CN102071185B - Efficient gene knockout method of pseudomonas putida KT2440 - Google Patents
Efficient gene knockout method of pseudomonas putida KT2440 Download PDFInfo
- Publication number
- CN102071185B CN102071185B CN2010105752020A CN201010575202A CN102071185B CN 102071185 B CN102071185 B CN 102071185B CN 2010105752020 A CN2010105752020 A CN 2010105752020A CN 201010575202 A CN201010575202 A CN 201010575202A CN 102071185 B CN102071185 B CN 102071185B
- Authority
- CN
- China
- Prior art keywords
- gene
- pseudomonas putida
- recombinase
- pls512
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for performing gene knockout on pseudomonas putida KT2440 by a recombinant engineering measure. The method comprises the following specific steps of: amplifying through an overlapped-extension polymerase chain reaction so as to obtain a deoxyribonucleic acid (DNA) fragment of which both sides are provided with target genes to be knocked, the upstream and downstream are provided with homologous genes of about 500 base pairs and the middle is provided with a kanamycin resistance gene; electrically transforming the DNA fragment into a pseudomonas putida KT2440 electro-transformation competent cell which is expressed by toluic acid induction recombinase with the final concentration of 2mM; and replacing the target genes by the kanamycin resistance gene through homologous recombination between homologous fragments of a recombinase mediate so as to directly obtain a mutant strain from which target genes are knocked. The method is simple and convenient and can become a genetic operating measure of an environmental microorganism, namely pseudomonas putida KT2440 which has important application value in the aspects of organic compound biodegradation and the like.
Description
Technical field
The present invention relates to the genetically engineered field, specifically relate to a kind of method of efficiently pseudomonas putida KT2440 being carried out gene knockout.
Background technology
Pseudomonas putida KT2440 (Pseudomonas putida KT2440) is important pattern environmental microorganism bacterial strain, is widely used in researchs such as physiology, ecology, biological chemistry, genetics, also is the good host bacterium of expression of heterologous genes.The genome of pseudomonas putida KT2440 was resolved in 2002, also was that first is assert environmentally safe gram negative strain by the u.s. department of health recombinant DNA council.Pseudomonas putida KT2440 is the saprophytic pseudomonas that genetic research is so far set forth the most clearly, metabolism diversity is studied the most thoroughly; It has kept in environment the characteristics of existence and performance function, and reaching in the degraded of important environmental activity such as element circulation, organism and inorganic matter pollutent has very big development potentiality at aspects such as biocatalysis, biological blowdown, biological plasticss.Through genetic manipulation, make " super engineering bacteria " of pseudomonas putida KT2440 for the multiple environmental pollutant of degraded, will be significant to environment protection and biological control.Gene knockout is the main mode of bacterial strain genetic manipulation; Also be the research of carrying out gene and protein function, set forth the main method of biodegradable approach and regulation and control, therefore develop quick, easy, efficient and can the quantized gene knockout of high pass be the important prerequisite that makes full use of pseudomonas putida KT2440.
Conventional pseudomonas putida KT2440 gene knockout method is the recA recombination system that utilizes bacterial strain itself to be had.At first utilize the homologous gene of polymerase chain reaction (PCR) amplification target gene upstream and downstream to be knocked out; After cloning and sequencing is correct; Subsequently resistant gene is cloned in the middle of the homologous gene of upstream and downstream, then be cloned into can not " suicide " carrier of self-replacation in pseudomonas putida KT2440 in.With recombinant plasmid transformed to pseudomonas putida KT2440; Under antibiotic resistance effect; Homologous recombination between the recA recombination system catalysis homologous fragment that bacterial strain itself had and recombinant plasmid is integrated into genome; The negative screening effect of being exercised through the sacB gene of encoding sucrose 6-fructose-transferring enzyme entrained on the recombinant plasmid at last; In the substratum that contains 10% sucrose, impel and a homologous recombination takes place again and remove the plasmid skeleton part that is integrated on the genome, so resistant gene replaces target gene and has realized gene knockout.
Though this method is effective, clone, consuming time, the consumption power of a plurality of steps of order-checking have also increased the expense of testing.Do not see and adopt this method to realize the report that big fragment gene knocks out that this method also has needs special carrier, be difficult to high pass quantification or the like shortcoming.
Recombined engineering be last century late nineteen eighties rise and the genetic engineering technique of sophisticated gradually a kind of dna clone and modification.It utilizes homologous recombination and form effect between the catalytic dna fragmentation of recombinase.At present widely used recombinase be the exo that comes from the lambda phage; Bet and gam gene, exo (reda) genes encoding DNA 5'->3 excision enzymes, it acts on double-stranded DNA and obtains the dna molecular that the 3' distal process goes out; Bet (redb) genes encoding dna single chain binding protein; It is combined on the outstanding dna molecular, and Bet has recombinase active concurrently, can between the catalysis homologous fragment homologous recombination take place.Gam (redg) genes encoding suppresses the Gam albumen of endogenous nucleicacidase, Gam can protect external source, be converted into the degraded that double chain DNA fragment in the host bacterium of being studied is avoided the endogenous dna enzyme.
The length of homologous fragment can be as short as 36 base pairs in intestinal bacteria, and these feasible means through simple and easy to do PCR obtain the linear dsdna molecule and be used for transformed into escherichia coli to realize that gene knockout becomes possibility.Researchists such as Datsenko have reported in 2000 and have utilized the recombined engineering means to realize colibacillary gene knockout (Datsenko; K.A. and B.L. Wanner; One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A, 2000. 97 (12): 6640-5).The resistant gene electricity that homology arm (promptly with target gene upstream and downstream 5' end or one section consistent base sequence of 3' terminal sequence) is contained in they will obtain through PCR, both sides is converted into through L-arabinose and induces and in the Bacillus coli cells of express recombinant enzyme, go on foot resistance screening through one and directly obtained the intestinal bacteria mutant strain that target gene knocks out.This research has produced extensively and far-reaching influence has promoted the research and development of recombined engineering.
Recombined engineering is in the gene clone of routine and modifying method is difficult to carry out or significant advantage is arranged during efficient extremely low (excessive like dna fragmentation, be difficult to seek proper restriction site, dna gel reclaims and is difficult to carry out or the like).Recombined engineering has been avoided electrophoresis, uv irradiating (can introduce unusual sudden change), gel recovery, DNA connection, conversion, colony screening or the like loaded down with trivial details operation steps consuming time, can realize gene clone efficiently and modification.Recombined engineering becomes conventional gene clone and modification means gradually.
Recombined engineering be at first in colibacillary genetic manipulation, take place, development and ripe, the researchist constantly this technology is applied to be worth with research more and the microbial strains of actual application value in, majority has been obtained gratifying effect.But in different mikrobes, the length of homologous fragment need be adjusted, and need develop the different systems that induce with the express recombinant enzyme.
Summary of the invention
To the problems referred to above, the invention provides the method that a kind of method through recombined engineering realizes the gene knockout of pseudomonas putida KT2440 efficient quick.
A kind ofly use simple and efficient recombined engineering method to realize pseudomonas putida KT2440 gene knockout the invention provides.The acquisition that contains the resistant gene of waiting to knock out the target gene upstream and downstream obtains through overlapping-extension PCR.Adopt the method amplification of PCR to wait to knock out the homologous gene in homologous gene, resistant gene and the downstream at the target gene upper reaches at first respectively, respectively at design eclipsed base sequence between upper reaches homologous gene and the resistant gene, between resistant gene and the downstream gene.Three fragments of gained are merged the back as template, the dna fragmentation that obtains merging with the primer amplification of both sides again.Use this overlapping-the extension PCR technology can obtain to be used to be converted into the linear DNA molecule of pseudomonas putida KT2440 apace.When the primer of design gene knockout; Consider the gene distribution situation of target gene both sides to be knocked out; Knock out in the reading frame of realization target gene, make target gene knock out the left kalamycin resistance gene in back and do not cause polar effect, promptly do not destroy the adjacent expression of gene of target gene.
The technical scheme that the present invention adopted may further comprise the steps:
(1) obtains homologous gene, centre that the left and right sides is respectively each 500 base pair of target gene upstream and downstream to be knocked out through the overlapping-means amplification of extending the polymerase chain reaction and be the dna fragmentation of kalamycin resistance gene;
The plasmid pLS512 that (2) will contain recombinase gene is converted among the pseudomonas putida KT2440, processes electric transformed competence colibacillus cell;
(3) the dna fragmentation electricity that obtains of step (1) is converted into the final concentration to the 2mM m-methyl benzoic acid induces in the pseudomonas putida KT2440 electricity transformed competence colibacillus cell of the step (2) that recombinase expresses; Through the homologous recombination between the homologous fragment of recombinase-mediated, kalamycin resistance gene has replaced target gene and has directly obtained the mutant strain that target gene knocks out.
In the mutant strain that obtains, recombinase expression vector pLS512 that may remaining trace to this, can be that pLS512 plasmid remaining in the mutant strain is removed in 10% the negative screening effect of sucrose through concentration.The sacB gene that contains encoding sucrose 6-fructose-transferring enzyme among the pLS512, the sacB gene is negative selection markers, is that 10% sucrose is removed the recombinase expression vector that contains the sacB gene through in substratum, adding concentration.
It is the exo that comes from the lambda phage that recombinase gene is selected; Bet and gam; After these three genes are increased from the lambda phage DNA; Be cloned into conventional height copy escherichia coli cloning carrier pBluescript KS (-), treat that order-checking is correct after, the enzyme switchback is received from the recombinant plasmid; But the sacB gene with coding 6-fructosyl transferase is cloned on the carrier pJB866 of the self-replicating that can in pseudomonas putida KT2440, be the free form existence subsequently, finally obtains recombinase expression vector pLS512.Recombinase gene places and receives to have guaranteed recombinase abduction delivering of short duration, preciseness like this under the m-methyl benzoic acid inductive Pm promotor among the pLS512, has avoided undue express recombinant enzyme and the generation of the unusual reorganization that causes.The sacB gene plays the effect of negative selection markers, and under the situation that contains 10% SM, the 6-fructosyl transferase catalysis sucrose of sacB genes encoding forms the virulent ficoll of bacterial strain, and the bacterial strain that therefore contains sacB genetic expression can not be survived.So can remove micro-pLS512 remaining in the mutant strain effectively, obtain mutant strain with good genetic background.
Knock out the 1.0kb in the pseudomonas putida KT2440 genome in the preferred embodiment, the meliority that three experiments of 7.3kb and 9.3kb have fully proved the more conventional employed method of the inventive method promptly: easy, quick and can carry out the high-throughput operation of a plurality of gene knockouts simultaneously.Similarly, can take to realize with the same strategy of gene knockout that gene is knocked in transgenation or the like studies.
Description of drawings
Fig. 1 is the collection of illustrative plates that the m-methyl benzoic acid of 11910 base pairs is induced the plasmid pLS512 of recombinase expression.Wherein:
469-598 receives m-methyl benzoic acid inductive Pm promoter sequence;
599-1015 is the open reading frame sequence that coding suppresses the gam gene of endogenous nucleicacidase;
1021-1806 is the open reading frame sequence of the bet gene of coding DNA single strand binding protein;
1803-2483 is coding DNA 5'->open reading frame sequence of the exo gene of 3 excision enzymes;
2491-3912 is the open reading frame sequence of sacB gene of the gene of coding 6-fructosyl transferase;
4349-4958 is two-way terminator zone;
5009-6157 is the open reading frame sequence of regulatory gene trfA, and trfA is that plasmid replication institute is necessary;
6555-7080 is the replicon zone of plasmid;
7654-8853 is the open reading frame sequence of tetracycline resistance gene tetA;
8959-9609 is the open reading frame sequence of regulatory gene tetR, and tetR is that tetA expression institute is necessary;
10064-10174 RK2 is that plasmid combines the forwarding function fragment
10714-11679 is the open reading frame sequence of regulatory gene xylS, and xylS is that the active institute of Pm is necessary;
XbaI on the plasmid figure, NsiI, EcoRI etc. are restriction enzyme site, the relative position of numeral restriction enzyme site on plasmid in the bracket.
Fig. 2 is that overlapping-extension polymerase chain reaction (OE-PCR) and this fragment of amplification homologous gene and resistant gene is used for pseudomonas putida KT2440 gene knockout synoptic diagram.
The target gene that gene representation is to be knocked out; Upstream and downstream is represented the homologous gene of target gene upstream and downstream; P1 and P2 are the homogenic primer of amplified target upstream region of gene; P3 and P4 are the segmental primer of amplification kalamycin resistance gene; P5 and P6 are the homogenic primers in amplified target gene downstream, and P2 and P3, P4 and P5 contain the carrying out that the eclipsed base is beneficial to overlapping-extension PCR reaction; PCR representes the polymerase chain reaction; The overlap is to contain the box indicating of oblique line; Thick lines are represented target gene both sides fragment on the genome.Be primer with P1 to P6 at first, pcr amplification goes out upper reaches homologous gene, kalamycin resistance gene and downstream homologous gene, is template with three fragments subsequently, and P1 and P6 are that primer amplifies the DNA product that three fragments merge with overlapping-extension PCR.DNA product electricity transforms the electric transformed competence colibacillus cell of inducing the pseudomonas putida KT2440/pLS512 of recombinase expression through the 2mM m-methyl benzoic acid; Under the screening effect of kantlex; The homologous gene generation homologous recombination of the target gene both sides on DNA that process transforms and the genome of pseudomonas putida KT2440; Kalamycin resistance gene has replaced target gene, finally obtains the mutant strain that target gene knocks out.
Fig. 3 is the gel electrophoresis result of the gene type assay of PP_3948 gene knockout gained mutant strain among the embodiment 2
1. DL2000 molecular weight standard: 2.0,1.0,0.75,0.5,0.25,0.1 kb;
2. be template with the genome that becomes strain, amplification obtains 2.2 kb fragments;
3. the genome with former strain is a template, and amplification obtains 2.25 kb fragments;
4. 2.2 kb cut with the PstI enzyme and obtain 0.9kb and 1.3kb;
5. 2.25 kb cut with the PstI enzyme and obtain 0.7kb and 1.5kb.
Fig. 4 is the gel electrophoresis result of the gene type assay of PP_1384 gene knockout gained mutant strain among the embodiment 3
1. DL2000 molecular weight standard: 2.0,1.0,0.75,0.5,0.25,0.1 kb;
2. be template with the genome that becomes strain, amplification obtains 2.1 kb fragments;
3. 2.1 kb cut with the PstI enzyme and obtain 0.3,0.6kb and 1.2kb;
4. 2.1 kb cut with the NcoI enzyme and obtain 0.8kb and 1.3kb;
(annotate: under employed PCR condition, primer can not amplify product from the genome of former strain KT2440, so do not add the PCR result of former strain).
Fig. 5 is the gel electrophoresis result of the gene type assay of PP_2064 gene knockout gained mutant strain among the embodiment 4
1. DL2000 molecular weight standard: 2.0,1.0,0.75,0.5,0.25,0.1 kb;
2. be template with the genome that becomes strain, amplification obtains 2.1 kb fragments;
3. 2.1 kb cut with the NcoI enzyme and obtain 0.9kb and 1.2kb;
4. 2.1kb cuts with the PstI enzyme and obtains 0.8kb and 1.3kb;
(annotate: under employed PCR condition, primer can not amplify product from the genome of former strain KT2440, so do not add the PCR result of former strain).
Embodiment
Employed in the present invention term only if other explanation is arranged, generally has the implication of those of ordinary skills' common sense.
Below in conjunction with concrete embodiment, and comparable data is described the present invention in further detail.Should be understood that these embodiment just in order to demonstrate the invention, but not limit scope of the present invention by any way.
In following embodiment, various processes and the method do not described in detail are ordinary methods as known in the art.The source of agents useful for same, trade(brand)name and be necessary to list its moity person indicate when occurring first that all used thereafter identical reagent is like no specified otherwise, and is all identical with the content of indicating first.
Used bacterial strain and plasmid among the embodiment are disclosed bacterial strain and plasmid:
1.?
Escherichia?coli?DH10B。Genotype F
- McrA D (
Mrr-
HsdRMS-
McrBC) f80 d
LacZDM15 D
LacX74
DeoR
RecA1
AraD139D (
Ara,
Leu) 7697
GalU
GalK
RpsL
EndA1
NupG..Document: Life Technologies, Inc. Focus, 1990,12:19.Available from American I nvitrogen company.
2.?
Pseudomonas?putida?KT2440。Document: Nelson KE; Weinel C; Paulsen IT et al. Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environ Microbiol 2002,4:799-808.Karen doctor Nelson from U.S. The Institute for Genomic Research.
3.
?pBluescript?II?KS(-)。Document: Alting-Mees MA, Short JM. pBluescript II:gene mapping vectors. Nucleic Acids Res. 1989,17 (22): 9494. is available from U.S. Novagen company.
4.
pEX100Tlink。Document: Quenee L; Lamotte D; Polack B. Combined sacB-based negative selection and cre-lox antibiotic marker recycling for efficient gene deletion in pseudomonas aeruginosa. Biotechniques. 2005,38 (1): 63-7. is from the Benoit Polack professor of French Centre Hospitalier Universitaire.
5.
?pJB866。Document: Blatny JM; Brautaset T; Winther-Larsen HC; Et al. Improved broad-host-range RK2 vectors useful for high and low regulated gene expression levels in gram-negative bacteria.Plasmid. 1997,38 (1): 35-51. is from the Svein Valla professor of Norway Norwegian University of Science and Technology.
6.?
pKD4。Document: Datsenko KA; Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000,97 (12): 6640-5. is from the professor of the Barry Wanner of U.S. Purdue university.
7.
PGEM-T easy, available from U.S. Promega company.
1. the preparation of the electric transformed competence colibacillus of intestinal bacteria DH10B and DNA transform
On flat board the inoculation fresh streak culture single bacterium colony to 2ml LB liquid nutrient medium in 37
oThe C shaken overnight goes to 50 ml LB with 1/50 volume, and shaking culture is to thalline OD
600Be about 0.6.Pour bacterium liquid the centrifuge tube of precooling into, ice bath 10 minutes, 4
oC, centrifugal 5 minutes of 5000rpm abandons supernatant.Glycerine washing precipitation twice with 10% is suspended in 10% glycerine of 200ml at last, the every pipe packing of 50ml.
The DNA that is dissolved in TE damping fluid or distilled water is added in the electric transformed competence colibacillus cell of the DH10B that 50ml melts on ice, flick mixing.Mixed solution is transferred in the 1mm electricity revolving cup of precooling on ice, electric shock transforms.Electricity conversion condition: 200 Ω, 1800 V, the Gene Pulser II of Bio-Rad company
RThe electricity conversion instrument.Add 1ml LB liquid nutrient medium to electric revolving cup, the piping and druming mixing is transferred to solution in the aseptic 1.5ml eppendorf pipe 37
oAfter the C shaking culture 60 minutes, conversion fluid is coated on the corresponding antibiotic resistant panel, and 37
oC cultivates.Picking list bacterium colony is cultivated in containing corresponding antibiotic liquid nutrient medium, extracts plasmid and carries out the enzyme evaluation of cutting and check order.
The composition of LB substratum (%): peptone 1g, yeast extract 0.5g, sodium-chlor 1g adds the agar of 1.5% (w/v) during solid culture.115
oThe C 20min that sterilizes.
The composition of TE damping fluid: the hydrochloride of 10mM Tutofusin tris, the disodium salt of 1mM ethylenediamine tetraacetic acid (EDTA), pH 8.0.
Polymerase chain reaction (PCR)
Set up the PCR reaction system of 50ml, add respectively:
37.7?ml?dd?H
2O；
5 ml, 10 * PCR reaction buffer;
4?ml?25?mM?MgCl
2；
1?ml?10?mM?dNTP；
0.5 ml upstream primer (final concentration 0. 5mM);
0.5 ml downstream primer (final concentration 0. 5mM);
1 ml template (plasmid 50ng, genomic dna 200ng);
0.3ml Ex-Taq polysaccharase (5U/ml).
The PCR response procedures is: at first 97 ° of C denaturing treatment 5 minutes, the round-robin condition was: 97 ° of C 45 seconds, 60 ° of C 1 minute, 72 ° C 1-2 minute (look purpose product size and decide), totally 30 circulations.Extended 10 minutes at 72 ° of C at last.Use the PCR appearance of instrument as the PTC-200 model of Bio-rad company.
After reaction finishes, detect, add the ethidium bromide of 20 mg/ml in the gel with 1% agarose gel electrophoresis.PCR product deposition reclaims: add 1/10 volume 3M pH 5.2 sodium-acetates and 2 times of volume ice ethanol, mixing ,-80
o Freezing 5 min of C, centrifugal 10 minutes of 13200 rpm abandon supernatant, add 500 ml, 70% washing with alcohol, and centrifugal 5 minutes of 13200 rpm abandon supernatant, and room temperature adds the sterilized water dissolving of an amount of volume to doing.
Plasmid construction
Design primer NR1:5'-GGGGAGCTCCATGGATATTAATACTGAAACTG-3', (SEQ ID NO.1); NR2:5'-GGGTCTAGAGTCATCGCCATTGCTCCCCAAATAC-3', (SEQ ID NO.2).(available from the precious biotech firm in Dalian) is template with the lambda phage DNA; Pcr amplification goes out the recombinase gene (gam of 1.9kb; Exo and bet) fragment, to SacI and the XbaI site of pBluescript II KS (-), obtain recombinant clone pNcRed with SacI and XbaI enzyme cutting rear clone.
Design primer SAK1:5'-GGGTCTAGATTATTTGTTAACTGTTAATTGTC-3', (SEQ ID NO.3); SAK2:5'-GGGGGATCCGGCAACTTTATGCCCATGCAAC-3', (SEQ ID NO.4).With pEX100Tlink is template, and pcr amplification goes out the sacB gene fragment of 1.9kb, cuts XbaI and the BamHI site of rear clone to pBluescript II KS (-) with the XbaI-BamHI enzyme, obtains recombinant clone pKsacB.
NcoI and XbaI enzyme cutting pNcRed, the recombinase gene fragment of separating 1.9kb; XbaI and BamHI enzyme are cut pKsacB, separate the sacB gene fragment of 1.9kb.Two fragments with cut with the BamHI enzyme with AflIII and link to each other through the dephosphorylized carrier pJB866 of Ostase.NcoI and AflIII are isocaudarner, and after the viscosity base end that the two DNA that acts on produces linked to each other, two restriction enzyme site all disappeared.Through the tetracyclin resistance screening, the upgrading granzyme is cut checking, finally obtains the plasmid pLS512 that m-methyl benzoic acid induces recombinase to express.Shown in Figure 1 in the plasmid map of pLS512 such as the Figure of description.
Segmental the knocking out of embodiment 2. pseudomonas putida KT2440 genome PP_3948 gene 1.0kb
1. the preparation of pseudomonas putida KT2440 electricity transformed competence colibacillus cell and the conversion of pLS512
From being stored in-70
oRule to the LB solid medium in the frozen pipe of pseudomonas putida KT2440 of C, incubated overnight is in picking list bacterium colony to the 2ml EM liquid nutrient medium 30
oThe C shaken overnight goes to 50 ml EM substratum with 1/50 volume, and shaking culture is to thalline OD
600Be about 0.6.Pour bacterium liquid the centrifuge tube of precooling into, ice bath 10 minutes, 4
oC, centrifugal 5 minutes of 7000rpm abandons supernatant.With 3 ice-cold mM 4-HEPESs (HEPES, pH=7.0) liquid washing thalline is 3 times, thalline concentrates 300 times, the 50ml packing also is used for once electricity and transforms.
The conversion of pLS512: the pLS512 that will be dissolved in the TE damping fluid adds to the competent cell of 50ml, flicks mixing.Mixed solution is transferred in the 1mm electricity revolving cup of precooling on ice, electric shock transforms.Electricity conversion condition: 1.2 kV, 200 Ω, the Gene Pulser II of Bio-Rad company
RThe electricity conversion instrument.After electricity transforms, suspend, go to 15 ml polypropylene centrifuge tubes, 30 with 1 mL SOC substratum
oThe C shaking culture is cultivated 2 h, and it is dull and stereotyped to be applied to the LB that contains the 10mg/ml tsiklomitsin.
The composition of EM substratum (%): peptone 2g, yeast extract paste 5g, sodium-chlor 5g, glucose 5g, pH7.3,115
oThe C 20min that sterilizes.
The composition of SOC substratum (%): peptone 2.0g; Yeast extract 0.5g; Sodium-chlor 0.05g, Repone K 0.019g, pH 7.0.115
oThe C 20min that sterilizes.Add aseptic 1M magnesium chloride solution 1ml separately before using, aseptic separately 1M Adlerika 1ml and 20% glucose solution 2ml of filtration sterilization.
Induce the preparation and DNA conversion of the electric transformed competence colibacillus cell of the pseudomonas putida KT2440/pLS512 that recombinase expresses
The single bacterium colony of picking KT2440/pLS512 on the LB flat board of self-contained 10mg/ml tsiklomitsin is connected to 2ml and contains in the EM liquid nutrient medium of 10mg/ml tsiklomitsin 30
oThe C shaken overnight goes to same medium with 1/50 volume, and shaking culture is to thalline OD
600Be about at 0. 2 o'clock, adding final concentration is the m-methyl benzoic acid of 2mM, continues to be cultured to OD600 and is about 0.6.The method of the preparation of follow-up operation and KT2440 electricity transformed competence colibacillus cell and the conversion of DNA is identical.
3. PP_3948 gene knockout
The amplification of design primer PCR contains the kalamycin resistance gene of homologous fragment.R401：5'-GC?CGGCGCCGCCGGCCGCAATATC，（SEQ?ID?NO.?5）；R402：5'-CCGGTTCGCTT?GCTGTCCATACAGCGAGGTACGGATGCCAGT，（SEQ?ID?NO.?6）；R403：5'-CA?CTGGCATCCGTACCTCGCTGTATGGACAGCA?AGCGAACCGG，（SEQ?ID?NO.?7）；R404：5'-CTGCACCGCACGCGACAGCAGCATCAGAAGAACTCGTCA?AGA?AG，（SEQ?ID?NO.?8）；R405：5'-CTTCTTGACGAGTTCTTCTGATGCTGCTGTC?GCGTGCGGTGCAG，（SEQ?ID?NO.?9）；?R406：5'-GGGCCGGGTATGCGGCTGC?CATTG，（SEQ?ID?NO.?10）。R402 and R403 have the overlapping of 43 base pairs, and R404 and R405 have the overlapping of 44 base pairs, and all the form with reverse complemental appears.
With pseudomonas putida KT2440 genomic dna is template, and R401 and R402 are primer, and pcr amplification obtains the dna fragmentation of PP_3948 upstream region of gene 500bp; R405 and R406 are primer, and pcr amplification obtains the dna fragmentation of PP_3948 gene downstream 500bp.With the pKD4 plasmid that contains kalamycin resistance gene is template, and R403 and R404 are primer, and pcr amplification obtains the kalamycin resistance gene fragment of 0.9kb.Gel reclaims these three fragments respectively, and three fragments of each 20ng are template, and R401 and R406 are primer, obtains the dna fragmentation of the 1.9kb of three fragments fusions through overlapping-extension polymerase chain reaction (OE-PCR) amplification.
Transform the dna fragmentation of the 1.9kb of 2mg, under the kalamycin resistance screening, obtain the resistance transformant.Through three experiments, on average can obtain 210 transformants.Carry out not having or only have the appearance of one or two resistance transformant in the inductive control experiment not adding m-methyl benzoic acid, this show the m-methyl benzoic acid abduction delivering recombinase catalytic homologous recombination be the determinative that obtains recombinant bacterial strain.
The design primer verifies that with the method for bacterium colony PCR kalamycin resistance knocks in the genotype that becomes strain to the genome gained.R407：5'-GGCCCCAAGTACGGCTGCGGC，（SEQ?ID?NO.?11）；R408：5'-CCACGCGGGTACGCCACTTC，（SEQ?ID?NO.?12。R407 is positioned at R401 upper reaches 100bp, and R408 is positioned at R406 downstream 200p.10 resistance bacterium colonies of picking are template with its genome at random, and R407 and R408 are primer, and pcr amplification finds that used bacterium colony all obtains the amplified fragments of 2.2 kb, and are that template amplification obtains 2.25 kb fragments with the genome of former strain.2.2 it is in full accord with expection that kb and two segmental enzymes of 2.25 kb are cut the result.
Overlapping-extension the polymerase chain reaction (OE-PCR) of amplification homologous fragment and resistant gene and this fragment are used for pseudomonas putida KT2440 gene knockout synoptic diagram and see Fig. 2.The experimental result picture of PP_3948 gene knockout is seen Fig. 3.
Two of pickings become the amplified productions of strain at random, be cloned into pGEM-T easy after, order-checking finds that sequence is in full accord with expection.In the proof pseudomonas putida KT2440 genome in the PP_3948 gene fragment of 1.0kb knocked out.
Elimination from recombinant bacterial strain
SacB genes encoding 6-fructosyl transferase among the pLS512; This enzyme catalysis sucrose is the Polylevulosan to the toxic effect of pseudomonas; The bacterial strain that contains pLS512 can not be grown containing on the substratum of sucrose, therefore under the negative screening effect of sucrose, can obtain the bacterial strain of pLS512 elimination.
The recombinant bacterial strain that will contain pLS512 lines on the LB solid plate that contains 10% sucrose, and 30
oThe C overnight cultures, picking list bacterium colony is cultured to logarithmic phase to the LB liquid nutrient medium, with 1x10
-6Dilution back coating LB solid plate; 30 single bacterium colonies of picking are dull and stereotyped dull and stereotyped with the resistance LB that contains tsiklomitsin to nonreactive LB at random; The all bacterium colonies of incubated overnight discovery all can only be grown on nonreactive LB flat board; And can not grow on the LB flat board of tetracyclin resistance containing, these sensitive tetracycline property bacterial strains are the bacterial strain that pLS512 eliminates.
Segmental the knocking out of embodiment 3. pseudomonas putida KT2440 genome PP_1384 to PP_1388 7.3kb
Preparation and the DNA conversion of electric transformed competence colibacillus cell of inducing the pseudomonas putida KT2440/pLS512 that recombinase expresses is with embodiment 2.
The amplification of design primer PCR contains the kalamycin resistance gene of homologous fragment.KSD1：5'-?GTCGACGA?AGTTGCGGTTGATG，（SEQ?ID?NO.13）；KSD2：5'-CCGGTTCGCTTGCTGTC?CATATGATCGGCCTTGTTGCAAAAGC，（SEQ?ID?NO.14）；?KSD3：5'-GCTTTT?GCAACAAGGCCGATCATATGGACAGCAAGCGAACCGG，（SEQ?ID?NO.15）；KSD4：5'-?GAC?AAAACAAGGTATTCCCGTGTCAGAAGAACTCGTCAAGAA?G，（SEQ?ID?NO.16）；KSD5：5'-CTTCTTGACGAGTTCTTCTGACACGGGAATA?CCTTGTTTTGTC，（SEQ?ID?NO.17）；?KSD6：5'-GCGTGCCGACATTGGGTCG?AAC，（SEQ?ID?NO.18）。The overlapping of 43 base pairs all arranged between KSD2 and the KSD3 and between KSD4 and the KSD5, and all appear with the form of reverse complemental.
With pseudomonas putida KT2440 genomic dna is template, and KSD1 and KSD2 are primer, and pcr amplification obtains the dna fragmentation of PP_1384 upstream region of gene 500bp; KSD5 and KSD6 are primer, and pcr amplification gets the dna fragmentation of PP_1388 gene downstream 500bp.With the pKD4 plasmid that contains kalamycin resistance gene is template, and KSD3 and KSD4 are primer, and pcr amplification obtains the kalamycin resistance gene fragment of 0.9kb.Gel reclaims these three fragments respectively, is template with these three fragments that are respectively 20ng, and KSD1 and KSD6 are primer, obtains the dna fragmentation of the 1.9kb of three fragments fusions through overlapping-extension polymerase chain reaction (OE-PCR) amplification.
Transform the dna fragmentation of 2mg, under the kalamycin resistance screening, obtain the resistance transformant.Through three experiments, on average can obtain 156 transformants.Carry out in the inductive control experiment not adding m-methyl benzoic acid; There is not or only has the appearance of one or two resistance transformant; Identical with embodiment 2, this shown the m-methyl benzoic acid abduction delivering recombinase catalytic homologous recombination be the determinative that obtains recombinant bacterial strain.The design primer verifies that with the method for bacterium colony PCR kalamycin resistance knocks in the genotype that becomes strain to the genome gained.KSD7：5'-?TGAAACCGGAACGGGCATCGAG，（SEQ?ID?NO.?19）；KSD8：?5'-?AGGGTGATCAGAGCGAAGTCC，（SEQ?ID?NO.?20）。KSD7 is positioned at KSD1 upper reaches 100bp, and KSD8 is positioned at KSD6 downstream 100bp.
10 resistance bacterium colonies of picking are template with its genome at random, and KSD7 and KSD8 are primer, and pcr amplification finds that used bacterium colony all obtains the amplified fragments of 2.1 kb, and are that template can not amplify product with the genome of former strain.2.1 it is in full accord with expection that the kb enzyme is cut the result.The experimental result picture that the 7.3kb fragment knocks out between the PP_1384 to PP_1388 is seen Fig. 4.
Two of pickings become the amplified productions of strain at random, be cloned into pGEM-T easy after, order-checking finds that sequence is in full accord with expection.7.3kb fragment in the proof pseudomonas putida KT2440 genome between the PP_1384 to PP_1388 is knocked out completely.
The elimination of pLS512 from recombinant bacterial strain is with embodiment 2.
Segmental the knocking out of embodiment 4. pseudomonas putida KT2440 genome PP_2064 to PP_2069 9.3kb
Preparation and the DNA conversion of electric transformed competence colibacillus cell of inducing the pseudomonas putida KT2440/pLS512 that recombinase expresses is with embodiment 2.
The amplification of design primer PCR contains the kalamycin resistance gene of homologous fragment.KAE1：5'-?TGTGTCTG?CGCTTATGAATCG，（SEQ?ID?NO.?21）；KAE2：5'-CCGGTTCGCTTGCTGTCC?ATACATGCACAGCTCCGATCACAGG，（SEQ?ID?NO.?22）；KAE3：5'-?CCTGT?GATCGGAGCTGTGCATGTATGGACAGCAAGCGAACCGG，（SEQ?ID?NO.?23）；KAE4：5'-?CGACCTTTGAGCGACAATCGTGTCAGAAGAACTCGTCAAG?AAG，（SEQ?ID?NO.?24）；KAE5：5'-?CTTCTTGACGAGTTCTTCTGACACGATTGTCG?CTCAAAGGTCG，（SEQ?ID?NO.?25）；KAE6：5'-TGATCCTGTACGAACTCGCC?G，（SEQ?ID?NO.?26）。Between KAE2 and the KSD3 and between KAE 4 and the KAE 5 the overlapping of 43 base pairs arranged all, and all appear with the form of reverse complemental.
With pseudomonas putida KT2440 genomic dna is template, and KAE1 and KAE2 are primer, and pcr amplification obtains the dna fragmentation of PP_1384 upstream region of gene 500bp; KAE5 and KAE 6 are primer, and pcr amplification gets the dna fragmentation of PP_1388 gene downstream 500bp.With the pKD4 plasmid that contains kalamycin resistance gene is template, and KAE3 and KAE4 are primer, and pcr amplification obtains the kalamycin resistance gene of 0.9kb.Gel reclaims these three fragments respectively, is template with these three fragments that are respectively 20ng, and KAE1 and KAE6 are primer, obtains the dna fragmentation of the 1.9kb of three fragments fusions through overlapping-extension polymerase chain reaction (OE-PCR) amplification.
Transform the dna fragmentation of 2mg, under the kalamycin resistance screening, obtain the resistance transformant.Through three experiments, on average can obtain 92 transformants.Carry out in the inductive control experiment not adding m-methyl benzoic acid; There is not or only has the appearance of one or two resistance transformant; Identical with embodiment 2 with embodiment 3, this shown the m-methyl benzoic acid abduction delivering recombinase catalytic homologous recombination be the determinative that obtains recombinant bacterial strain.
The design primer verifies that with the method for bacterium colony PCR kalamycin resistance knocks in the genotype that becomes strain to the genome gained.KAE7：5'-GATTGGGTCGTTCAGGCAGTAG，（SEQ?ID?NO.?27）；KAE8：5'-TGCTGCGCGAACTGATCCTGG，（SEQ?ID?NO.?28）。KAE7 is positioned at KAE 1 upper reaches 100bp, and KAE8 is positioned at KAE 6 downstream 100bp.
10 resistance bacterium colonies of picking are template with its genome at random, and KAE 7 and KAE 8 be primer, and the used bacterium colony of pcr amplification discovery all obtains the amplified fragments of 2.1 kb, and are that template can not amplify product with the genome of former strain.2.1 it is in full accord with expection that the kb enzyme is cut the result.The experimental result picture that 9.3kb fragment between the PP_2064 to PP_2069 knocks out is seen Fig. 4.
Two of pickings become the amplified productions of strain at random, be cloned into pGEM-T easy after, order-checking finds that sequence is in full accord with expection.9.3kb fragment in the proof pseudomonas putida KT2440 genome between the PP_2064 to PP_2069 is knocked out completely.
The elimination of pLS512 from recombinant bacterial strain is with embodiment 2.
Claims (4)
1. pseudomonas putida KT2440 gene knockout method efficiently is characterized in that, may further comprise the steps:
(1) obtains homologous gene, centre that the left and right sides is respectively each 500 base pair of target gene upstream and downstream to be knocked out through the overlapping-means amplification of extending the polymerase chain reaction and be the dna fragmentation of kalamycin resistance gene;
The plasmid pLS512 that (2) will contain recombinase gene is converted among the pseudomonas putida KT2440, processes electric transformed competence colibacillus cell; Described plasmid pLS512 is the exo that comes from the lambda phage with being; After bet and gam gene increase from the lambda phage DNA; Be cloned into conventional height copy escherichia coli cloning carrier pBluescript KS (-); After treating that order-checking is correct; The enzyme switchback is received from the recombinant plasmid, but subsequently on the sacB gene of coding 6-fructosyl transferase is cloned into the carrier pJB866 that can in pseudomonas putida KT2440, be the self-replicating that free form exists, thereby obtain recombinase expression vector pLS512;
(3) the dna fragmentation electricity that obtains of step (1) is converted into the final concentration to the 2mM m-methyl benzoic acid induces in the pseudomonas putida KT2440 electricity transformed competence colibacillus cell of the step (2) that recombinase expresses; Through the homologous recombination between the homologous fragment of recombinase-mediated, kalamycin resistance gene has replaced target gene and has directly obtained the mutant strain that target gene knocks out.
2. the method for claim 1 is characterized in that: the mutant strain that the target gene that step (3) is obtained knocks out is that plasmid pLS512 remaining in the mutant strain is removed in 10% the negative screening effect of sucrose through concentration.
3. the method for claim 1; It is characterized in that; Recombinase gene is the exo that comes from the lambda phage; Bet and gam gene, recombinase gene are to be cloned in to receive under the m-methyl benzoic acid inductive promotor, and the plasmid pLS512 that contains recombinase gene is free on the genome of pseudomonas putida KT2440.
4. the method for claim 1; It is characterized in that; The sacB gene that contains encoding sucrose 6-fructose-transferring enzyme in the recombinase expression vector, the sacB gene is negative selection markers, is that 10% sucrose is removed the recombinase expression vector that contains the sacB gene through in substratum, adding concentration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105752020A CN102071185B (en) | 2010-12-06 | 2010-12-06 | Efficient gene knockout method of pseudomonas putida KT2440 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105752020A CN102071185B (en) | 2010-12-06 | 2010-12-06 | Efficient gene knockout method of pseudomonas putida KT2440 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102071185A CN102071185A (en) | 2011-05-25 |
| CN102071185B true CN102071185B (en) | 2012-07-04 |
Family
ID=44029944
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105752020A Expired - Fee Related CN102071185B (en) | 2010-12-06 | 2010-12-06 | Efficient gene knockout method of pseudomonas putida KT2440 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102071185B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102703424B (en) * | 2012-06-19 | 2015-12-16 | 南京师范大学 | A kind of method of genome of E.coli point mutation of recombined engineering mediation |
| CN104046647A (en) * | 2014-06-26 | 2014-09-17 | 南京师范大学 | Re-engineering mediated sinorhizobium meliloti Rm1021 gene knockout method |
| CN104561077A (en) * | 2014-12-22 | 2015-04-29 | 南京师范大学 | Recombineering-mediated gene knockout method of corynebacterium glutamicum ATCC 13032 |
| CN106480082A (en) * | 2016-11-09 | 2017-03-08 | 天津大学 | A kind of gene knockout method for pseudomonas putida NBRC 14164 |
| CN109913491B (en) * | 2018-11-11 | 2022-07-26 | 江苏省农业科学院 | SacB-mediated pseudomonas chlororaphis genetic manipulation method |
| CN109439684B (en) * | 2018-12-27 | 2023-09-01 | 尚科生物医药（上海）有限公司 | Method for improving evolution efficiency of exogenous gene in eukaryotic cells |
| CN112143689B (en) * | 2019-06-28 | 2023-01-03 | 中国科学院微生物研究所 | Construction of recombinant pseudomonas putida strain and application thereof in conversion of threonine to synthesize propionic acid |
| CN114032248B (en) * | 2021-11-02 | 2023-11-07 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Large-fragment knockout plasmid for myxococcus xanthus and knockout method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002014495A2 (en) * | 2000-08-14 | 2002-02-21 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Enhanced homologous recombination mediated by lambda recombination proteins |
| CN101899413A (en) * | 2010-05-05 | 2010-12-01 | 南京大学 | Recombinant pseudomonas putida, and construction method and application thereof |
-
2010
- 2010-12-06 CN CN2010105752020A patent/CN102071185B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002014495A2 (en) * | 2000-08-14 | 2002-02-21 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Enhanced homologous recombination mediated by lambda recombination proteins |
| CN101899413A (en) * | 2010-05-05 | 2010-12-01 | 南京大学 | Recombinant pseudomonas putida, and construction method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Andreas Schafer等.small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19：selection of defined deletions in the chromosome of Corynebacterium glutamicum.《gene》.1994,第145卷 * |
| 沈文静等.恶臭假单胞菌DLL-E4对硝基苯酚降解途径关键基因pnpC的突变分析.《生态与农村环境学报》.2008,第24卷(第4期),第77-82页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102071185A (en) | 2011-05-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102071185B (en) | Efficient gene knockout method of pseudomonas putida KT2440 | |
| Højberg et al. | Oxygen-sensing reporter strain of Pseudomonas fluorescens for monitoring the distribution of low-oxygen habitats in soil | |
| Tremblay et al. | A c‐type cytochrome and a transcriptional regulator responsible for enhanced extracellular electron transfer in Geobacter sulfurreducens revealed by adaptive evolution | |
| Lee et al. | Sequence analysis of two cryptic plasmids from Bifidobacterium longum DJO10A and construction of a shuttle cloning vector | |
| Kulakov et al. | Web-type evolution of Rhodococcus gene clusters associated with utilization of naphthalene | |
| Yin et al. | Single-stranded DNA-binding protein and exogenous RecBCD inhibitors enhance phage-derived homologous recombination in Pseudomonas | |
| Labes et al. | Isolation and characterization of a strong promoter element from the Streptomyces ghanaensis phage I19 using the gentamicin resistance gene (aacC1) of Tn 1696 as reporter | |
| Torres et al. | A dual lethal system to enhance containment of recombinant micro-organisms | |
| Zhang et al. | Transcriptional activation of multiple operons involved in para-nitrophenol degradation by Pseudomonas sp. strain WBC-3 | |
| CN1678624B (en) | Benzoate- and anthranilate-inducible promoters | |
| Hsiao et al. | XCC2731, a GGDEF domain protein in Xanthomonas campestris, is involved in bacterial attachment and is positively regulated by Clp | |
| Petrova et al. | Genetic structure and biological properties of the first ancient multiresistance plasmid pKLH80 isolated from a permafrost bacterium | |
| Ryan et al. | Novel Tn 4371-ICE like element in Ralstonia pickettii and genome mining for comparative elements | |
| Feng et al. | The xrvA gene of Xanthomonas oryzae pv. oryzae, encoding an H-NS-like protein, regulates virulence in rice | |
| Reimmann | Inner-membrane transporters for the siderophores pyochelin in Pseudomonas aeruginosa and enantio-pyochelin in Pseudomonas fluorescens display different enantioselectivities | |
| Yanagiya et al. | Novel self-transmissible and broad-host-range plasmids exogenously captured from anaerobic granules or cow manure | |
| Nagao et al. | The gene transfer agent-like particle of the marine phototrophic bacterium Rhodovulum sulfidophilum | |
| Harvey et al. | Repetitive sequence variations in the promoter region of the adhesin-encoding gene sabA of Helicobacter pylori affect transcription | |
| Lacroix et al. | The mdoC gene of Escherichia coli encodes a membrane protein that is required for succinylation of osmoregulated periplasmic glucans | |
| Varivarn et al. | Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments | |
| Studer et al. | Chloromethane-induced genes define a third C1 utilization pathway in Methylobacterium chloromethanicum CM4 | |
| Hücker et al. | The novel anaerobiosis-responsive overlapping gene ano is overlapping antisense to the annotated gene ECs2385 of Escherichia coli O157: H7 Sakai | |
| Yang et al. | The H-NS protein represses transcription of the eltAB operon, which encodes heat-labile enterotoxin in enterotoxigenic Escherichia coli, by binding to regions downstream of the promoter | |
| Leang et al. | Regulation of two highly similar genes, omcB and omcC, in a 10 kb chromosomal duplication in Geobacter sulfurreducens | |
| Gößringer et al. | Analysis of RNase P protein (rnpA) expression in Bacillus subtilis utilizing strains with suppressible rnpA expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120704 Termination date: 20141206 |
|
| EXPY | Termination of patent right or utility model |