.Mixture is slowly added in the cell.Place 4h under 37 ℃, 5%CO2 condition, sucking-off transfection liquid, the DMEM complete culture solution that changes 10% foetal calf serum into continues to cultivate 24h.
6.IFA detect the transient expression of pig CXCL12
HEK293FT Tissue Culture Plate behind the transfection 24h is abandoned nutrient solution, with seasoning after the PBST washing 1 time, with the fixing 30min of 4 ℃ of the 700mL/L ethanol of precooling, seasoning.With the PBST washing, to get the 6*HIS monoclonal antibody and do dilution in 1: 100 with PBST, every hole adds 200 μ L serum dilutions, puts 37 ℃ of effect 45min in the wet box.With PBST washing 3 times, each 5min, seasoning.The rabbit anti-mouse igg of FITC mark was diluted among the PBST by 1: 100, and every hole adds 200 μ L and puts 37 ℃ of effect 45min in the dark wet box.With PBST washing 3 times, after the deionized water wash desalination, fluorescent microscope is observed down, when the positive cell that can send fluorescence surpasses 10%, is transfection success (see figure 3).
7. prepare reorganization pig chemokine CXCL12 albumen
With HEK293 cell inoculation 24 orifice plates, every hole 1ml MEM+10%FBS (foetal calf serum) is cultured to 70%~80% cytogamy.Every hole adds liposome-DNA transfection liquid (pcDNA3.1/CXCL122 μ g, liposome 2 μ g) expression plasmid mixing solutions, shakes mixing slightly, in 37 ℃, CO
2Cultivated 6 hours in 5% the incubator, abandon transfection liquid, every hole adds the DMEM1ml that contains 10%FBS, use the cell pyrolysis liquid lysing cell after 60~72 hours, collecting cell lysate, 10000r/min, collect supernatant liquor, be reorganization pig chemokine CXCL12 protein crude extract.
8. pig chemokine CXCL12 albumen is purified
With above-mentioned reorganization pig chemokine CXCL12 crude extract High-Affinity Ni-NTA Resin purifying protein, carry out Westernblot with anti-V5 or 6*His monoclonal antibody, discovery has the protein band of 17kD, is reorganization pig chemokine CXCL12 albumen (see figure 5).
9. the proteic active detection of pig chemokine CXCL12
Extract fresh pig venous blood and join in the anticoagulant heparin pipe, add the PBS suspension cell of equivalent.Cell suspension carefully is added in the lymphocyte separation medium with blood aliquot the centrifugal 500g of level 20 minutes.Draw the PBMC between plasma layer and the lymphocyte separation medium, add the RPMI1640 nutrient solution that contains 2% calf serum of 2 times of amounts, centrifugal 200g is 10 minutes behind the mixing, washes cell 2 times with same washing lotion again, each centrifugal 500g 10 minutes.Make concentration reach 2X10 with the RPMI-1640 suspension cell that contains 10% foetal calf serum
6/ 100ul.On 5um Transwell cell, add the PBMC that 100ul prepares in the hole, add in the following hole and contain the proteic RPMI1640 nutrient solution of CXCL12 600ul, and do negative control with nutrient solution.If 3 repetitions.37 ℃, 5%CO
2Hatch 2h in the incubator, to the cell counting in the following hole.Statistical analysis: data are represented with mean ± standard deviation, carry out data analysis with the SPSS statistical software.Analysis is checked with t, and the cell counting under the experimental group in the hole is higher than control group, and P<0.05 is considered to have statistical significance.10. the proteic application of reorganization pig chemokine CXCL12
Every weanling pig breeds with 1 part pig and mixes use with disordered breathing syndrome (PRRS) vaccine by 10~100ng pig chemokine CXCL12 that will recombinate, breeding of inoculation pig and disordered breathing syndrome virus (PRRSV) negative antibody health pig, two weeks back collection pig blood sample, separation of serum, detect PRRSV antibody, with only compare with the control group of PRRS vaccine, antibody increases by 4 times, the pig chemokine of recombinating be described, and CXCL12 is effective as vaccine adjuvant.
Claims (3)
1. a reorganization pig chemokine CXCL12 mammalian cell expression plasmid is characterized in that its nucleotide sequence is shown in SEQ ID NO:3; Its CXCL12 Argine Monohydrochloride sequence is shown in SEQ ID NO:4.
2. a reorganization pig chemokine CXCL12 albumen is characterized in that making the immune effect that agent can strengthen pig blue-ear disease vaccine as immunity.
3. to be every weanling pig use with disordered breathing syndrome PRRS vaccine mixing intramuscular injection with 1 part pig breeding by 10~100ng pig chemokine CXCL12 albumen of will recombinating for a kind of reorganization pig chemokine CXCL12 albumen according to claim 2, the consumption that it is characterized in that being used to strengthening the pig blue-ear disease vaccine immune effect.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201010573214XA CN102094043B (en) | 2010-11-23 | 2010-11-23 | Pig chemotactic factor CXCL12 gene and its uses |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201010573214XA CN102094043B (en) | 2010-11-23 | 2010-11-23 | Pig chemotactic factor CXCL12 gene and its uses |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102094043A true CN102094043A (en) | 2011-06-15 |
CN102094043B CN102094043B (en) | 2012-11-07 |
Family
ID=44127310
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201010573214XA Expired - Fee Related CN102094043B (en) | 2010-11-23 | 2010-11-23 | Pig chemotactic factor CXCL12 gene and its uses |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102094043B (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101333531A (en) * | 2008-08-06 | 2008-12-31 | 温州医学院 | CXCR4 antagonist recombination protein SDF-1 beta P2G, preparation method and application thereof |
CN101835800A (en) * | 2007-10-24 | 2010-09-15 | 普罗塔芬生物技术股份公司 | Glycosaminoglycan antagonist and using method thereof based on SDF-1 |
WO2010027502A9 (en) * | 2008-09-05 | 2011-04-14 | Duke University | Method of inducing an anti-viral immune response |
-
2010
- 2010-11-23 CN CN201010573214XA patent/CN102094043B/en not_active Expired - Fee Related
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101835800A (en) * | 2007-10-24 | 2010-09-15 | 普罗塔芬生物技术股份公司 | Glycosaminoglycan antagonist and using method thereof based on SDF-1 |
CN101333531A (en) * | 2008-08-06 | 2008-12-31 | 温州医学院 | CXCR4 antagonist recombination protein SDF-1 beta P2G, preparation method and application thereof |
WO2010027502A9 (en) * | 2008-09-05 | 2011-04-14 | Duke University | Method of inducing an anti-viral immune response |
Non-Patent Citations (2)
Title |
---|
《Cancer Biother Radiopharm.》 20050831 Shi M, et al "Vaccine of engineered tumor cells secreting stromal cell-derived factor-1 induces T-cell dependent antitumor responses." 1-3 第20卷, 第4期 * |
《山东畜牧兽医》 20090630 张元鹏 等 "猪趋化因子CXCL12及其受体CXCR4真核表达载体的构建" 1-3 第30卷, 第6期 * |
Also Published As
Publication number | Publication date |
---|---|
CN102094043B (en) | 2012-11-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
O’Connor et al. | Gill bacteria enable a novel digestive strategy in a wood-feeding mollusk | |
CN106148286A (en) | The construction method of a kind of cell model for detecting pyrogen and cell model and pyrogen test test kit | |
CN109652357B (en) | Mycoplasma bovis mutant strain with growth defect under cell co-culture and application thereof | |
CN104450616A (en) | Co-culture method of DC cell and CIK cell | |
CN102604889A (en) | HEK (human embryonic kidney) 293 cell line applicable to serum-free culture and application thereof | |
CN105567598A (en) | Tibetan pig origin bacillus amyloliquefaciens and application thereof | |
CN106399259A (en) | Porcine epidemic diarrhea virus and separation culture method | |
CN103981192B (en) | Express recombined adhenovirus and its construction method and the application of goat alpha interferon | |
CN113980912B (en) | Gene knockout cell line capable of replicating IBV virus QX subtype strain, construction method and application thereof | |
CN102600466B (en) | Anti-influenza A virus and novel universal epitope vaccine and preparing method thereof | |
CN103882018A (en) | Back-to-back primer pair for amplifying pigeon torque teno virus complete genome sequence and application thereof | |
CN105400745A (en) | Porcine reproductive and respiratory syndrome virus (PRRSV) genetic engineering strain, inactivated vaccine thereof, and preparation method of inactivated vaccine | |
CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
CN102899293A (en) | Mesenchymal stem cells genetically modified with angiopoietin 1 gene and construction method and application thereof | |
CN102094043A (en) | Construction and application of recombinant pig chemotactic factor CXCL12 mammalian cell expression plasmid | |
CN110577934A (en) | Construction method and application of TLR4 gene knocked-down porcine alveolar macrophage cell line | |
CN110106151B (en) | Mink-derived Nectin4 receptor-based canine distemper virus sensitive cell line, and preparation method and application thereof | |
CN104450781B (en) | A kind of cell line of overexpression CIAPIN1 albumen and its preparation method and application | |
CN103012578A (en) | Recombinant porcine interleukin 2, and encoding gene and expression method thereof | |
CN102898512A (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
CN110904056B (en) | Infectious bronchitis virus rH120-YZS1 delta 5a and construction method and application thereof | |
CN101402954A (en) | Method for expressing recombinant pig lactoferrin N leaf with pichia thermophilic methanol yeast | |
CN102776155A (en) | Chinese isolated strain of bovine enterovirus, and construction and application of infectious cDNA clone thereof | |
CN105001340A (en) | Animal fusion recombinant interferon | |
CN107266581B (en) | Preparation method and application of Tibetan pig IL-12 recombinant plasmid enhanced PCV2 vaccine immunologic adjuvant |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121107 Termination date: 20131123 |