CN102038956B - Tumor nucleus target medicinal vector and application thereof in preparing anti-tumor medicament - Google Patents
Tumor nucleus target medicinal vector and application thereof in preparing anti-tumor medicament Download PDFInfo
- Publication number
- CN102038956B CN102038956B CN201010605363A CN201010605363A CN102038956B CN 102038956 B CN102038956 B CN 102038956B CN 201010605363 A CN201010605363 A CN 201010605363A CN 201010605363 A CN201010605363 A CN 201010605363A CN 102038956 B CN102038956 B CN 102038956B
- Authority
- CN
- China
- Prior art keywords
- tumor
- carrier
- p107rh
- adm
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention belongs to the technical field of biopharmacy, in particular to tumor nucleus target medicinal vector protein which is used for reinforcing anti-tumor medicament specificity to identify the tumor cells and entering the tumor nucleus with the anti-tumor medicament carried, and can specifically and effectively kill tumor cells, and a gene for coding the tumor nucleus target medicinal vector protein of the tumor cells, and the invention further relates to application of the medicinal vector in preparing the anti-tumor medicament. The tumor nucleus target medicinal vector contains at least one tumor specificity identification sequence, at least one nucleus location sequence and at least one poly-L-histidine sequence. The tumor nucleus target medicinal vector can reinforce the specificity identification of the anti-tumor medicament on the tumor cells, can enter nucleus with the anti-tumor medicament effectively carried to play the role of inhibiting nucleic acid synthesis of tumor cells, has double target property, and can remarkably reduce the dosage and side and toxic effects of the anti-tumor medicament.
Description
Technical field
The invention belongs to the biopharmacy technical field, be specifically related to a kind of neoplastic cell nuclei target medicine carrier and the application in the preparation antitumor drug thereof.
Background technology
Capture the hot issue that tumor is biomedical boundary always.Developed in the last hundred years and formed operation, radiotherapy, chemotherapy three big clinical therapy of tumor methods.These treatment meanss have prolonged patient's band tumor life cycle to a certain extent; But they also are damaged to the 26S Proteasome Structure and Function of normal structure except excision and destruction tumor in process of clinical application; Especially when whole body uses chemotherapeutics; Medicine reaches each tissue of human body and normal cell has also been produced lethal effect through blood circulation, causes the untoward reaction of whole body, has a strong impact on the final effect of treatment.Therefore, the research and development of novel tumor specific therapy means seem particularly important, also are the targets of researcher unremitting effort all the time.The research of tumor cell target medicine carrier is undoubtedly one of most active fields in current oncology and the study of pharmacy.
Along with the completion of the Human Genome Project (HGP) and carrying out in a deep going way of human cancer genome anatomy plan (CGAP), people's understanding to tumor cell on molecular level is greatly improved.Researcher is through to some and closely-related receptor of tumor cell or molecule; Like EGF-R ELISA (epidermal growth factor; EGF), arginyl glycyl aspartyl dipeptide (Arg-Gly-Asp; RGD) molecular studies is for the research and development of tumor-targeting pharmaceutical carrier provide the important theory foundation.RGD, EGF guide molecule etc. become the first-selected molecule of design tumor cell targeting vector, make the targeted therapy to tumor cell that breakthrough progress arranged.
Yet the carrier of ideal antitumor drug should targeting property transport curative drug arrival tumor cell clinically, and can deliver in the subcellular structure of medicine entering performance drug effect.Could neither influence Normocellular growth like this, reduce the toxic and side effects of medicine, can give full play to the drug effect of antitumor drug again.Because most commercial antitumor drug all are to cause death of neoplastic cells through the physiological process in the interference cell nuclear now; For example (Adriamycin/Doxorubicin ADM) syntheticly reaches the effect of killing tumor cell through what suppress cell nuclear dna and RNA, therefore to amycin; It is not enough that the carrier of antitumor drug only has tumor cell targeting property; It can only make medicine touch tumor cell, but medicine is effectively got in the neoplastic cell nuclei, thereby causes the antitumor drug curative effect not high; Dosage increases, and toxic and side effects increases.This is the key that influences the antitumor drug efficacy for a long time.Therefore, the nuclear target function of the carrier of antitumor drug is most important.
Summary of the invention
The carrier that the purpose of this invention is to provide a kind of new type antineoplastic medicine; It can carry the nucleus that antitumor drug targeting property ground gets into tumor cell; Realize that antitumor drug kills and wounds specificity, the effectiveness of tumor cell, does not have affinity or toxic and side effects to normal cell simultaneously.The carrier of this new type antineoplastic medicine provided by the invention is a kind of protein with neoplastic cell nuclei targeting, can in the preparation antitumor drug, be widely used.
The present invention starts with from these two aspects, site that tumour-specific and medicine play a role, and develops dual-target property pharmaceutical carrier.This pharmaceutical carrier can have specific identification to tumor cell; Make medicine directly contact tumor cell and guide the phagocytosis of tumor cell medicine; Can mediate the nuclear translocation of going into of medicine rapidly again, thereby make medicine effectively get into the effect that tumor cell is killed in the nucleus performance.Use pharmaceutical carrier of the present invention can reduce the using dosage of antitumor drug, and significantly reduced the toxic and side effects of medicine, realized accurately killing tumor cell.
Do not report tumor cell target medicine carrier of the present invention up to now both at home and abroad as yet.Shang Weijian improves the report of antitumor drug killing tumor cell ability with this pharmaceutical carrier.
A kind of neoplastic cell nuclei target medicine carrier of the present invention; This pharmaceutical carrier albumen comprises at least one nuclear localization sequence (nuclear localization sequence), at least one RGD tripeptide sequence and at least one poly histidine peptide sequence; Nuclear localization sequence is through at least one covalent bond and the coupling mutually of described RGD tripeptide sequence; And described poly histidine peptide sequence forms three's linear recombiant protein sequence through at least one covalent bond and described nuclear localization sequence or the coupling mutually of described RGD tripeptide sequence.
Wherein said nuclear localization sequence is the peptide sequence from human body protein; Has single nuclear target function; It has the aminoacid sequence shown in the SEQ ID NO:1; Described RGD tripeptide sequence has the aminoacid sequence shown in the SEQ ID NO:2, and described poly histidine peptide sequence has the aminoacid sequence shown in the SEQ ID NO:3.
Further, the poly histidine peptide sequence of foregoing a kind of neoplastic cell nuclei target medicine carrier is positioned at proteic N-terminal of this pharmaceutical carrier or C-terminal.Covalent bond is a peptide bond.
Further, the aminoacid sequence of this pharmaceutical carrier is shown in SEQ ID NO:4.
Foregoing a kind of neoplastic cell nuclei target medicine carrier has widely in the preparation antitumor drug to be used.This pharmaceutical carrier forms the covalent coupling thing of neoplastic cell nuclei targeting vector-antitumor drug through at least one covalent bond and antitumor drug coupling mutually.Antitumor drug be amycin (Adriamycin, ADM), cytosine arabinoside (Cytarabine, CPT), Raltitrexed (Raltitrexed) or cisplatin (Cisplatin Injection).
Further, the invention still further relates to the proteic gene of the foregoing neoplastic cell nuclei target medicine carrier of a kind of coding, it has the DNA sequence shown in the SEQ ID NO:5.The invention still further relates to a kind of recombinant expression carrier, it is the gene of DNA sequence shown in the SEQ ID NO:5 and the recombinant expression carrier of expression vector pET28a, pMA5 or pGT22 recombination to construct.
The aminoacid sequence of the neoplastic cell nuclei target medicine carrier in the embodiment of the invention 1 is shown in SEQ ID NO:4; It is that SEQ ID NO:1 sequence and SEQ ID NO:2 sequence and SEQ ID NO:3 sequence are recombinated in order and formed; Among the embodiment 2 in the covalent coupling thing of prepared " neoplastic cell nuclei targeting vector-antitumor drug "; The aminoacid sequence of carrier shown in SEQ ID NO:4, antitumor drug be amycin (Adriamycin, ADM); The covalent coupling thing of " neoplastic cell nuclei targeting vector-antitumor drug " is in tumor cell specific and the effectiveness lethal effect among the embodiment 3, and applied target cell is the Hela cell.
Characteristics of the present invention are to be the proteic core sequence of pharmaceutical carrier with the nuclear localization sequence from human body protein; Recombinated simultaneously and the closely-related small peptide sequence of tumor cell; Demonstrate fully the tumor cell specific and nuclear targeting property of carrier protein, make antitumor drug carrier of the present invention have dual-target property.
Description of drawings
The order-checking spectrogram of Fig. 1: embodiment 1 described pET28a-P107RH recombinant expression carrier;
Fig. 2: embodiment 1 described recombinant expression carrier pET28a-P107RH makes up sketch map;
Fig. 3: the SDS-PAGE collection of illustrative plates of the reconstituted drug carrier protein P107RH that purification obtains; M wherein: protein Marker; A:P107RH;
The purity analysis figure of Fig. 4: P107RH-ADM;
The link coupled fluorescence spectrophotometry analysis chart of Fig. 5: P107RH and ADM;
Fig. 6: pharmaceutical carrier P107RH strengthens antitumor drug ADM to HeLa cell killing function analysis figure; Wherein, be 100% with control cells;
Fig. 7: pharmaceutical carrier P107RH quickens antitumor drug ADM and gets into neoplastic cell nuclei and make ADM analysis of agglomeration figure in tumor cell; Wherein, the immunofluorescence of ADM demonstrates the position that exists of ADM, and the painted position of DAPI demonstrates nuclear zone;
Fig. 8: pharmaceutical carrier P107RH strengthens antitumor drug ADM to the specificity of tumor cell and reduce the lethal effect analysis chart of ADM to non-tumor cell; Wherein, be 100% with control cells.
The specific embodiment
Embodiment 1: preparation neoplastic cell nuclei target medicine carrier P107RH may further comprise the steps:
(1) design pharmaceutical carrier protein sequence of the present invention
The design of neoplastic cell nuclei target medicine carrier P107RH of the present invention makes its complete amino acid sequence shown in SEQ ID NO:4; It has comprised 1 SEQ ID NO:1 (nuclear targeting) sequence, 1 SEQ ID NO:2 (tumor cell identification) sequence and 1 SEQ ID NO:3 (histidine-tagged) sequence; 1 nuclear targeting sequence SEQ ID NO:1 forms neoplastic cell nuclei target medicine carrier sequence SEQ ID NO:4 with 1 tumor recognition sequence SEQ ID NO:2 and 1 histidine-tagged sequence SEQ IDNO:3 reorganization in order; SEQ ID NO:3 (histidine-tagged) sequence is the part of this pharmaceutical carrier sequence, is again the proteic purification tag of this pharmaceutical carrier.
(2) gene of composite coding P107RH and make up its expression vector
According to the aminoacid sequence of the neoplastic cell nuclei target medicine carrier P107RH that the present invention designed, design and utilized the dna synthesizer synthetic coding P107R genetic fragment, its sequence is following:
aa
ccatggacctcttcggggacctgccggagcccgagcgctcgccgcgcccggctgccgggaaagaagctcagaaaggacccctgctctttgatgacctccctccggccagcagtactgactcaggatcagggggacctttgctttttgatgatctcccacccgctagcagtggcgattcaggttctcttgccacatcaatatcccagatggtaaagactgaagggaaaggagcaaagagaaaaacctccgaggaagagaagaatggcagtgaagagcttgtggaaaagaaagtttgtaaagcctcttcggtgatctttggtctgcgtggagat
ctcgagct
Wherein 5 ' end has underscore
CcatggSequence is restriction endonuclease Ncol recognition site, and 3 ' end has underscore
CtcgagSequence is a restriction endonuclease Xhol recognition site; Prokaryotic expression carrier pET28a (the general coli expression carrier that this two restriction enzyme site that is designed and the present invention are used; Contain T7 promoter, histidine-tagged and kanamycin sulfate resistant gene etc.; Companies such as Novagen are on sale) Ncol and Xhol be complementary, be suitable in escherichia coli, efficiently expressing.Utilize Ncol and Xhol cleavage site that the gene fragment clone of this artificial synthetic coding P107R is advanced among the expression vector pET28a between the Ncol and Xhol restriction enzyme site; Connect the gene that just obtains complete coding P107RH, its nucleotide sequence is shown in SEQ ID NO:5.
The construction step of above-mentioned expression vector is specific as follows:
Double digestion reaction: with the genetic fragment 5.0ug of 1.0 μ g pET28a carriers and above-mentioned coding P107R with the dna synthesizer synthetic respectively with the appropriate amount of deionized water mixing; Make its cumulative volume be respectively 16 μ l; Each adds restricted enzyme Ncol and Xhol and the 2 μ l corresponding 10X K buffer and the 2 μ l bSAs (BSA) of 2 units, and making its final concentration is 0.01% (mass concentration), mixing; Place 37 ℃ of water bath heat preservations after 2 hours; (it is on sale that worker company is given birth in Shanghai, article No.: BS413) reclaim target DNA, obtain the genetic fragment of carrier pET28a fragment and coding P107R respectively to use conventional agarose gel to reclaim test kit respectively.
The coding genetic fragment of P107R and being connected of carrier pET28a: get the carrier pET28a fragment that 0.5 μ g above-mentioned steps reclaims; Genetic fragment, the 2 μ l 10XT4DNA ligase buffer of the coding P107R that the above-mentioned steps of 10 times of moles of adding obtains; Add deionized water and be settled to 20 μ l, add the T4DNA ligase of 1 unit at last, mixing and moment are centrifugal so that at the bottom of the droplet congregating pipe; After placing 16 ℃ of water-baths to spend the night, the recombinant expression carrier pET28a-P107RH that obtains connecting.
Recombinant expression carrier pET28a-P107RH Transformed E .coli DH5 α: get 10 μ l recombinant expression carrier pET28a-P107RH and add 100 μ l E.coli DH5 α competent cells (method for preparing reference " molecular cloning experiment guide " second edition of E.coli DH5 α competent cell; Science Press; 49 pages) in; Ice bath was placed in 42 ℃ of water-baths and is incubated 1 minute in 30 minutes, took out and place ice bath cooling 2 minutes immediately.The SOC fluid medium that adds 37 ℃ of preheatings of 200 μ l, 37 ℃ of 150rpm joltings were cultivated after 60 minutes, took out 100 μ l culture fluid and coated on the LB agar culture plate of sulfur acid kanamycin, cultivated after 16 hours for 37 ℃, bacterium colony occurred transforming.
The clone of recombinant expression carrier pET28a-P107RH and gene sequencing: the picking transformed bacteria is dropped into capable nucleic acid sequence analysis; Result such as Fig. 1 (recombinant expression carrier pET28a-P107RH spectrogram that checks order; The gene sequence number of P107RH of wherein encoding is 766～No. 1122) shown in, proving the gene of the complete P107RH that obtained to encode, its nucleotide sequence is shown in SEQ ID NO:5; Start codon is ATG, and termination codon is TGA.The building process of recombinant expression carrier pET28a-P107RH is as shown in Figure 2; Utilize Ncol and Xhol cleavage site that the gene fragment clone of synthetic coding P107RGD is advanced among the expression vector pET28a between the Ncol and Xhol restriction enzyme site, obtain recombinant expression carrier pET28a-P107RH.
(3) expression of neoplastic cell nuclei target medicine carrier P107RH and preparation:
Use the serial cell of E.coli BL21 (DE3) to be host's bacterial cell in the present embodiment; But recombinant expression carrier pET28a-P107RH Transformed E .coli BL21 (DE3) cell; And use kanamycin sulfate to filter out the monoclonal cell strain of ability stably express, obtain the neoplastic cell nuclei target medicine carrier P107RH that expresses.Concrete operations:
The recombinant expression carrier pET28a-P107RH of 1.0 μ g is joined in 100 μ l E.coli BL21 (DE3) competent cells, and mixing gently, ice bath were placed in 42 ℃ of water-baths insulation in 30 minutes 1 minute, took out and place ice bath cooling 2 minutes immediately.The SOC that adds 37 ℃ of preheatings of 800 μ l is fluid medium also, and 37 ℃ of 150rpm joltings were cultivated after 60 minutes, takes out 100 μ l culture fluid and coats on the LB agar culture plate of sulfur acid kanamycin, cultivates after 16 hours, obtains the single bacterium colony that transforms for 37 ℃.
Single bacterium colony that picking transforms is inoculated in the 2ml LB culture medium 37 ℃ of jolting overnight incubation.With the ratio inoculation 10ml LB culture medium (50 μ g/ml Kana) of 1: 100 (volume ratio), 37 ℃ of 200rpm shaken cultivation are to OD
600=0.8～1.0, add isopropyl-(IPTG) to final concentration 1mM, after 37 ℃ of 200rpm vibrations were induced 12 hours, 4 ℃ of 5000rpm collected thalline in centrifugal 5 minutes.The resuspended thalline of 10mM Tris-cl (pH8.0) with 1/10 culture fluid volume places ice bath ultrasonic disruption thalline.4 ℃ of broken thalline, centrifugal 15 minutes of 5000rpm obtains supernatant.At last, use Ni
2+(it is on sale that the worker is given birth in Shanghai, and article No.: BSP079) purification obtains neoplastic cell nuclei target medicine carrier P107RH of the present invention for affinity column.
A shows the SDS-PAGE qualification result of prepared neoplastic cell nuclei target medicine carrier P107RH among Fig. 3, and the molecular weight of the neoplastic cell nuclei target medicine carrier P107RH that purification obtains is 13kDa.
The present invention has designed the aminoacid sequence of neoplastic cell nuclei target medicine carrier P107RH, and has synthesized the gene of coding P107RH, uses this gene expression to go out neoplastic cell nuclei target medicine carrier P107RH.Described neoplastic cell nuclei target medicine carrier P107RH uses Ni with the soluble protein formal representation
2+Affinity chromatography has obtained neoplastic cell nuclei target medicine carrier P107RH of the present invention.
The preparation of embodiment 2 antitumor cells nuclear targeted drug P107RH-ADM may further comprise the steps:
(1) neoplastic cell nuclei target medicine carrier P107RH and antitumor drug amycin (Adriamycin, ADM) coupling
It is 1-ethyl-3-(3-dimethylamino-propyl) carbodiimide hydrochloride [1-Ethyl-3-(3-dimethyllaminopropyl) carbodiimide hydrochloride of 1nM that 10mg doxorubicin hydrochloride (ADMHCl) and 240mg neoplastic cell nuclei target medicine carrier P107RH are placed the 10ml final concentration; EDC.HCl] and the N-hydroxy-succinamide (Hydroxysuccinimide of 1nM; NHS) in the aqueous solution; Placed 37 ℃ of lucifuge gentle agitation 10 hours; Accomplish the coupling of neoplastic cell nuclei target medicine carrier P107RH and antitumor drug ADM, obtain coupled product P107RH-ADM.
Coupled product P107RH-ADM again through dialysis, lyophilizing, obtains antitumor cell nuclear targeted drug P107RH-ADM with G50 sieve chromatography column separating purification.
(2) purity detecting of antitumor cell nuclear targeted drug P107RH-ADM
Molecular sieve chromatography detects antitumor cell nuclear targeted drug P107RH-ADM: with the antitumor cell nuclear targeted drug P107RH-ADM preparation 2ml of preparation, the solution of 2mg/ml; Use G50 molecular sieve chromatography testing goal degree of purity of production, the result is as shown in Figure 4.Purpose product peak is a simple spike, and molecular weight conforms to theoretical value, shows that the product purity of preparation is higher, has reached application standard.
Spectrofluorophotometer detects antitumor cell nuclear targeted drug P107RH-ADM: place the wavelength of Ex470nm, Em585nm to measure fluorescence intensity the neoplastic cell nuclei target medicine carrier P107RH of 24mg/ml and the antitumor drug ADM of antitumor cell nuclear targeted drug P107RH-ADM and 1mg/ml respectively; The result finds: the antitumor cell nuclear targeted drug P107RH-ADM of preparation all detects fluorescence intensity at Ex470nm, Em585nm place with identical normal monomer antitumor drug ADM; And neoplastic cell nuclei target medicine carrier P107RH does not detect fluorescence intensity, and is as shown in Figure 5.This has proved neoplastic cell nuclei target medicine carrier P107RH and antitumor drug ADM coupling success.
Embodiment 3 neoplastic cell nuclei target medicine carrier P107RH have strengthened the antitumor action of antitumor drug ADM
(1) neoplastic cell nuclei target medicine carrier P107RH has strengthened the lethal effect of antitumor drug ADM to tumor cell
With well-grown 1 * 10
4The HeLa cell is divided into three groups; Make the even adherent growth of cell behind 96 orifice plates bottom; Add final concentration in three groups of cells respectively and be 20,40, the monomer antitumor drug ADM of 80nmol/ml, antitumor cell nuclear targeted drug P107RH-ADM, neoplastic cell nuclei target medicine carrier P107RH; Above-mentioned three groups of cells are measured cell survival rate with mtt assay after hatching 24h; Structure is as shown in Figure 6; Simple neoplastic cell nuclei target medicine carrier P107RH does not have lethal effect (cell survival rate reaches 100%) to the HeLa cell; And simple antitumor drug ADM and antitumor cell nuclear targeted drug P107RH-ADM all have lethal effect to the HeLa cell; Wherein the more simple antitumor drug ADM of lethal effect of antitumor cell nuclear targeted drug P107RH-ADM obviously strengthens, and shows that neoplastic cell nuclei target medicine carrier P107RH has significantly strengthened the lethal effect of antitumor drug ADM to tumor cell, demonstrates the effect of neoplastic cell nuclei target medicine carrier.
(2) neoplastic cell nuclei target medicine carrier P107RH has strengthened the gathering of antitumor drug ADM in neoplastic cell nuclei.
With well-grown 1 * 10
4The HeLa cell is divided into two groups, makes the even adherent growth of cell after on the sheet glass of 24 orifice plates bottoms, and adding final concentration respectively is antitumor cell nuclear targeted drug P107RH-ADM and the monomer antitumor drug ADM of 20nmol/ml; And the Subcellular Localization of when 5min, 10min, 30min, under fluorescence microscope, observing ADM, and compare with the painted nuclear area of DAPI, the result is as shown in Figure 7; By contrast; In the cell that adds simple antitumor drug ADM, it is slower that ADM gets into nuclear speed, still has part A DM to be present in the Cytoplasm during 10min; When 30min, ADM exists the position just identical basically with the painted nuclear area of DAPI; And in the cell that adds antitumor cell nuclear targeted drug P107RH-ADM; ADM's exists the painted nuclear area of position and DAPI just consistent basically during 5min; During to 10min; Exist position and the painted nuclear area of DAPI of ADM fit like a glove, and when the 30min, the gathering of ADM in nucleus further strengthened.The The above results explanation: neoplastic cell nuclei target medicine carrier P107RH has obviously strengthened antitumor drug ADM and has got into speed and quantity in the HeLa nucleus; Show that neoplastic cell nuclei target medicine carrier P107RH can guide link coupled antitumor drug ADM to get into neoplastic cell nuclei fast and in nuclear, assembles, and has demonstrated the effect of the cell nucleus targeting pharmaceutical carrier of neoplastic cell nuclei target medicine carrier P107RH.
(3) neoplastic cell nuclei target medicine carrier P107RH has strengthened the specific killing effect of antitumor drug ADM to tumor cell
Respectively with well-grown 1 * 10
4HEK293, HeLa cell respectively are divided into two groups; Make the even adherent growth of cell in 96 orifice plates bottom; Adding final concentration in two kinds of cells respectively is antitumor cell nuclear targeted drug P107RH-ADM and the monomeric antitumor drug ADM of 20nmol/ml, and behind 24h, measures the survival rate of cell respectively with mtt assay, and the result is as shown in Figure 8; Two kinds of ADM all have lethal effect to tumor cell HeLa; But P107RH-ADM is more obvious for antitumor cell nuclear targeted drug, and for human embryo kidney normal cell HEK293, the result but completely contradicts: monomeric antitumor drug ADM examines targeted drug P107RH-ADM to the lethal effect of HEK293 apparently higher than antitumor cell; And antitumor cell nuclear targeted drug P107RH-ADM only shows faint lethal effect to the HEK293 cell; This shows that neoplastic cell nuclei target medicine carrier P107RH can obviously strengthen the specificity of link coupled ADM to tumor cell, reduces ADM to Normocellular lethal effect, reduces the toxic and side effects of ADM.
Claims (5)
1. neoplastic cell nuclei target medicine carrier, it is characterized in that: the proteic aminoacid sequence of this pharmaceutical carrier is shown in SEQ ID NO:4.
2. the application of the described a kind of neoplastic cell nuclei target medicine carrier of claim 1 in the preparation antitumor drug.
3. the application of a kind of neoplastic cell nuclei target medicine carrier as claimed in claim 2 in the preparation antitumor drug; It is characterized in that: this pharmaceutical carrier forms the covalent coupling thing of neoplastic cell nuclei targeting vector and amycin, cisplatin, Raltitrexed or cytosine arabinoside through covalent bond and the coupling mutually of amycin, cisplatin, Raltitrexed or cytosine arabinoside.
4. the gene of the described neoplastic cell nuclei target medicine carrier of the claim 1 of encoding, it is characterized in that: its DNA sequence is shown in SEQ ID NO:5.
5. recombinant expression carrier is characterized in that: be gene and expression vector pET28a, pMA5 or the pGT22 reorganization of DNA sequence shown in the SEQ ID NO:5, and the recombinant expression carrier of structure.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010605363A CN102038956B (en) | 2010-12-24 | 2010-12-24 | Tumor nucleus target medicinal vector and application thereof in preparing anti-tumor medicament |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010605363A CN102038956B (en) | 2010-12-24 | 2010-12-24 | Tumor nucleus target medicinal vector and application thereof in preparing anti-tumor medicament |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102038956A CN102038956A (en) | 2011-05-04 |
| CN102038956B true CN102038956B (en) | 2012-09-05 |
Family
ID=43905714
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010605363A Expired - Fee Related CN102038956B (en) | 2010-12-24 | 2010-12-24 | Tumor nucleus target medicinal vector and application thereof in preparing anti-tumor medicament |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102038956B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104857523A (en) * | 2015-04-23 | 2015-08-26 | 东南大学 | Trastuzumab-mediated cis-platinum targeting conjugate and preparation method thereof |
| CN106619571B (en) * | 2017-01-03 | 2020-04-07 | 西南交通大学 | Polymer nano-carrier for improving endocytosis and cell nucleus targeting and preparation method thereof |
| CN113025637A (en) * | 2021-02-05 | 2021-06-25 | 贵州医科大学 | Bacterial origin anti-tumor PNPase gene and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101210044A (en) * | 2007-12-25 | 2008-07-02 | 王自正 | Polypeptide and application thereof |
-
2010
- 2010-12-24 CN CN201010605363A patent/CN102038956B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101210044A (en) * | 2007-12-25 | 2008-07-02 | 王自正 | Polypeptide and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102038956A (en) | 2011-05-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5995879B2 (en) | Angiogenesis inhibitor, and production method, modification method thereof, and use in production of antitumor agent | |
| CN106282216B (en) | A kind of preparation method of recombinant long-acting chicken interferon α | |
| RU2006100679A (en) | MODIFIED RECOMBINANT VACCINING VIRUSES AND OTHER MICRO-ORGANISMS AND THEIR APPLICATION | |
| CN109593693B (en) | Escherichia coli Nissle 1917 anti-tumor targeting engineering bacterium and construction method and application thereof | |
| CN112933219B (en) | Preparation method and application of DNA-polypeptide reversible covalent coupling molecule | |
| CN110478322A (en) | A kind of nucleic acid drug compound and its preparation method and application | |
| CN102038956B (en) | Tumor nucleus target medicinal vector and application thereof in preparing anti-tumor medicament | |
| CN104342444A (en) | Recombinant TRAIL protein and preparation method and application thereof | |
| CN105504063B (en) | The antineoplastic amalgamation protein of a kind of alexin-albumin and its preparation and application | |
| CN108578709A (en) | Thermo-sensitive long-acting slow-releasing medicine carrier and its application | |
| CN101143902B (en) | Anti-HER2 single-chain antibody-cefuroxime sodium enhanced fusion protein HER2(Fv-LDM) | |
| CN101070350B (en) | Intensified fusion protein NGR-LDP-AE formed by target peptide to CD13 and lidamycin | |
| CN101475643B (en) | Double single chain antibody strengthened fusion protein dFv-LDP-AE, preparation and use thereof | |
| CN102038957B (en) | Efficient cell nucleus targeted medicine vector and application thereof to preparing antineoplastic medicines | |
| CN102516392A (en) | Cancer-targeted super antigen fusion protein, and preparation method and application thereof | |
| CN109400711A (en) | A kind of PDGFR β targeting tumor necrosin relative death inducing ligand variant and its preparation method and application | |
| CN101003568A (en) | Recombined diphtheria toxin, preparation method, and application | |
| CN104119444B (en) | Anti-tumor fusion protein and preparation method and application thereof | |
| CN100352838C (en) | Interfusion protein of antineoplastic genetic engineering composed of target short peptide of receptor of epidermal growth factor and Lidamycin | |
| CN105985447B (en) | A kind of albumin mating type tumor necrosin relative death inducing ligand variant and its preparation method and application | |
| CN102690342B (en) | Anti-cancer analgesic peptide VKVR, its preparation method and application | |
| CN101875691A (en) | Scorpion arialgesic antitumoral peptide mutant and preparation method thereof | |
| CN101456913B (en) | Anti-tumor fusion protein and use thereof | |
| CN101070547B (en) | Recombined protein carrier PEA II-HphA of actively carrying exogenic gene, its preparing method and use | |
| CN110101868A (en) | A kind of environmental stimulus responsiveness protein high molecular conjugate self-assembly and the preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120905 Termination date: 20121224 |