CN102091333B - Application of miR-124 in preparation of medicines for preventing infectious shock - Google Patents
Application of miR-124 in preparation of medicines for preventing infectious shock Download PDFInfo
- Publication number
- CN102091333B CN102091333B CN2010105566192A CN201010556619A CN102091333B CN 102091333 B CN102091333 B CN 102091333B CN 2010105566192 A CN2010105566192 A CN 2010105566192A CN 201010556619 A CN201010556619 A CN 201010556619A CN 102091333 B CN102091333 B CN 102091333B
- Authority
- CN
- China
- Prior art keywords
- mir
- application
- septic shock
- preparation
- medicines
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses a new application of miR-124 in preparation of medicines for preventing infectious shock, thereby expanding the application range of the miR-124, and providing a new way for treating infectious shock.
Description
Technical field
The present invention relates to the new application of endogenous micromolecule nucleic acid miR-124 in field of medicaments.
Background technology
MiRNAs (microRNAs) is a kind of endogenic micromolecule rna regulation, can act on 3 ' UTR structure of said target mrna, blocks the translation process of this gene, thereby regulator gene is expressed.
MiR-124 a kind of micromolecule nucleic acid with regulating and controlling effect that comes to this, its nucleotides sequence is classified UAAGGCACGCGGUGAAUGCC (shown in SEQ ID No.1), mirBase Accession:MIMAT0000134 as.
At present, the miR-124 correlational study concentrates on its effect in the regulation and control growth promoter.Document (ChengLC; Pastrana E; Tavazoie M; Et al.miR-124regulates adult neurogenesis in thesubventricular zone stem cell niche [J] .Nat Neurosci.2009,12 (4): 399-408) report, ventricles of the brain inferior segment endogenous miR-124 can suppress the expression of transcription factor Sox9; Thereby promote stem cells hyperplasia and postpone its neurad unit differentiation, proved that miR-124 plays an important role in the neuronotropic evolution of ventricles of the brain inferior segment stem cell pedigree.But the relevant miR-124 of Shang Weijian is at the report in anti-septic shock field.
Summary of the invention
Technical problem to be solved by this invention provides the application of a kind of new field of medicaments of miR-124, thereby expands its range of application.
The present invention relates to the application of miR-124 in the medicine of preparation anti-septic shock.
Wherein, described miR-124 is a kind of endogenic micromolecule rna regulation, and its nucleotide sequence is shown in SEQ ID No.1.
Wherein, the preferable medicine of the medicine of described anti-septic shock for prevention or treatment septic shock.Described septic shock is preferable is the septic shock due to the endotoxin LPS.In the medicine of described anti-septic shock, can only contain miR-124, also can also contain other active component except that miR-124 as unique active component.Described other active component does not have harmful effect can unite other active component of use for the infection shock effect to miR-124, like other infection shock active component.
In the medicine of described anti-septic shock, the content of miR-124 specifically can be selected for more than the treatment effective dose as required.The medicine of described anti-septic shock can be the conventional various dosage forms that are applicable to miR-124 in this area.
Agents useful for same of the present invention and raw material are all commercially available to be got.
Positive progressive effect of the present invention is: the invention provides the new application of miR-124 in the medicine of preparation anti-septic shock, thereby expanded its range of application, also for the septic shock field new treatment approach is provided.
Description of drawings
Fig. 1 is 24h mice survival curve figure after the additional administration of endotoxin (LPS).
The specific embodiment
Mode through embodiment further specifies the present invention below, but does not therefore limit the present invention among the described scope of embodiments.
Embodiment 1
1, experiment material
Endotoxin (LPS) is bought the company in SIGMA.
MiR-124 and negative control reagent thereof are commercial synthetic by the sharp rich bio tech ltd in Guangzhou.
Negative control reagent and miR-124 sequence similarity, but do not have the nucleic acid molecules of physiological action, sequence is: UGACGACAGCGGUGAAUGCC.
The Balb/c mice is purchased the pul in the west, Shanghai---and must triumphant laboratory animal company limited.
2, experimental technique
(1) gets 28 of the male Blab/c mices of 18-22g, be divided into two groups (miR-124 group and matched groups) at random, 14 every group.
(2) matched group tail vein injection every day equal volume negative control reagent, successive administration three days.
MiR-124 group tail vein injection miR-124100nmol/kg every day, successive administration three days increases the interior miR-124 content of animal body.
(3) administration is after three days, and two groups of mouse peritoneal injection endotoxin (LPS) 10mg/kg are to cause zoogenetic infection property shock.Observe 24 hours two groups of mices death all takes place, replenished to endotoxin (LPS) 15mg/kg, replenish the administration continued and observe 24h mice existence situation (like table 1 and shown in Figure 1) in the 26th hour.
The septic shock animal model makes up list of references: Antishock effect of anisodamineinvolves a novel pathway for activating alpha7nicotinic acetylcholine receptor [J] (Liu C; Shen FM; Le YY; Et al.Crit Care Med, 2009,37 (2): 634)
Table 1
Visible by table 1 and Fig. 1, after miR-124 crosses expression in the animal body, can significantly improve the survival rate of 24 hours endotoxemia mices, be increased to 35.7% from 0%.
Claims (2)
1. the application of nucleic acid miR-124 in the medicine of preparation anti-septic shock; The nucleotide sequence of described miR-124 is shown in SEQ ID No.1; Wherein, described septic shock is a septic shock due to the endotoxin.
2. application as claimed in claim 1 is characterized in that: the medicine of described anti-septic shock is the medicine of prevention or treatment septic shock.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105566192A CN102091333B (en) | 2010-11-23 | 2010-11-23 | Application of miR-124 in preparation of medicines for preventing infectious shock |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105566192A CN102091333B (en) | 2010-11-23 | 2010-11-23 | Application of miR-124 in preparation of medicines for preventing infectious shock |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102091333A CN102091333A (en) | 2011-06-15 |
| CN102091333B true CN102091333B (en) | 2012-05-30 |
Family
ID=44124712
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105566192A Expired - Fee Related CN102091333B (en) | 2010-11-23 | 2010-11-23 | Application of miR-124 in preparation of medicines for preventing infectious shock |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102091333B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012106586A1 (en) | 2011-02-03 | 2012-08-09 | Mirna Therapeutics, Inc. | Synthetic mimics of mir-124 |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10148886A1 (en) * | 2001-10-04 | 2003-04-30 | Avontec Gmbh | Inhibition of STAT-1 |
| JP2009501521A (en) * | 2005-07-13 | 2009-01-22 | ベス イスラエル ディーコネス メディカル センター | Methods for diagnosing and treating inflammatory responses |
-
2010
- 2010-11-23 CN CN2010105566192A patent/CN102091333B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102091333A (en) | 2011-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rottiers et al. | MicroRNAs in metabolism and metabolic diseases | |
| Nejad et al. | A guide to miRNAs in inflammation and innate immune responses | |
| Gurha | MicroRNAs in cardiovascular disease | |
| Chen et al. | Identification and functional characterization of Dicer2 and five single VWC domain proteins of Litopenaeus vannamei | |
| Pottier et al. | FibromiRs: translating molecular discoveries into new anti-fibrotic drugs | |
| Singh et al. | The role of miRNA in inflammation and autoimmunity | |
| Giuliani et al. | Mitochondrial (Dys) function in inflammaging: do MitomiRs influence the energetic, oxidative, and inflammatory status of senescent cells? | |
| Liang et al. | Nuclear microRNAs and their unconventional role in regulating non-coding RNAs | |
| Kim et al. | miRNA degradation in the mammalian brain | |
| Wolpaw et al. | MYC-induced metabolic stress and tumorigenesis | |
| CN104673812B (en) | A kind of insect cell cytochrome p 450 gene and its application | |
| CN102091333B (en) | Application of miR-124 in preparation of medicines for preventing infectious shock | |
| Jeker et al. | Targeting microRNAs for immunomodulation | |
| Li et al. | miR-548k regulates CXCL13 expression in myasthenia gravis patients with thymic hyperplasia and in Jurkat cells | |
| Sharma et al. | Harnessing the induction of cardiomyocyte proliferation for cardiac regenerative medicine | |
| Wang et al. | p-CREB-1 promotes hepatic fibrosis through the transactivation of transforming growth factor-β1 expression in rats | |
| Sen et al. | miRNA: licensed to kill the messenger | |
| CN103751807B (en) | A kind of method utilizing RNA perturbation technique to prevent and treat apis cerana sac brood | |
| Ju et al. | Role of microRNAs in skeletal muscle development and rhabdomyosarcoma | |
| Duan et al. | Influence of miR-30b regulating humoral immune response by genetic difference | |
| Course et al. | Endogenous MicroRNA competition as a mechanism of shRNA-induced cardiotoxicity | |
| Das et al. | Micro RNA mimics and antagonists | |
| CN101906417A (en) | shRNA for hepatitis B virus and recombinant adeno-associated virus vector treating vector carrying same | |
| Jones | Teaming up to tackle RNAi delivery challenge | |
| Teymoori et al. | Non-coding RNAs Could Be New Tools for Cancer Treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120530 Termination date: 20131123 |