CN102041259A - GPR116 (G-protein coupled Receptor) gene, receptor protein coded by same and application of the GPR116 gene - Google Patents
GPR116 (G-protein coupled Receptor) gene, receptor protein coded by same and application of the GPR116 gene Download PDFInfo
- Publication number
- CN102041259A CN102041259A CN2009101970042A CN200910197004A CN102041259A CN 102041259 A CN102041259 A CN 102041259A CN 2009101970042 A CN2009101970042 A CN 2009101970042A CN 200910197004 A CN200910197004 A CN 200910197004A CN 102041259 A CN102041259 A CN 102041259A
- Authority
- CN
- China
- Prior art keywords
- gpr116
- sequence
- seq
- gene
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an isolated GPR116 (G-protein coupled Receptor) gene shown as SEQ ID NO.1, GPR116 receptor protein coded by the same and application of the GPR116 gene or the GPR116 receptor protein in preparing medicaments for treating or diagnosing breast cancer. The invention discloses an antisense gene of GPR116 or a small interfering siRNA sequence and application thereof in preparing medicaments for treating or diagnosing breast cancer. The invention also discloses a medical composition containing an effective quantity of GPR116 genes or GPR116 receptor protein or antisense genes or small interfering siRNA sequences.
Description
Technical field
The present invention relates to GPR116 (G protein-coupled receptor 116) the GPR116 gene of biological technical field and the receptor protein of coding thereof, particularly, the present invention relates to a kind of GPR116 gene relevant and the receptor protein of coding thereof with the generation development of mammary cancer, this expression carrier, with and application in the medicine of preparation treatment mammary cancer.
Background technology
Mammary cancer is one of modal malignant tumour of women, and its sickness rate accounts for 7%~10% of the various malignant tumours of whole body, becomes the significant threat of WomanHealth.Mammary cancer is systemic disease, and the patient with breast cancer treated failure and dead key point when the whole body transfer that causes was sent out in the lymphatic channel of tumour cell and blood road.Although it is not in the last few years the Physiologic Studies of mammary cancer had been obtained very big progress, also very clear for its pathogenesis and metastasis.Therefore find and breast cancer related new gene and expressed proteins thereof that no matter for the morbidity and the metastasis of further further investigation mammary cancer, the new target site that still obtains treatment mammary cancer thus all has very significant meaning.
Human epidermal growth factor receptor 2 (HER2) gene unconventionality amplification or to cross generation, development and the prognosis expressed with mammary cancer closely related has become the individual index that breast cancer relapse, patient are judged lifetime.And be successfully applied in the treatment of clinical mammary cancer, He Saiting (herceptin) is exactly to be the medicine of target exploitation with HER2, and it has curative effect preferably to HER2 male mammary cancer.Similar with HER2, GPR116 also is a kind of surface of cell membrane acceptor, and a kind of g protein coupled receptor (GPCR), g protein coupled receptor (GPCR) are important acceptors common on the cytolemma, have typical seven times and stride membrane structure, the important media that to be cell signal transmit in the export-oriented born of the same parents of born of the same parents.It is activator or the antagonist of GPCR that 1/3 small-molecule drug is arranged on world's pharmaceutical market at present; In current preceding 50 kinds of best-selling marketed drug, 20% belongs to G protein receptor related drugs; In calendar year 2001 preceding in the world 50 medicines that sales volume is the highest, there are 23 directly or indirectly by GPCR performance drug effect.G protein coupled receptor has been proved to be the important target spot of wide clinical application medicine, the medicine that acts on g protein coupled receptor all has the good curing effect to all kinds of diseases such as pain cognitive disorder, hypertension, stomach ulcer, rhinitis, asthma, further investigate the characteristic of this class target spot, can further develop better new drug.
The evaluation of imbalance gene helps more exactly and accurately to diagnose various tumours in the tumour, and seeks new treatment target.For the acceptor class diagnosis target molecule of finding that mammary gland is new, and develop new acceptor class medicine, the present invention screens in mammary cancer the member of GPCR Adhesion family, in the hope of finding with mammary cancer the relevant novel receptor of development takes place.GPCR Adhesion family is a member young in the GPCR extended familys, just is found after 2000, and up to the present the research of having delivered about this family gene is very limited.Because the member of this family has long extracellular fragment, and often possesses some structural domains relevant with cell adhesion, so effect may be played by this family of prediction in the cell adhesion process, with its called after Adhesion GPCR.The human GPR116 assignment of genes gene mapping is on chromosomal 6p12.3, and it has been encoded one and has contained 1346 amino acid whose cell-membrane receptor albumen.About human GPR116, up to the present there is not one piece of relevant research report, can be described as a complete brand-new very promising again field.The present invention has disclosed GPR116 in the GPCR Adhesion family to be had specific expressedly in mammary cancer, and its expression becomes positive correlation with the deterioration degree of mammary cancer, has the application of the reagent of the medicine of preparation treatment mammary cancer or diagnosing mammary cancer.
Summary of the invention
Technical problem solved by the invention is screening and clones GPR116 gene relevant with development with the mammary cancer generation in the GPCR Adhesion family and the receptor protein of encoding and expressing thereof, use it in preparation treatment or the Breast Cancer Prevention disease and carry out medicinal application, and be applied to prepare the diagnostic reagent of diagnosing mammary cancer, and pharmaceutical composition.
The invention provides a kind of GPR116 gene of separation and purification, the described GPR116 receptor protein of this genes encoding, and in human malignant's mammary cancer, cross and express.Described GPR116 gene has the polynucleotide sequence shown in the SEQ ID NO.1.Described polynucleotide sequence also has among the SEQ ID NO.1 nucleotide sequence from Nucleotide 290-4330 position; Perhaps have with SEQ IDNO.1 in show the sequence of at least 70% homology from the nucleotides sequence of Nucleotide 290-4330 position; Perhaps described polynucleotide sequence under the moderate stringent condition with SEQ ID NO.1 in from the nucleotide sequence hybridization of Nucleotide 290-4330 position.
" the isolating GPR116 gene " of indication of the present invention is meant the different polynucleotide of genome polynucleotide passage of its structure and naturally occurring polynucleotide or 3 above separate gene of naturally occurring leap.Term " isolating GPR116 gene " comprising: for example (a) has the DNA of the partial sequence of naturally occurring genomic dna molecule in its naturally occurring organism genome; (b) be incorporated among carrier or prokaryotic organism or the eukaryotic gene group DNA, thereby make the molecule and any naturally occurring carrier or the different polynucleotide of genomic dna that is produced; (c) independently molecule for example cDNA, genomic fragment, by the fragment or the restriction fragment of polymerase chain reaction (PCR) preparation: and (d) heterozygous genes, the part recombinant nucleotide sequence of the gene of the fusion polypeptide of promptly encoding.This definition is concrete, and what get rid of is to be present in difference (i) dna molecular, (ii) cells transfected or the (iii) polynucleotide of the dna molecular in the mixture of cell clone; For example, be present in the DNA library for example cDNA or genome dna library in these polynucleotide.
The invention provides a kind of GPR116 receptor protein of GPR116 genes encoding, described albumen has the aminoacid sequence shown in the SEQ ID NO.2.The present invention further provides coding GPR116 albumen or its function equivalence body, with the polynucleotide sequence hybridization shown in the SEQ ID NO.1 and have 15% at least, more preferably at least 25% complementary polynucleotide with it.
The present invention also provides a kind of carrier, and a kind of plasmid vector that is used for gene overexpression is cut the method for connection with classical molecular biology enzyme, and total length GPR116 gene is connected into the corresponding multiple clone site of carrier, makes this carrier comprise described GPR116 gene.This carrier is used in the dna sequence dna of keeping GPR116 of the present invention in the host cell.
The present invention also provides a kind of described expression vector transformed host cells, and this host cell comprises prokaryotic cell prokaryocyte, eukaryotic cell.Prokaryotic organism such as e. coli bl21, DH5a bacterial strain, the mouse source cell in eukaryote such as people source.
The method that is used for pcr amplification GPR116 full-length gene of the present invention is: classical molecular biology PCR clone gene method, see people such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989)
The primer that is used for pcr amplification GPR116 full-length gene of the present invention is:
Positive-sense strand: 5 ' GGGGTACCTGGACAGGCCAACCAACTC 3 '
Antisense strand: 5 ' CCCTCGAGTGAGTTGAGCAACGAAGAAG 3 '
The present invention also provides a kind of diagnostic reagent that is used to detect mammary cancer, and its effective constituent comprises the detection reagent that reacts with described GPR116 gene or GPR116 receptor protein.Preferably, diagnostic reagent of the present invention comprises the oligonucleotide with multi-nucleotide hybrid of the present invention, perhaps can be used as these compounds with the present invention protein bound antibody and come usefulness.Using the result of diagnostic reagent, is to identify by the standard clinical method or by the unconventionality expression level or the activity that detect GPR116.
The present invention also provides a kind of biochip that is used to diagnose and treat mammary cancer, contains the sequence of following (i)-(iv) or their continuous fragment on the carrier of described biochip: (i) encoding sequence shown in the SEQ ID NO:1; (ii) with SEQ ID NO:1 in 290-4330 position nucleotide sequence have the sequence of 70% homology at least; (iii) under the moderate stringent condition with SEQ IDNO:1 in the sequence of 290-4330 position Nucleotide hybridization; (iv) has sequence with aminoacid sequence at least 70% homology shown in the SEQ ID NO.2.
Biochip of the present invention with the nucleotide sequence design primer of the GPR116 gene that obtains, amplifies the part fragment of GPR116 gene or this gene of total length, as the sample of biochip point sample.
The present invention also provides described GPR116 gene or the application of GPR116 receptor protein in the medicine of preparation treatment or Breast Cancer Prevention.Medicinal application of the present invention can be undertaken by reducing GPR116 expression of gene or function, can reduce its overexpression and carry out.Dispenser can be whole body or partial.
The present invention also provides a kind of pharmaceutical composition, comprises the effective constituent with GPR116 gene or GPR116 receptor protein association reaction, and one or more pharmaceutically useful other carriers.The present invention also provides GPR116 polynucleotide or GPR116 receptor protein as the drug targets for the treatment of mammary cancer.
The present invention also provides and has been used for the treatment of or the pharmaceutical composition of Breast Cancer Prevention.This medicinal compositions can be a cancer therapy drug for example, can also be to comprise that screening by the present invention is used for the treatment of or prophylaxis of tumours shifts the medicinal compositions of the compound of selecting such as the method for the compound of Metastasis in Breast Cancer.
The screening of medicinal compositions of the present invention or compound obtains, be as target spot with GPR116, cells contacting with compound to be selected or composition and expression GPR116, if compound to be selected can be exciting or be suppressed the expression activity of GPR116, then can screen this compound to be selected or composition medicine as pointed drug effect.
The present invention also provides and comprises and the effective constituent of siRNA (siRNA) sequence association reaction and the pharmaceutical composition of one or more pharmaceutically useful other carriers.Described pharmaceutical composition comprises the special little interference siRNA sequence of significant quantity ground at GPR116, and described siRNA comprises SEQ ID NO:
3Nucleotide sequence, can preferably be elected to be the treatment or the target of Breast Cancer Prevention.SiRNA (siRNA) sequence that can specially reduce the GPR116 expression level effectively provided by the invention:
5’CCUUGUGUUCCAUAUCAUATT?3’(SEQ?ID?NO:3)。
The present invention also provides the special antisense polynucleotides that reduces the GPR116 expression level effectively, and sequence is as follows:
GTGATGCAGGTGAATATGTTTCAAGAGAACATATTCACCTGCATCAC(SEQ?ID?NO:4)
CACTACGTCCACTTATACAAAGTTCTCTTGTATAAGTGGACGTAGTG(SEQ?ID?NO:5)
Do not have the contrast hairpin structure antisense oligonucleotide of sequence homology with Mammals, sequence is as follows:
GTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAAC(SEQ?ID?NO:6)
CAAGAGGCTTGCACAGTGCAAAGTTCTCTTGCACTGTGCAAGCCTCTTG(SEQ?ID?NO:7)
Invention also is provided for making up the artificial synthetic oligonucleotide at the siRNA slow virus expression vector of GPR116, and sequence is as follows:
Positive-sense strand (SEQ ID NO:8)
TGTGATGCAGGTGAATATGTTTCAAGAGAACATATTCACCTGCATCACTTTTTTC
Antisense strand (SEQ ID NO:9)
ACACTACGTCCACTTATACAAAGTTCTCTTGTATAAGTGGACGTAGTGAAAAAAGAGCT
Be used to make up at not having the artificial synthetic oligonucleotide of the contrast siRNA slow virus expression vector of sequence homology with Mammals, sequence is as follows:
Positive-sense strand (SEQ ID NO:10)
TGTTCTCCGAACGTGTCACGT?TTCAAGAGA?ACGTGACACGTTCGGAGAACTTTTTTC
Antisense strand (SEQ ID NO:11)
ACAAGAGGCTTGCACAGTGCAAAGTTCTCTTGCACTGTGCAAGCCTCTTGAAAAAAGAGCT
Slow virus that above-mentioned lentiviral vectors and its pack out and the cell strain that is successfully infected by this effective slow virus are provided.The invention provides the polyclonal antibody at GPR116, this antibody can stop the expression of gene and the receptor protein thereof of GPR116, thereby suppresses its activity.
The GPR116 expression of gene also can suppress by several means known in the art, comprises the experimenter used suppressing or the nucleic acid of antagonism genetic expression.Antisense oligonucleotide, siRNA or the ribozyme that can destroy genetic expression can be used for the expression of suppressor gene.
Antisense oligonucleotide corresponding to GPR116 gene nucleic acid sequence can be used for reducing GPR116 expression of gene level.The present invention's antisense oligonucleotide can be by any polypeptide or the mRNA corresponding with it in conjunction with the GPR116 genes encoding, thereby the transcribing or translating of suppressor gene, promote the degraded of mRNA, and/or inhibition is reached the proteinic function of the final GPR116 of inhibition and is worked by the protein expression of genes encoding.By mixing with suitable base mateiral to the derivative non-activity, antisense oligonucleotide and derivative thereof can be made into external preparation, such as liniment or application, are used for the method for the present invention's treatment or prevention prostate cancer.
The nucleic acid that suppresses one or more gene products of overexpression gene also comprises siRNA (siRNA), and it comprises the sense strand nucleic acid of nucleotide sequence of coding GPR116 gene and the molectron of antisense strand nucleic acid.The standard technique of siRNA transfered cell be can be used for treatment and prevention among the present invention, comprise with DNA being that template is transcribed the method that obtains RNA.SiRNA is built into the single transcript that comprises from adopted sequence of having of target gene and complementary antisense sequences, as hairpin structure.Combining of GPR116 gene transcripts causes that the GPR116 protein output descends in this cell in siRNA and the target cell.The nucleic acid of one or more gene products of inhibition overexpression gene also comprises the ribozyme at overexpression gene (GPR116 gene).
The present invention finds that by 34 members with Mammals GPCR Adhesion family do expression level in the breast cancer cell line that six kinds of transfer abilities increase progressively successively detection the mRNA of GPR116 gene becomes positive correlation with the transfer ability of breast cancer cell line with protein expression level.Because very big different of cancerous cell line and the existence of real clinical pathology situation, so we have carried out the detection of clinical mammary cancer sample.By comparing the positive patient with breast cancers' of 24 routine nodus lymphoideus transferring rates primary carcinoma and paired nodus lymphoideus transferring rate cancerous tissue, and the expression of GPR116 in the mammary cancer sample of 75 routine different deterioration degrees and the normal breast sample, determine that further the GPR116 and the generation of mammary cancer develop closely related.Experimental result shows that GPR116 only expresses specifically in breast cancer cell, do not express and have in cancer beside organism or mammary gland normal cell, and its expression amount becomes positive correlation with the mammary cancer deterioration degree.
The human GPR116 assignment of genes gene mapping is on chromosomal 6p12.3, and it has been encoded one and has contained 1346 amino acid whose cell-membrane receptor albumen.For disclose the concrete effect that GPR116 plays in mammary cancer develops, one aspect of the present invention has been cloned the gene of coding GPR116, made up the host cell that contains this expression carrier and contain this expression vector, determined that on the other hand special target disturbs the siRNA of GPR116, make up antisense nucleoside acid vectors and the corresponding interference slow virus of GPR116, obtained to disturb the stable cell lines of slow virus infection.Find that this G protein-coupled receptor can influence the generation and the development of mammary cancer.
The present invention also provides diagnosis or has judged the method for breast cancer susceptibility (predisposition to breast cancer), comprises the expression level of measuring GPR116 in the breast cancer tissue's sample that is derived from the patient.The GPR116 expression level is compared the situation that rising takes place with mammary gland normal cell control level in tissue sample, then shows the risk that the experimenter also has mammary cancer or existence to suffer from breast cancer.
The present invention also provides the method for estimating and judge the mammary cancer deterioration degree, for the in good time individualized treatment of mammary cancer patient provides objective basis, comprises the expression level of measuring GPR116 in the breast cancer tissue's sample that is derived from the patient.The GPR116 expression level is compared with mammary gland normal cell control level in sample, and it is many more to exceed control level, and the expression deterioration degree is high more.
The present invention also provides the method for the therapeutic process of monitoring mammary cancer, this method comprises the step that the GPR116 level of the biological sample that is derived from the patient that will gather before GPR116 level and the treatment in the biological sample that be derived from the patient of treatment back collection compares, treatment back GPR116 expression level reduces, and shows that treatment effectively.Otherwise treatment back GPR116 expression level rises or does not change, and shows and fails to respond to any medical treatment.
The invention provides the method for the treatment of or preventing clinical mammary cancer.This method comprises the step of using the antisense composition to the experimenter.In the context of the present invention, the antisense composition can reduce the specified target expression of gene.Antisense compounds can be to contain and GPR116 sequence complementary Nucleotide, or slow virus.In addition, method of the present invention can comprise the step of using siRNA (siRNA) composition and slow virus to the experimenter, and in the context of the present invention, siRNA composition and slow virus can both reduce the expression of GPR116.The present invention has also confirmed siRNA and the slow virus retarding effect to GPR116.For example, by the application's embodiment, confirmed the migration that siRNA and slow virus at GPR116 can suppress breast cancer cell clearly.Therefore, GPR116 is the preferred therapeutic target of mammary cancer in the present invention.
The present invention also provides screening to be used for the treatment of or the method for Breast Cancer Prevention compound, this method comprises the cells contacting that makes test compounds and imported following carrier, described carrier comprises the transcription regulatory region of GPR116 in the reporter gene upstream, and selects to suppress the test compounds of GPR116 expression level.
The invention has the advantages that this gene only has positive signal in mammary cancer, so can be used as the special sign of mammary cancer, detected result is clear and definite, be easy to judge; GPR116 is used for the target molecule of breast cancer treatment drug screening as a member of cell-membrane receptor, has the signal path upstream, the accessible advantage in site.Many cancer therapy drugs are not only poisonous to cancer cells, poisonous equally to normal grown cell, yet, based on the fact of GPR116 specifically expressing in mammary cancer, the medicine that suppresses the GPR116 expression may just can not have undesirable action to normal cell, thereby can be advantageously used in treatment or Breast Cancer Prevention.
In conjunction with the accompanying drawings, description of drawings and embodiment and claims of investing this specification sheets, other purposes of the present invention, characteristics and advantage can more clearly display.
Description of drawings
Fig. 1: the GPR116 express spectra in six kinds of breast cancer cell lines
Fig. 1 (a): the expression of the GPR116 mRNA of RT-PCR qualitative test in six kinds of breast cancer cell lines, express as internal contrast with GAPDH.
Fig. 1 (b): the expression of the GPR116mRNA of Real-time PCR quantitative assay in six kinds of breast cancer cell lines, express as internal contrast with GAPDH.
Fig. 1 (c): the Western engram analysis is measured the expression of GPR116 albumen in six kinds of breast cancer cell lines, expresses as internal contrast with β-actin.
Fig. 2: the GPR116 immunohistochemical methods result of BR721 organization chip.
Fig. 2 (a): the mammary cancer and the cancer side of coupling and the immunohistochemical methods figure of the middle GPR116 of healthy tissues (row) that are three different mammary cancer patients (OK).
Fig. 2 (b): the expression intensity of GPR116 is quantized marking, be divided into 3,2,1,0.8,0.5,0.3,0 seven grades.According to the information that marking result and BR721 organization chip provide, count the expression table of GPR116 in the other and healthy tissues of the cancer of 24 routine clinical patient mammary cancer and coupling thereof.
Fig. 3: the GPR116 immunohistochemical methods result of BR8010 organization chip.
Fig. 3 (a): the immunohistochemical staining result who has shown the GPR116 of BR8010 organization chip.
Fig. 3 (b): software analysis GPR116 surface of cell membrane optical density(OD), according to optical density(OD) numerical division strength of signal.
Fig. 3 (c): the information that provides according to the BR8010 organization chip is in conjunction with experimental result, and the GPR116 of statistics is in normal galactophore tissue and optimum, pernicious and shifted the expression in the mammary cancer.
Fig. 3 (d): according to information and the experimental result that the BR8010 organization chip provides, the relation of the GPR116 of statistics and clinical each factor of mammary cancer.
Fig. 4: in low transfer ability breast cancer cell line MCF-7 (ER+), SK-BR-3 (ER-), cross expression GPR116, significantly strengthen its migration, invasive ability
Fig. 4 (a): PCR, Western Blot that the MCF-7 cell surely changes strain identify that the MCF-7/ empty carrier is represented the MCF-7 of stably express pcDNA3.1/myc-His C empty carrier, and MCF-7/GPR116 represents the MCF-7 of stably express GPR116 total length carrier.
Fig. 4 (b): the MCF-7 empty carrier surely changes cell and MCF-7 to be crossed expression GPR116 cell and is respectively applied for migration and invasion and attack experiment, surely changes cell with empty carrier and compares, and the MCF-7 cell that has surely changeed GPR116 has obtained significant reinforcement in migration and invasive ability.
Fig. 4 (c): the PCR that the SK-BR-3 cell surely changes strain identifies that the SK3/ empty carrier is represented the SK-BR-3 of stably express pcDNA3.1/myc-HisC empty carrier, and SK3/GPR116 represents the SK-BR-3 of stably express GPR116 total length carrier.
Fig. 4 (d): the SK-BR-3 empty carrier surely changes cell and SK-BR-3 to be crossed expression GPR116 cell and is respectively applied for migration and invasion and attack experiment, surely changes cell with empty carrier and compares, and the SK-BR-3 cell that has surely changeed GPR116 has obtained significant reinforcement in migration and invasive ability.
Fig. 5: after in high transfer ability breast cancer cell line MDA-MB-231 (ER-), disturbing downward modulation GPR116, significantly reduced its migration, invasive ability.
Fig. 5 (a): the siRNA transient transfection is after 24 hours, RT-PCR detects the effect of siRNA, than not having the contrast siRNA (siNC) of sequence homology with Mammals, this siRNA (siGPR116) has effectively reduced endogenic GPR116 expression level in the MDA-MB-231 clone.
Fig. 5 (b): the siRNA transient transfection is after 48 hours, and the MDA-MB-231 cell of siNC and siGPR116 transfection is respectively applied for migration and invasion and attack experiment.Compare with the MDA-MB-231 of transfection siNC, the MDA-MB-231 cell of siGPR116 still all has significant decline on the invasive ability in migration.
Fig. 5 (c): after having the slow virus infection MDA-MB-231 that the plentilox3.7 carrier package of antisense polynucleotides sequence goes out, detect the interference effect of GPR116 respectively with PCR and Western Blot, by picture as seen, special specific shRNA compares with the no target of contrast, GPR116shRNA1 has good interference effect, and the GPR116shRNA2 interference effect is relatively poor.
Fig. 5 (d): do migration and invasion and attack experiment respectively with the breast cancer cell that these three kinds of antisense polynucleotides are handled, as seen, MDA-MB-231 migration and invasive ability that the best GPR116shRNA1 of interference effect infects obviously descend, and significantly are lower than the MDA-MB-231 that contrast shRNA and GPR116shRNA2 infect.Mammary cancer MDA-MB-231 itself is a migration and the very high clone of invasive ability, and the GPR116 that is reduced in high expression level among the MDA-MB-231 can significantly reduce its migration and invasive ability.
Fig. 6: in matrigel3D cultivates, cross the MCF-7 cell comparison of expressing GPR116 and shine the ability that the MCF-7 cell has stronger growth and shifts to adjacent tissue.
Fig. 7: the mouse lung tissue slice, further illustrate the expression level that in the malignant galactophore cancer cells, reduces GPR116 and can stop the lung of malignant breast carcinomas to shift, reduced its grade malignancy.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Except as otherwise noted, the whole technical terms that use in this specification sheets and the implication of the scientific words all general implication of understanding of technician with the technical field of the invention are identical.But, be as the criterion with this specification sheets that comprises definition if any conflict.
Embodiment 1
The expression of GPR116 in the different transfer ability breast cancer cell lines
In order to understand the expression of GPR116 in the breast cancer cell line of different transfer abilities, select MDA-MB-231, MDA-MB-435, MDA-MB-468, MCF-7, these six kinds of breast cancer cell lines that transfer ability successively decreases from high to low of SK-BR-3, MDA-MB-453, utilize RT-PCR, Real-time round pcr and Western Blot analytical technology qualitative and quantitative analysis GPR116mRNA and albumen expression therein respectively, with the expression of GAPDH and β-actin respectively as the internal contrast of mRNA level and protein level.Experimental result shows no matter to be mRNA level or protein level, the abnormal expression height of GPR116 in the breast cancer cell line that height shifts, and weak or do not have an expression in optimum breast cancer cell.
RT-PCR (qualitative detection mRNA level)
RNA utilizes Trizol reagent (Invitrogen) to be prepared by extracting total RNA according to the scheme of manufacturers in experiment.Go out strand cDNA with PrimeScript TM RT test kit (TaKaRa company) reverse transcription from the total RNA of 1ug, method is provided to specifications.The cDNA that reverse transcription is obtained is equally divided into two parts, use confidential reference items GAPDH primer () and GPR116 gene-specific primer (upstream primer: 5 ' CCTACGGCTGAAGAATACAC, 3 ' downstream primer: 5 ' CGTCACGCTCTTGACAAATG 3 ') carry out pcr amplification respectively, reaction system is according to TaKaRaPrimeScript TM RT test kit specification sheets, reaction conditions is: 94 ℃ 4 minutes, 94 ℃ of circulating reactions 30 seconds, 55 ℃ 30 seconds, 72 ℃ 30 seconds, 30 circulations, 72 ℃ 8 minutes.The PCR product is electrophoresis in 1.5% Spain's sepharose.Experimental result is seen Fig. 1 (a).Real-time PCR (detection by quantitative mRNA level)
With SYBR Premix Ex Taq (the Prefect Real Time) test kit of TAKARA company, reaction system is to specifications done pipe, three multiple holes of all parallel repetition of each sample, reaction conditions: 94 ℃ 10 seconds, 94 ℃ of circulating reactions 30 seconds, 55 ℃ 30 seconds, 72 ℃ 30 seconds, 40 circulations.Used real-time PCR instrument is Mx3005p Real-Time PCR CyclerSTATAGENE (Mx3005p).When fluorescent signal reaches setting threshold in the real-time quantitative PCR process the cycle number of process be the CT value, calculate the difference DELTA CT of the CT value of the CT value of each sample GPR116 and house-keeping gene GAPDH, 2
-Δ Δ CTBe in each sample GPR116 with respect to the expression amount of GAPDH in the same sample.Relative expression's level of GPR116 gene in like this can each breast cancer cell line of quantitative expression.Experimental result is seen Fig. 1 (b).
Western Blot (qualitative protein level)
Western Blot ultimate principle is antigen antibody reaction.The cell protein extract is transferred to (nitrocellulose filter is adopted in this experiment) on the solid support after polyacrylamide gel electrophoresis separates.With a special anti-reaction, resist with horseradish peroxidase (HRP) link coupled two again and hatch colour developing, can obtain the western blot figure of differential protein molecule.This method has detect specific antigenic characteristics from mixes antigen.
Cell is given a baby a bath on the third day after its birth time with PBS, with lysis buffer RIPA solution (50mM Tris-HCl, ph7.4,150mMNaCl, 1%NP40,0.25%Na-deoxycholate, 1mMPMSF now adds 1 when using: 100cocktail) lysing cell, 4 ℃ were mixed 15 minutes, and centrifugal 20 minutes of 4 ℃ of 12000rpm collect supernatant.Electrophoresis and immune response, flow process is as follows: A, glue (8% concentrates glue, 10% separation gel); B, 50ug protein sample add sample-loading buffer, boil last sample; C, electrophoresis concentrate glue 60V voltage, separation gel 100V voltage: D, commentaries on classics film, 100V, 1.5h; E, 5% skimmed milk, sealing 1h; F, an anti-reaction, are spent the night by 4 ℃; G, TBST wash film, and three times, each 100 minutes; H, two anti-reactions, lucifuge 1h; I, TBST wash film, and three times, each 10 minutes; J, colour developing, exposure.Experimental result is seen Fig. 1 (c).
Embodiment 2
Immunohistochemistry
Organization chip is provided by Shaanxi Chaoying Biotechnology Co., Ltd., and production code member is respectively BR721 and BR8010 (all from U.S. Biomax).Normal and cancer beside organism's combined chip of BR721 mammary cancer and coupling thereof, 24 examples/72 points and BR8010 case do not repeat, the normal and cancer beside organism of 24 routine mammary cancer and coupling thereof, every example is a bit.BR8010, the mammary gland fibroadenoma chip, 71 examples/80 points wherein contain the normal and cancer next door edge of 10 examples, 20 routine fibromas, 10 routine lobular carcinomas, 30 routine infitrating ductal carcinoma, 10 routine metastatic lymph nodes, every example is a bit.The BR721 chip results shows: GPR116 highly expresses in patient breast cancer tissue, and only is expressed in the cancer cells specifically, and GPR116 weak expression by corresponding cancer and in the healthy tissues, even do not have expression.As seen GPR116 has good indicative function for distinguishing mammary gland cancerous tumor cell and normal cell, and expression intensity is high and special in cancer cells, can be used as the molecular marker of clinical breast cancer diagnosis.The BR8010 chip results shows: GPR116 does not have expression or weak expression in normal galactophore tissue, and based on weak expression, strongly expressed is in the mammary cancer that highly worsens and shift in optimum mammary cancer.And the expression of GPR116 increases progressively in the mammary cancer of optimum, pernicious and transfer, presents the positive correlation with the mammary cancer deterioration degree.As seen GPR116 not only can distinguish breast cancer cell and normal cell, and its expression intensity can also be used for the evaluating breast cancer process, for the clinical treatment of mammary cancer provides guidance.
It is as follows that immunohistochemical methods detects step:
1. vertical the placement baked sheet, bakes 1 hour at 62 ℃ of constant temperature ovens.
2. put into dimethylbenzene after taking out successively 5 minutes, 100% ethanol 2 times 2 minutes, 95% ethanol 2 times 2 minutes, 70% ethanol 1 time 2 minutes, 50% ethanol 1 time 2 minutes, 1 * TBS 2 times 5 minutes.
3. organize preliminary treatment, carry out tissue repair with sodium citrate solution and repaired 20-35 minute for 100 ℃; Place room temperature, allow it reduce to 25-30 ℃; The PAP pen will organize circle to live; 3%H202 removed interior source catalase in 15 minutes in wet box; The washcoated section of 1 * TBS 3 times 5 minutes
4. the wet box of sealing block reagent is hatched washing in 30 minutes 3 times 5 minutes
5. spend the night in anti-(1: 100) 4 ℃.
6.1 * TBS 4 times 5 minutes; Blot with filter paper and to add Anti-Rabbit two anti-15 minutes; 1 * TBS 4 times 5 minutes; HRP (pink) covered sample 10 minutes; 1 * TBS washed 4 times 5 minutes; 150ul DAB colour developing 5 minutes; Tap water flushing 10 minutes; Haematoxylin redyeing 10 minutes.
Hydrochloride alcohol color separation in 1: 1, with the naked eye differentiate become redness (lighter) than purple with twice of distillation washing after, be placed on tap water under and washed about 10 minutes.Be successively placed on 50% ethanol 2 minutes, 75% ethanol 2 minutes, 85% ethanol 2 minutes, 95% ethanol 2 times 3 minutes, 100% ethanol 2 times 5 minutes.
7. dimethylbenzene is 2 times 5 minutes, adds resinene 1-2 after blotting and drips mounting.
8. Lycra is just being put microscope (Leica DM4000B) and is being taken pictures.The results are shown in Figure 2 and Fig. 3.
Embodiment 3
GPR116 total length vector construction and the steady acquisition of changeing cell strain
GPR116 total length PCR clone is connected into the corresponding site of pcDNA3.1/myc-His C carrier from the cDNA of breast cancer cell line MDA-MB-231 with Kpn I and Xho I restriction enzyme site, confirms that through order-checking fragment is connected into success and correct.Used PCR primer is as follows:
Positive-sense strand: 5 ' GGGGTACCTGGACAGGCCAACCAACTC 3 '
Antisense strand: 5 ' CCCTCGAGTGAGTTGAGCAACGAAGAAG 3 '
Above-mentioned total length carrier and pcDNA3.1/myc-His C empty carrier are each separately transfected in the MCF-7 cell with Lipofectamine 2000 Transfection Reagent (invitrogen), transfection method is according to the reagent specification sheets, add the MCF-7 perfect medium that contains G418700ug/mL every other day, a large amount of necrocytosiss after three to five days, changed liquid once in per two days, mono-clonal forms after 20 days, choose mono-clonal and go into 24 orifice plates, the mono-clonal in every hole, this moment substratum in the G418 density loss to 400ug/mL, behind enlarged culturing to 6 orifice plate, do the expression that PCR and Western Blot detect each monoclonal cell strain GPR116 respectively, compare with the strain of transfection empty carrier monoclonal cell.Finally pick out the MCF-7 cell strain of real high expression level GPR116.Empty carrier and cross to express the steady cell strain that changes and all go down to posterity with the perfect medium that contains G418 400ug/mL is stable the results are shown in Figure 4 (a), compares with the empty carrier cell, and the expression level of crossing the steady commentaries on classics cell GPR116 of expression is significantly improved, and illustrates and expresses successfully.SK-BR-3 crosses the same MCF-7 of steady commentaries on classics cell preparation method that expresses GPR116, and screening G418 concentration is 500ug/mL, and keeping G418 concentration is 200ug/mL.Experimental result is seen Fig. 4 (c), compares with carrier cell, and the expression level of crossing the steady commentaries on classics cell GPR116 that expresses also is significantly improved, and illustrates also to cross to have expressed successfully.
The 3D tumor cell culture of embodiment 4Matrigel
Three-dimensional cell is cultivated and extensively have been applied to oncology studies, has brought into play irreplaceable effect at the aspects such as simulation of the vascularization of the mechanism of aggressive, transfer and the both central necrotic of the experimental treatment of tumour, tumour, tumour and nutrition supply, gene expression in vivo.People observe, and tumour cell not only can form individual layer on common culture dish, can also leave basal surface by the transmission of intercellular information, and become three-dimensional tissue to spatial development.Therefore, the oncologist has set up one specially and has overlapped the dimensional culture technology of circling round, and there not being blood vessel to provide under the situation of nutrition, can at utmost produce how many cell aggregations and don't the phenomenon that necroses with research.In addition, the ability of utilizing dimensional culture can also test tumor growth effectively and shift to adjacent tissue.
Concrete experimental technique is as follows:
1.Matri-gel (BD) spend the night to thawing in 4 ℃ on ice, experiment with six orifice plates also be positioned over 4 ℃ eve and spend the night.
2. second day, take out the every hole of six orifice plates of precooling and spread Matri-gel 120ul, place 37 ℃ of 15~30min that Matri-gel is solidified.
3. peptic cell, counting, every hole connects cell 10,000/250ul evenly is layered on cell on the Matri-gel, treat that cell is affixed on Matri-gel after, add the perfect medium that 250ul contains 10%Matri-gel.If when needing TGF-beta to cultivate, the concentration that makes TGF-beta in the substratum of upper strata is 10ng/ml.Put back in 37 ℃ of constant incubators and cultivate.
4. change liquid in per approximately two days, and behind the cell cultures 3-4d, the cell mass of 3D clonal growth occurred.Take pictures.
No matter be as can be seen have or the situation that no TGF-beta cytokine stimulates under, cross the MCF-7 cell of expressing GPR116 and compare according to the MCF-7 cell and all have more little aggregate to occur.Illustrate that GPR116 makes benign MCF-7 breast cancer cell not have blood vessel to provide under the situation of nutrition, produce the more little aggregate and don't the phenomenon that necroses, and have the ability that to attack extension of stronger extracellular matrix towards periphery.Prompting GPR116 can be so that the ability that breast tumor has stronger growth and shifts to adjacent tissue.
GPR116 total length carrier transforms prokaryotic cell prokaryocyte
Here used prokaryotic cell prokaryocyte is intestinal bacteria, comprises DH5 α, BL21 coli strain.
With the competence intestinal bacteria that prepare from-80 ℃ of taking-ups, be placed on ice and thaw.
2. get the soft mixing of competence intestinal bacteria that 1-2uLGPR116 total length vector plasmid and 30-50uL thaw, be placed on 30 minutes on ice.
3. mixture is placed in 42 ℃ of water-baths water-bath 1 minute, and put on ice 2 minutes immediately.
4. add the LB substratum that the nonresistant temperature of 600uL was bathed, 37 ℃, shook bacterium 40-60 minute.
5. take out 100-200uL bacterium liquid and be uniformly coated on the prior warm good LB flat board, be inverted in 37 ℃ of constant temperature cultivation chests and spend the night.
Embodiment 6
Cell migration invasion and attack experiment
The cell invasion experiment
The Matrigel (BD) that thaws under 4 ℃ of conditions spends the night, blank substratum is pressed 1: 10 dilution proportion Matrigel, the even tiling in bottom, chamber Matrigel 100 μ l on each Transwell (Millipore) cell, and place 37 ℃ of placements Matrigel to be solidified in 2 hours, use 37 ℃ of blank substratum dipping bath aquation cell films 30 minutes then.0.25% trysinization is in the cell of exponential growth phase, suspends and counting with blank substratum, inserts 1 * 10
5(MDA-MB-231) 1.5 * 10
5(MCF-7, SK-BR-3) cell is established 3 parallel holes for every group, and adds indoor adding 600 μ l perfect mediums under the blank substratum 200 μ L..37 ℃ cultivate 16 hours (MDA-MB-231) 24 hours (MCF-7, SK-BR-3) after, take out, chamber liquid in the exhaustion, to go up the cell of chamber wipes with cotton swab, 4 percent precooling Paraformaldehyde 96s are fixed 10 minutes, brazilwood extract dyeing 30 minutes, the cell numeration is carried out in 15 visuals field of (200 *) picked at random under the opticmicroscope, calculates the mean value in each visual field. and above-mentioned experiment repeats 3 times.
The cell migration experiment
Adopt Transwell to wear film exercise testing method, detect the transfer ability of cell, does not spread the film concrete grammar chamber on the Transwell cell, and all the other are all identical with the invasion and attack experiment.
The transient transfection of GPR116siRNA
In transfection the day before yesterday with the MDA-MB-231 cell inoculation in 6 orifice plates, inoculum density longly was advisable to degree of converging about 50% with second day.Second day with Trans-EZ siRNA transfection reagent (SunBio) transfection reagent transfection siRNA, notices that solution, rifle head, operating environment that all transfections are used all will note not having RNase to pollute transfection method reference reagent specification sheets.After transfection, change liquid (perfect medium) in 4-8 hour, received sample in 24 hours and be used for PCR and detect interference effect, see Fig. 5 (a), show the descended expression of GPR116 of successful interference.After 48 hours, peptic cell is used to do function related experiment (migration and invasion and attack experiment), the results are shown in Figure 5 (b), has reduced the later MDA-MB-231 of GPR116 and has all significantly reduced on migration and invasive ability.
Embodiment 8
GPR116 antisense polynucleotides lentiviral vectors makes up and slow virus packs, infects
1.GPR116 antisense polynucleotides vector construction
Be used to make up artificial sequence synthesized oligonucleotide at the siRNA expression vector of GPR116
Positive-sense strand TGTGATGCAGGTGAATATGTTTCAAGAGAACATATTCACCTGCATCACTTTTTTC
Antisense strand ACACTACGTCCACTTATACAAAGTTCTCTTGTATAAGTGGACGTAGTGAAAAAAGA GCT
Be used to make up at not having the artificial sequence synthesized oligonucleotide of the contrast siRNA expression vector of sequence homology with Mammals
Positive-sense strand TGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAACTTTTTT C
Antisense strand ACAAGAGGCTTGCACAGTGCAAAGTTCTCTTGCACTGTGCAAGCCTCTTGAAAAAA GAGCT
The vector construction step is as follows:
(1). with strand with aseptic water-soluble to 3mg/mL
(2). two strands of paired are respectively got 1uL and are joined (100mM NaCl and 50mM HEPESpH 7.4) in the 48uL annealing buffer mutually.
(3). with mixture by the annealing of following program: 90 ℃ 4 minutes, 70 ℃ 10 minutes, 37 ℃ 20 minutes, slowly be cooled to 10 ℃ at last.
(4) the .pletilox3.7 empty carrier uses Xho I and Hpa I double digestion after 3 hours, and 1% Spain's agarose runs glue, reclaims test kit (day root) with the DNA rubber tapping, taps rubber and reclaims, and step is according to the test kit specification sheets.
(5). linked system is as follows: the 2uL annealing mixture, 1uL 10 * T4DNA connects damping fluid, and 1 μ l enzyme is cut carrier (concentration is between 0.2 μ g/ μ l-0.5 μ g/ μ l), 5 μ l sterilized waters, 1 μ l T4DNA ligase enzyme, totally 10 μ l, 16 ℃ of connections are spent the night.
(6). be transformed in the DH5 α competence intestinal bacteria coated plate (ammonia benzyl resistance LB flat board), 37 ℃ of overnight incubation.Choose mono-clonal, shake bacterium, plasmid is taken out for a short time, and order-checking is identified.
2. slow virus packing and target cell infect
(1) with three pUC pUC transfection 293FT cell packaging virus, three plasmids are respectively PSPAX2, PMD2G, plentilox3.7 according to 2: 1: 2 ratio cotransfection.
(2) meet 293FT the day before yesterday and go into 10 centimetres of culture dish, density was advisable to 50%-60% with second day.
(3) next day, calcium phosphate method transfection three plasmids are gone into 293FT
(4) change liquid after 4-6 hour, add 6 to 7 milliliters of perfect mediums, continue to put into incubator and cultivate.
(5) after 36-48 hour, draw supernatant, 4000rpm, 4 ℃ are centrifugal 5 minutes.
(6) draw supernatant, filter with the 0.22uM filter tip
(7) liquid is added in the target cell of fishplate bar the day before yesterday, the cell density below 70% is advisable.
Observe efficiency of infection after (8) 48 hours.
Slow virus infection disturbs the effect of GPR116 to see Fig. 5 (c), compares with contrast (not reducing the GPR116 level) cell, successfully disturbs the MDA-MB-231 cell that has reduced GPR116 to show lower migration and invasive ability.
Embodiment 9
The GPR116 gene is used to prepare biochip
With the nucleotide sequence design primer of the GPR116 gene that obtains, amplify the part fragment of GPR116 gene or this gene of total length, as the sample of biochip point sample.
With the BioRobotics of Britain put automatically the film instrument with sample spot on 8 * 12cm nylon membrane, 4 points of each specimens point, every DNA amount is about 10ng.Positive control is the people β-actin gene of 4 point samples of repetition, and negative control is the phage DNA of 4 point samples of repetition.
The chip that contains the GPR116 gene can be used as the diagnosis marker of mammary cancer and can be used for drug screening.
Diagnosing mammary cancer
The invention provides the method for GPR116 gene of utilizing as the diagnostic markers diagnosing cancer.This diagnostic method comprises step:
(a) .GPR116 expression of gene level in the biological sample of mensuration sample;
(b) with in this expression level of GPR116 gene and the normal specimens compare and
(c) high expression level of GPR116 gene in the sample is defined as has cancer.
The expression level of GPR116 gene in concrete sample can be by quantitatively assessing corresponding to the mRNA of GPR116 gene or by the albumen of GPR116 genes encoding.The mRNA quantivative approach is that those skilled in the art are known.For example, can assess by RNA trace or RT_PCR with the corresponding mRNA of .GPR116 gene.
GPR116 expression of gene level can be analyzed according to the proteic activity or the amount of this GPR116 genes encoding.The method of measuring the GPR116 protein content is shown in down.For example, immunoassay can be used to measure the above-mentioned albumen in the biomaterial.Any biomaterial may be used to this albumen or its active mensuration.For example, analyze blood sample to assess by the shown albumen of serum mark.On the other hand, can proteic activity select suitable method to be used to measure the proteic activity of GPR116 coded by said gene according to be analyzed every kind.
In assessment sample (given the test agent) GPR116 expression of gene level and with normal specimens in compare.When this when proving that relatively GPR116 expression of gene level is higher than level in the normal specimens, judge that then the experimenter dyes cancer is arranged.Can measure simultaneously from GPR116 expression of gene level in normal specimens and experimenter's the sample.Alternatively, can determine the normal range of expression level by statistical method according to the prior result that analysis obtained of GPR116 expression of gene level from the sample that control group is collected.To compare by checking result and this normal range that experimenter's sample is obtained; In the time of in the result does not drop on normal range, the experimenter is determined to dye cancer.In the present invention, cancer to be diagnosed is preferably mammary cancer.
Embodiment 11
The reagent of diagnosing mammary cancer
Diagnostic reagent of the present invention comprises and DNA of the present invention or protein bound compound.Preferably, with the oligonucleotide of multi-nucleotide hybrid of the present invention, perhaps can be used as these compounds and use with the protein bound antibody of the present invention.
Embodiment 12
The method of treatment or Breast Cancer Prevention
The invention provides the method that is used in experimenter's treatment or Breast Cancer Prevention.In order to prevent or therapeutic purpose are applied to therapeutic compound and suffer from or risky (or being easy to) develops into the experimenter of mammary cancer.This type of experimenter obtains identifying by the standard clinical method or by unconventionality expression level or the activity that detects GPR116.Preventative using before the obvious clinical symptom appearance that occurs in disease, thereby preventing disease or disorder, or delay its process.Therapeutic method comprises reduction GPR116 expression of gene or function.In these methods, the experimenter accepts the treatment of significant quantity compound, to reduce the gene (GPR116 gene) of overexpression among the experimenter.Dispenser can be whole body or partial.Therapeutic compound comprises the compound (promptly reducing the compound of overexpression expression of gene) that can be reduced in this type of expression of gene level that endogenous exists in the breast cancer cell.Use this type of therapeutic compound and offset the effect of unusual overexpression gene in experimenter's cell, and expectation can improve experimenter's clinical condition.This compounds can obtain by the present invention's mentioned above screening method.
The GPR116 expression of gene also can suppress by several means known in the art, comprises the experimenter used suppressing or the nucleic acid of antagonism genetic expression.Antisense oligonucleotide, siRNA or the ribozyme that can destroy genetic expression can be used for the expression of suppressor gene.
As previously mentioned, the antisense oligonucleotide corresponding to GPR116 gene nucleic acid sequence can be used for reducing GPR116 expression of gene level.Particularly, the present invention's antisense oligonucleotide can be by any polypeptide or the mRNA corresponding with it in conjunction with the GPR116 genes encoding, thereby the transcribing or translating of suppressor gene, promote the degraded of mRNA, and/or inhibition is reached the proteinic function of the final GPR116 of inhibition and is worked by the protein expression of genes encoding.
By mixing with suitable base mateiral to the derivative non-activity, antisense oligonucleotide and derivative thereof can be made into external preparation, such as liniment or application, are used for the method for the present invention's treatment or prevention prostate cancer.
The nucleic acid that suppresses one or more gene products of overexpression gene also comprises siRNA (siRNA), and it comprises the sense strand nucleic acid of nucleotide sequence of coding GPR116 gene and the molectron of antisense strand nucleic acid.The standard technique of siRNA transfered cell be can be used for treatment and prevention among the present invention, comprise with DNA being that template is transcribed the method that obtains RNA.SiRNA is built into the single transcript that comprises from adopted sequence of having of target gene and complementary antisense sequences, as hairpin structure.
Present method is used for suppressing the genetic expression of the cell that GPR116 genetic expression raises.Combining of GPR116 gene transcripts causes that the GPR116 protein output descends in this cell in siRNA and the target cell.
The nucleic acid of one or more gene products of inhibition overexpression gene also comprises the ribozyme at overexpression gene (GPR116 gene).
Embodiment 13
SCREENED COMPOUND
The invention provides that screening is used for the treatment of or the method for the compound of Breast Cancer Prevention.By the expression level of control GPR116, the generation of may command mammary cancer and development.Like this, expression level that can be by utilizing GPR116 is identified as the screening method of index and be can be used for treating or the compound of Breast Cancer Prevention.
This type of screening can comprise for example following steps:
A) cell of expressing GPR116 is contacted with test compounds; And
B) select the expression level compound of specific energy reduction GPR116 expression level mutually under the situation with the test compounds disappearance.
The cell of expressing GPR116 comprises the clone of for example being set up by mammary cancer; These cells can be with above-mentioned screening method of the present invention (as MDA-MB-231).Expression level can be assessed by method well known to those skilled in the art.In screening method, the compound that can select to reduce the GPR116 expression level is as being used for the treatment of or the drug candidate of Breast Cancer Prevention.Perhaps, screening method of the present invention can may further comprise the steps:
A) make test compounds and the cells contacting that has imported following carrier, the transcription regulatory region that described carrier comprises GPR116 reaches
The reporter gene that this transcription regulatory region control is expressed down.
B) expression level of the said reporter gene of measurement; And
C) select to reduce compared with the control said newspaper reporter gene expression level or active compound.
Suitable reporter gene and host cell are known in the art.Screening required reporter gene construction can make up with the transcription regulatory region of GPR116.And the transcription regulatory region of GPR116 is known to those skilled in the art, can make up the reporter gene carrier with known sequences information.
Embodiment 14
Experiment in the mouse body
The NOD-SCID female mice in 4 ages in week is divided into 2 groups, 5 every group at random.With 1 * 10
6The MDA-MB-231 cell that the MDA-MB-231 cell of the logarithmic phase of/100uL and steady decrease GPR116 express is squeezed in two groups of mouse bodies by the mode of tail vein injection respectively.The conventional raising, nine weeks back execution mouse is got lung tissue section, and behind the HE (hematoxylin eosin stain), microscope is taken pictures.The section result as seen, control group has been injected in the mouse lung section of normal MDA-MB-231 cell has the breast tumor cell of a large amount of transfers (shown in the arrow, tumour cell nucleus and cytoplasmic odds ratio normal surrounding tissue cell are big, and existence normal appearance) with the nuclear atypia phenomenon, and the mouse lung section of the MDAA-MB-231 group of injection steady decrease GPR116 shows that lung tissue structure is normal, without any tumour cell.The mouse experiment made on the living further specifies the expression that reduces GPR116 in the malignant galactophore cancer cells, can reduce the grade malignancy of breast cancer cell, stops the transfer of malignant breast carcinomas.
Sequence table
<110〉East China Normal University
<120〉receptor protein of GPR116 gene and coding thereof and application
<160>13
<170>PatentIn?Version?2.1
<210>1
<211>5822
<212>DNA
<213〉homo sapiens (Homo sapiens)
<220>
<221>CDS
<222>(290)...(4330)
<400>1
1 actttttgtt?tttaaaacag?cagcgcggct?ctcagggatg?actctgtgag?actgggagga
61 tcatagctgg?gggaggctga?gcgtgggagc?ggtgctgcca?gtcctgcctg?aaaacgcgaa
121 atgagtcttg?cttggttctc?cctccactgg?gcgtgagagc?ccctgcccag?gaggcccagg
181 acaaatggcc?ccatagtgga?aactgggaag?cttttaggca?tctgatcaga?gcgggagcca
241 gccgggggac?cacagtgctg?gacaggccaa?ccaactcaaa?cttgaagaca?tgaaatcccc
301 aaggagaacc?actttgtgcc?tcatgtttat?tgtgatttat?tcttccaaag?ctgcactgaa
361 ctggaattac?gagtctacta?ttcatccttt?gagtcttcat?gaacatgaac?cagctggtga
421 agaggcactg?aggcaaaaac?gagccgttgc?cacaaaaagt?cctacggctg?aagaatacac
481 tgttaatatt?gagatcagtt?ttgaaaatgc?atccttcctg?gatcctatca?aagcctactt
541 gaacagcctc?agttttccaa?ttcatgggaa?taacactgac?caaattaccg?acattttgag
601 cataaatgtg?acaacagtct?gcagacctgc?tggaaatgaa?atctggtgct?cctgcgagac
661 aggttatggg?tggcctcggg?aaaggtgtct?tcacaatctc?atttgtcaag?agcgtgacgt
721 cttcctccca?gggcaccatt?gcagttgcct?taaagaactg?cctcccaatg?gacctttttg
781 cctgcttcag?gaagatgtta?ccctgaacat?gagagtcaga?ctaaatgtag?gctttcaaga
841 agacctcatg?aacacttcct?ccgccctcta?taggtcctac?aagaccgact?tggaaacagc
901 gttccggaag?ggttacggaa?ttttaccagg?cttcaagggc?gtgactgtga?cagggttcaa
961 gtctggaagt?gtggttgtga?catatgaagt?caagactaca?ccaccatcac?ttgagttaat
1021?acataaagcc?aatgaacaag?ttgtacagag?cctcaatcag?acctacaaaa?tggactacaa
1081?ctcctttcaa?gcagttacta?tcaatgaaag?caatttcttt?gtcacaccag?aaatcatctt
1141?tgaaggggac?acagtcagtc?tggtgtgtga?aaaggaagtt?ttgtcctcca?atgtgtcttg
1201?gcgctatgaa?gaacagcagt?tggaaatcca?gaacagcagc?agattctcga?tttacaccgc
1261?acttttcaac?aacatgactt?cggtgtccaa?gctcaccatc?cacaacatca?ctccaggtga
1321?tgcaggtgaa?tatgtttgca?aactgatatt?agacattttt?gaatatgagt?gcaagaagaa
1381?aatagatgtt?atgcccatcc?aaattttggc?aaatgaagaa?atgaaggtga?tgtgcgacaa
1441?caatcctgta?tctttgaact?gctgcagtca?gggtaatgtt?aattggagca?aagtagaatg
1501?gaagcaggaa?ggaaaaataa?atattccagg?aacccctgag?acagacatag?attctagctg
1561?cagcagatac?accctcaagg?ctgatggaac?ccagtgccca?agcgggtcgt?ctggaacaac
1621?agtcatctac?acttgtgagt?tcatcagtgc?ctatggagcc?agaggcagtg?caaacataaa
1681?agtgacattc?atctctgtgg?ccaatctaac?aataaccccg?gacccaattt?ctgtttctga
1741?gggacaaaac?ttttctataa?aatgcatcag?tgatgtgagt?aactatgatg?aggtttattg
1801?gaacacttct?gctggaatta?aaatatacca?aagattttat?accacgagga?ggtatcttga
1861?tggagcagaa?tcagtactga?cagtcaagac?ctcgaccagg?gagtggaatg?gaacctatca
1921?ctgcatattt?agatataaga?attcatacag?tattgcaacc?aaagacgtca?ttgttcaccc
1981?gctgcctcta?aagctgaaca?tcatggttga?tcctttggaa?gctactgttt?catgcagtgg
2041?ttcccatcac?atcaagtgct?gcatagagga?ggatggagac?tacaaagtta?ctttccatac
2101?gggttcctca?tcccttcctg?ctgcaaaaga?agttaacaaa?aaacaagtgt?gctacaaaca
2161?caatttcaat?gcaagctcag?tttcctggtg?ttcaaaaact?gttgatgtgt?gttgtcactt
2221?taccaatgct?gctaataatt?cagtctggag?cccatctatg?aagctgaatc?tggttcctgg
2281?ggaaaacatc?acatgccagg?atcccgtaat?aggtgtcgga?gagccgggga?aagtcatcca
2341?gaagctatgc?cggttctcaa?acgttcccag?cagccctgag?agtcccattg?gcgggaccat
2401?cacttacaaa?tgtgtaggct?cccagtggga?ggagaagaga?aatgactgca?tctctgcccc
2461?aataaacagt?ctgctccaga?tggctaaggc?tttgatcaag?agcccctctc?aggatgagat
2521?gctccctaca?tacctgaagg?atctttctat?tagcatagac?aaagcggaac?atgaaatcag
2581?ctcttctcct?gggagtctgg?gagccattat?taacatcctt?gatctgctct?caacagttcc
2641?aacccaagta?aattcagaaa?tgatgacgca?cgtgctctct?acggttaatg?tcatccttgg
2701?caagcccgtc?ttgaacacct?ggaaggtttt?acaacagcaa?tggaccaatc?agagttcaca
2761?gctactacat?tcagtggaaa?gattttccca?agcattacag?tcgggagata?gccctccttt
2821?gtccttctcc?caaactaatg?tgcagatgag?cagcatggta?atcaagtcca?gccacccaga
2881?aacctatcaa?cagaggtttg?ttttcccata?ctttgacctc?tggggcaatg?tggtcattga
2941?caagagctat?ctagaaaact?tgcagtcgga?ttcgtctatt?gtcaccatgg?ctttcccaac
3001?tctccaagcc?atccttgccc?aggatatcca?ggaaaataac?tttgcagaga?gcttagtgat
3061?gacaaccact?gtcagccaca?atacaactat?gccattcagg?atttcaatga?cttttaagaa
3121?caatagccct?tcaggcggcg?aaacgaagtg?tgtcttctgg?aacttcaggc?ttgccaacaa
3181?cacagggggg?tgggacagca?gtgggtgcta?tgtagaagaa?ggtgatgggg?acaatgtcac
3241?ctgtatctgt?gaccacctaa?catcattctc?catcctcatg?tcccctgact?ccccagatcc
3301?tagttctctc?ctgggaatac?tcctggatat?tatttcttat?gttggggtgg?gcttttccat
3361?cttgagcttg?gcagcctgtc?tagttgtgga?agctgtggtg?tggaaatcgg?tgaccaagaa
3421?ccggacttct?tatatgcgcc?acacctgcat?agtgaatatc?gctgcctccc?ttctggtcgc
3481?caacacctgg?ttcattgtgg?tcgctgccat?ccaggacaat?cgctacatac?tctgcaagac
3541?agcctgtgtg?gctgccacct?tcttcatcca?cttcttctac?ctcagcgtct?tcttctggat
3601?gctgacactg?ggcctcatgc?tgttctatcg?cctggttttc?attctgcatg?aaacaagcag
3661?gtccactcag?aaagccattg?ccttctgtct?tggctatggc?tgcccacttg?ccatctcggt
3721?catcacgctg?ggagccaccc?agccccggga?agtctatacg?aggaagaatg?tctgttggct
3781?caactgggag?gacaccaagg?ccctgctggc?tttcgccatc?ccagcactga?tcattgtggt
3841?ggtgaacata?accatcacta?ttgtggtcat?caccaagatc?ctgaggcctt?ccattggaga
3901?caagccatgc?aagcaggaga?agagcagcct?gtttcagatc?agcaagagca?ttggggtcct
3961?cacaccactc?ttgggcctca?cttggggttt?tggtctcacc?actgtgttcc?cagggaccaa
4021?ccttgtgttc?catatcatat?ttgccatcct?caatgtcttc?cagggattat?tcattttact
4081?ctttggatgc?ctctgggatc?tgaaggtaca?ggaagctttg?ctgaataagt?tttcattgtc
4141?gagatggtct?tcacagcact?caaagtcaac?atccctgggt?tcatccacac?ctgtgttttc
4201?tatgagttct?ccaatatcaa?ggagatttaa?caatttgttt?ggtaaaacag?gaacgtataa
4261?tgtttccacc?ccagaagcaa?ccagctcatc?cctggaaaac?tcatccagtg?cttcttcgtt
4321?gctcaactaa?gaacaggata?atccaaccta?cgtgacctcc?cggggacagt?ggctgtgctt
4381?ttaaaaagag?atgcttgcaa?agcaatgggg?aacgtgttct?cggggcaggt?ttccgggagc
4441?agatgccaaa?aagacttttt?catagagaag?aggctttctt?ttgtaaagac?agaataaaaa
4501?taattgttat?gtttctgttt?gttccctccc?cctccccctt?gtgtgatacc?acatgtgtat
4561?agtatttaag?tgaaactcaa?gccctcaagg?cccaacttct?ctgtctatat?tgtaatatag
4621?aatttcgaag?agacattttc?actttttaca?cattgggcac?aaagataagc?tttgattaaa
4681?gtagtaagta?aaaggctacc?taggaaatac?ttcagtgaat?tctaagaagg?aaggaaggaa
4741?gaaaggaagg?aaagaaggga?gggaaacagg?gagaaaggga?aaaagaagaa?aaagagaaag
4801?atgaaaatag?gaacaaataa?agacaaacaa?cattaagggc?catattgtaa?gatttccatg
4861?ttaatgatct?aatataatca?ctcagtgcaa?cattgagaat?ttttttttaa?tggctcaaaa
4921?atggaaactg?aaagcaagtc?atggggaatg?aatactttgg?gcagtatctt?cctgatgtct
4981?tcttagctaa?gaggaggaaa?aaaaggctga?aaaaataggg?aggaaattcc?ttcatcagaa
5041?cgacttcaag?tggataacaa?tatttataag?aaatgaatgg?aaggaaatat?gatcctcctg
5101?agactaactt?tgtatgttaa?ggtttgaact?aagtgaatgt?atctgcagag?gaagtattac
5161?aaagatatgt?cattagatcc?aagtgctgat?taaattttta?tagtttatca?gaaaagcctt
5221?atattttagt?ttgttccaca?ttttgaaagc?aaaaaatata?tatttgatat?acccttcaat
5281?tgccaaattt?gatatgttgc?actgaagaca?gaccctgtca?tatatttaat?ggcttcaagc
5341?aggtacttct?ctgtgcatta?tagaatagat?tttaataatc?ttatagcatt?gtatattatt
5401?attgctgttg?tcactgttat?tattattgtg?gatactggcc?cttggtgtgt?tgcatagctc
5461?cctatgtatt?ctctgtttcc?atctttaagt?tcccagacca?atatacatta?agagttttgc
5521?atggtctaaa?ttgtgtttat?tccaaccacg?tggaaagctc?ctggaaagaa?attttacatt
5581?cggttgttct?gtgctcctaa?tgacacttga?ccttgttgaa?caaatggcag?agcctttccc
5641?aaggatttga?ttgtttgtga?attatctgca?tgtgtgcttt?tttttggtgt?gtatttcatt
5701?aaaaaatata?aatatttatg?aaaattgcac?gcatattaga?gttaaccatg?tactattgat
5761?acagcaacgc?tacattgcaa?ataaaagtcc?gatcccaaaa?ggagaatgag?acaaaaaaaa
5821?aa
<210>2
<211>1346
<212〉amino acid
<213>
<400>2
1 MKSPRRTTLC?LMFIVIYSSK?AALNWNYEST?IHPLSLHEHE?PAGEEALRQK?RAVATKSPTA
61 EEYTVNIEIS?FENASFLDPI?KAYLNSLSFP?IHGNNTDQIT?DILSINVTTV?CRPAGNEIWC
121?SCETGYGWPR?ERCLHNLICQ?ERDVFLPGHH?CSCLKELPPN?GPFCLLQEDV?TLNMRVRLNV
181?GFQEDLMNTS?SALYRSYKTD?LETAFRKGYG?ILPGFKGVTV?TGFKSGSVVV?TYEVKTTPPS
241?LELIHKANEQ?VVQSLNQTYK?MDYNSFQAVT?INESNFFVTP?EIIFEGDTVS?LVCEKEVLSS
301?NVSWRYEEQQ?LEIQNSSRFS?IYTALFNNMT?SVSKLTIHNI?TPGDAGEYVC?KLILDIFEYE
361?CKKKIDVMPI?QILANEEMKV?MCDNNPVSLN?CCSQGNVNWS?KVEWKQEGKI?NIPGTPETDI
421?DSSCSRYTLK?ADGTQCPSGS?SGTTVIYTCE?FISAYGARGS?ANIKVTFISV?ANLTITPDPI
481?SVSEGQNFSI?KCISDVSNYD?EVYWNTSAGI?KIYQRFYTTR?RYLDGAESVL?TVKTSTREWN
541?GTYHCIFRYK?NSYSIATKDV?IVHPLPLKLN?IMVDPLEATV?SCSGSHHIKC?CIEEDGDYKV
601?TFHTGSSSLP?AAKEVNKKQV?CYKHNFNASS?VSWCSKTVDV?CCHFTNAANN?SVWSPSMKLN
661?LVPGENITCQ?DPVIGVGEPG?KVIQKLCRFS?NVPSSPESPI?GGTITYKCVG?SQWEEKRNDC
721?ISAPINSLLQ?MAKALIKSPS?QDEMLPTYLK?DLSISIDKAE?HEISSSPGSL?GAIINILDLL
781?STVPTQVNSE?MMTHVLSTVN?VILGKPVLNT?WKVLQQQWTN?QSSQLLHSVE?RFSQALQSGD
841 SPPLSFSQTN?VQMSSMVIKS?SHPETYQQRF?VFPYFDLWGN?VVIDKSYLEN?LQSDSSIVTM
901 AFPTLQAILA?QDIQENNFAE?SLVMTTTVSH?NTTMPFRISM?TFKNNSPSGG?ETKCVFWNFR
961 LANNTGGWDS?SGCYVEEGDG?DNVTCICDHL?TSFSILMSPD?SPDPSSLLGI?LLDIISYVGV
1021?GFSILSLAAC?LVVEAVVWKS?VTKNRTSYMR?HTCIVNIAAS?LLVANTWFIV?VAAIQDNRYI
1081?LCKTACVAAT?FFIHFFYLSV?FFWMLTLGLM?LFYRLVFILH?ETSRSTQKAI?AFCLGYGCPL
1141?AISVITLGAT?QPREVYTRKN?VCWLNWEDTK?ALLAFAIPAL?IIVVVNITIT?IVVITKILRP
1201?SIGDKPCKQE?KSSLFQISKS?IGVLTPLLGL?TWGFGLTTVF?PGTNLVFHII?FAILNVFQGL
1261?FILLFGCLWD?LKVQEALLNK?FSLSRWSSQH?SKSTSLGSST?PVFSMSSPIS?RRFNNLFGKT
1321?GTYNVSTPEA?TSSSLENSSS?ASSLLN
<210>3
<211>21
<212>RNA
<213〉artificial sequence
<400>3
ccuuguguuc?cauaucauat?t
<210>4
<211>47
<212>DNA
<213〉artificial sequence
<220>
<221〉be used for the oligonucleotide sequence of synthetic hair clip siRNA at GPR116
<400>4
gtgatgcagg?tgaatatgtt?tcaagagaac?atattcacct?gcatcac
<210>5
<211>47
<212>DNA
<213〉artificial sequence
<220>
<221〉be used for the oligonucleotide sequence of synthetic hair clip siRNA at GPR116
<400>5
cactacgtcc?acttatacaa?agttctcttg?tataagtgga?cgtagtg
<210>6
<211>49
<212>DNA
<213〉artificial sequence
<220>
<221〉be used for synthesizing the oligonucleotide sequence of not having the contrast hair clip siRNA of sequence homology with Mammals
<400>6
gttctccgaa?cgtgtcacgt?ttcaagagaa?cgtgacacgt?tcggagaac
<210>7
<211>49
<212>DNA
<213〉artificial sequence
<220>
<221〉be used for synthesizing the oligonucleotide sequence of not having the contrast hair clip siRNA of sequence homology with Mammals
<400>7
caagaggctt?gcacagtgca?aagttctctt?gcactgtgca?agcctcttg
<210>8
<211>55
<212>DNA
<213〉artificial sequence
<220>
<221〉be used to make up artificial sequence synthesized oligonucleotide at the siRNA expression vector of GPR116
<400>8
tgtgatgcag?gtgaatatgt?ttcaagagaa?catattcacc?tgcatcactt?ttttc
<210>9
<211>59
<212>DNA
<213〉artificial sequence
<220>
<221〉be used to make up artificial sequence synthesized oligonucleotide at the siRNA expression vector of GPR116
<400>9
acactacgtc?cacttataca?aagttctctt?gtataagtgg?acgtagtgaa?aaaagagct
<210>10
<211>57
<212>DNA
<213〉artificial sequence
<220>
<221〉be used to make up at not having the artificial sequence synthesized oligonucleotide of the contrast siRNA expression vector of sequence homology with Mammals
<400>10
tgttctccga?acgtgtcacg?tttcaagaga?acgtgacacg?ttcggagaac?ttttttc
<210>11
<211>61
<212>DNA
<213〉artificial sequence
<220>
<221〉be used to make up at not having the artificial sequence synthesized oligonucleotide of the contrast siRNA expression vector of sequence homology with Mammals
<400>11
acaagaggct?tgcacagtgc?aaagttctct?tgcactgtgc?aagcctcttg?aaaaaagagc?t
<210>12
<211>27
<212>DNA
<213〉artificial sequence
<220>
<221〉be used for the artificial sequence synthesized primer of pcr amplification GPR116 total length
<400>12
ggggtacctg?gacaggccaa?ccaactc
<210>13
<211>28
<212>DNA
<213〉artificial sequence
<220>
<221〉be used for the artificial sequence synthesized primer of pcr amplification GPR116 total length
<400>13
ccctcgagtg?agttgagcaa?cgaagaag
Claims (18)
1. isolated dna molecular, it is characterized in that, it comprises: coding has the nucleotide sequence of the polypeptide of people GPR116 protein active, and shows at least 70% homology from the nucleotides sequence of Nucleotide 290-4330 position among described nucleotide sequence and the SEQ ID NO.1; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.1 in from the nucleotide sequence hybridization of Nucleotide 290-4330 position.
2. dna molecular as claimed in claim 1 is characterized in that, described sequence encoding has the polypeptide of the aminoacid sequence shown in the SEQ ID NO.2.
3. dna molecular as claimed in claim 1 is characterized in that, this sequence has among the SEQ ID NO.1 nucleotide sequence from Nucleotide 290-4330 position.
4. a carrier is characterized in that, it comprises the described DNA of claim 1.
One kind by the described carrier of claim 4 according to classical biological method transfection and transformed host cells, comprise prokaryotic cell prokaryocyte and eukaryotic cell.
6. a primer that is used for pcr amplification GPR116 total length has the sequence shown in SEQ ID NO.12 and 13.
7. artificial sequence synthesized oligonucleotide that is used to make up at the siRNA expression vector of GPR116, has the sequence shown in SEQ ID NO.8 and 9, with be used to make up at not having the artificial sequence synthesized oligonucleotide sequence of the contrast siRNA expression vector of sequence homology with Mammals, have sequence shown in SEQ ID NO.10 and 11.
8. oligonucleotide sequence that is used for synthetic hair clip siRNA at GPR116, has sequence shown in SEQ ID NO.4 and 5, synthesize the oligonucleotide sequence of not having the contrast hair clip siRNA of sequence homology with Mammals with being used for, have sequence shown in SEQ ID NO.6 and 7.
9.GPR116 gene is characterized in that as the application of breast cancer diagnosis mark: GPR116 strongly expressed in the malignant galactophore cancer cells, to express and GPR116 is low in the optimum breast cancer cell, no GPR116 expresses in normal galactophore tissue's cell.The nothing of GPR116 expression intensity, weak and strong definition optical density numerical division are defined as optical density(OD) numerical value not have less than 0.1 and express, and are weak expression between the 0.2-0.5, greater than 0.5 be strongly expressed.Because the N-terminal of GPR116 can be hydrolyzed enzymic hydrolysis and become a lot of fragments, discharges into blood, so patient's serum also can be used as and utilizes GPR116 to diagnose one of its mammary cancer specimen.
10. biochip that is used to diagnose and treat mammary cancer is characterized in that: contain following sequence on the carrier of described biochip:
(I)-(iv) sequence or their continuous fragment,
(i) encoding sequence shown in the SEQ ID NO:1;
(ii) with SEQ ID NO:1 in 290-4330 position nucleotide sequence have the sequence of 70% homology at least;
(iii) under the moderate stringent condition with SEQ ID NO:1 in the sequence of 290-4330 position Nucleotide hybridization;
(iv) has sequence with aminoacid sequence at least 70% homology shown in the SEQ ID NO.2;
11. the application of polynucleotide sequence in the medicine of preparation treatment mammary cancer, it is characterized in that, described polynucleotide are to have the encoding sequence shown in the SEQ ID NO:1, perhaps with SEQ ID NO:1 in 290-4330 position nucleotide sequence have the sequence of 70% homology at least, perhaps under the moderate stringent condition with the sequence of the 290-4330 position nucleotide sequence hybridization of SEQ ID NO:1.
12. the application of a kind of polynucleotide sequence as claimed in claim 12 in the medicine of preparation treatment mammary cancer is characterized in that described polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.
13. a screening is used for the treatment of or the method for the compound of Breast Cancer Prevention, said method comprising the steps of:
A) make candidate compound and the cells contacting of expressing GPR116.
B) select such candidate compound, wherein, the expression level of the GPR116 that detects when not having this candidate compound is compared, and this candidate compound reduces the expression level of GPR116.
14. the method for claim 10, wherein said cell comprises breast cancer cell.
15. a screening is used for the treatment of or the method for the compound of Breast Cancer Prevention, said method comprising the steps of:
A) make candidate compound and the cells contacting that has imported carrier, wherein said carrier contains the transcription regulatory region of GPR116 and the reporter gene of expressing under the regulation and control of this transcription regulatory region.
B) expression level or the activity of the described reporter gene of mensuration.
C) select such candidate compound, this candidate compound reduces the expression level or the activity of described reporter gene.
16. be used for the test kit of breast cancer detection, it contains and (a) GPR116 nucleotide sequence or (b) polypeptide bonded detection reagent.
17. the treatment or the composition of Breast Cancer Prevention, described composition contain the antisense polynucleotides or the siRNA at the polynucleotide of GPR116 of medicine effective quantity.
18. the composition of claim 17, described siRNA comprises the nucleotide sequence that contains SEQ ID NO:3.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009101970042A CN102041259A (en) | 2009-10-12 | 2009-10-12 | GPR116 (G-protein coupled Receptor) gene, receptor protein coded by same and application of the GPR116 gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009101970042A CN102041259A (en) | 2009-10-12 | 2009-10-12 | GPR116 (G-protein coupled Receptor) gene, receptor protein coded by same and application of the GPR116 gene |
Publications (1)
Publication Number | Publication Date |
---|---|
CN102041259A true CN102041259A (en) | 2011-05-04 |
Family
ID=43907807
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009101970042A Pending CN102041259A (en) | 2009-10-12 | 2009-10-12 | GPR116 (G-protein coupled Receptor) gene, receptor protein coded by same and application of the GPR116 gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102041259A (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20070026424A1 (en) * | 2005-04-15 | 2007-02-01 | Powell Charles A | Gene profiles correlating with histology and prognosis |
-
2009
- 2009-10-12 CN CN2009101970042A patent/CN102041259A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20070026424A1 (en) * | 2005-04-15 | 2007-02-01 | Powell Charles A | Gene profiles correlating with histology and prognosis |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
An et al. | EGFL6 promotes breast cancer by simultaneously enhancing cancer cell metastasis and stimulating tumor angiogenesis | |
Wallerand et al. | Phospho-Akt pathway activation and inhibition depends on N-cadherin or phospho-EGFR expression in invasive human bladder cancer cell lines | |
KR101925125B1 (en) | Biomarker composition for diagnosing colon cancer or prognosing metastasis of colon cancer comprising NCKAP1 | |
CN109609653B (en) | The molecular marked compound and its application of diagnosis or treatment glioma | |
KR102338510B1 (en) | Companion diagnostic biomarker for anti-her2 therapy and use thereof | |
CN112226510B (en) | Application of MTX1 gene or expression product thereof in preparation of product for diagnosing, preventing or treating liver cancer and related reagent | |
CN107435074A (en) | Application of the CES8 genes in clear cell carcinoma of kidney diagnosis and treatment | |
CN107904311A (en) | A kind of prostate cancer marker and application thereof | |
CN109709335B (en) | Application of heat shock protein HSPA4 in tumor metastasis prediction, prognosis evaluation and treatment | |
CN112824540B (en) | SNX5 as biological marker for prognosis of liver cancer and application thereof | |
CN104726584A (en) | Application of miR-425 in tumor diagnosis, treatment and prognosis | |
CN106191238B (en) | Application of TLR3 in prediction of tumor metastasis, evaluation of prognosis and selection of prevention and treatment scheme | |
TW201204393A (en) | Diagnostic agent and therapeutic agent of cancer | |
JP7167263B2 (en) | Biomarker composition for diagnosing radiation-resistant cancer or predicting radiotherapy prognosis containing PMVK as an active ingredient | |
CN111996251B (en) | Application of malignant glioma biomarker | |
Cheng et al. | MicroRNA-129-5p inhibits invasiveness and metastasis of lung cancer cells and tumor angiogenesis via targeting VEGF. | |
CN115807082A (en) | Use of lncRNA LINREP for diagnosis, prognosis and treatment of glioma | |
WO2006112401A1 (en) | Composition for treatment of cancer | |
CN102041259A (en) | GPR116 (G-protein coupled Receptor) gene, receptor protein coded by same and application of the GPR116 gene | |
CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
CN107881240B (en) | The diagnosis and treatment marker of osteosarcoma | |
US10167516B2 (en) | Six-gene biomarker of survival and response to platinum based chemotherapy in serious ovarian cancer patients | |
CN110305962A (en) | DKC1 and application of the HIF-1 α in synergistic treatment colorectal cancer | |
CN108220443A (en) | Applications of the CGREF1 as marker in clear cell carcinoma of kidney diagnosis and treatment | |
CN115786515B (en) | Application of PDPN in HER2 positive gastric cancer diagnosis and treatment of lapatinib resistance |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20110504 |