CN102021175A - Optimized grass carp alpha interferon encoding gene and application thereof - Google Patents
Optimized grass carp alpha interferon encoding gene and application thereof Download PDFInfo
- Publication number
- CN102021175A CN102021175A CN 201010549303 CN201010549303A CN102021175A CN 102021175 A CN102021175 A CN 102021175A CN 201010549303 CN201010549303 CN 201010549303 CN 201010549303 A CN201010549303 A CN 201010549303A CN 102021175 A CN102021175 A CN 102021175A
- Authority
- CN
- China
- Prior art keywords
- alpha
- solution
- gcifn
- interferon
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses an optimized grass carp alpha interferon encoding gene and application thereof. The optimized grass carp alpha interferon encoding gene disclosed by the invention is deoxyribonucleic acid (DNA) shown as a sequence 2 of a sequence table. The expression capacity of the gene is far higher than that of a conventional gene; a recombinant plasmid is obtained by inserting the gene into multiple clone sites of pBV220; and a recombinant strain is obtained by importing the recombinant plasmid into colon bacillus DH5alpha. A large amount of ChIFN-alpha protein can be prepared by using the recombinant strain through simple inducing and culturing. The gene, the recombinant plasmid and the recombinant strain provided by the invention have a great economic value for the generation of the alpha interferon and also have a great value for aquaculture industry.
Description
Technical field
The invention belongs to the genetically engineered field, relate to a kind of grass carp interferon-alpha encoding gene and application thereof of optimization.
Background technology
In recent years, China's high-density, intensive aquaculture mode have caused various diseases frequently to take place, and particularly various virus diseases have become the key factor that restricts China's aquaculture industry sustainable development.People use various chemical substances to carry out the treatment of fish virus disease always for a long time, but this type of medicine very easily causes drug residue to exceed standard, add more and more higher to the requirement of food health both at home and abroad, making culture fishery have difficulty in walking, is extremely urgent so seek the antiviral fishing medicine of new safe noresidue already.
Fish are the low vertebratess of waiting, and non-specific immunity is occupied critical role.Interferon system plays an important role in the anti-infectious immunity of fish body as a kind of factor of non-specific immunity efficiently.The report of at present both at home and abroad existing salmo IFN gene order, aminoacid sequence aspect, and realized the fermentation expression of interferon gene in protokaryon or eukaryotic expression system is for the large-scale production and the application of fish genetic engineering interferon provides foundation.
Summary of the invention
The purpose of this invention is to provide a kind of grass carp interferon-alpha encoding gene and application thereof of optimization.
The grass carp interferon-alpha encoding gene of optimization provided by the invention is the DNA shown in the sequence 2 of sequence table.
The recombinant vectors, reorganization bacterium, expression cassette or the transgenic cell line that contain the DNA shown in the sequence 2 of ordered list all belong to protection scope of the present invention.
Described recombinant vectors can be the DNA shown in the sequence 2 of sequence table is inserted the recombinant plasmid that the multiple clone site of pBV220 obtains.Described recombinant vectors is preferably the recombinant plasmid that obtains between the BamHI of the insertion of the DNA shown in the sequence 2 of sequence table pBV220 and EcoRI site.
Described reorganization bacterium can be the DNA shown in the sequence 2 of sequence table is imported the reorganization bacterium that bacillus coli DH 5 alpha obtains.Described reorganization bacterium is preferably described recombinant vectors is imported the reorganization bacterium that bacillus coli DH 5 alpha obtains.Described reorganization bacterium most preferably is colon bacillus (Escherichia coli) DH5 α/pBV220-GCIFN α, be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on August 23rd, 2010 and (be called for short CGMCC, the address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City), preserving number is CGMCC No.4111.
The present invention also protects a kind of method for preparing interferon-alpha; be with described reorganization bacterium, induce 4~8 hours (inducing 6 hours for preferred 42 ℃), broken then thalline for 40~43 ℃; collect inclusion body, washing inclusion body, dissolve inclusion body and, obtain containing the solution of interferon-alpha its renaturation.
Described method also comprises the step of the described solution that contains interferon-alpha being carried out protein purification.
The method of described protein purification is as follows: is 5.5-9.5 with the described solution that contains interferon-alpha with the vinegar acid for adjusting pH value, adopt HiLoad 26/10 SP Sepharose High Performance to carry out cation-exchange chromatography, with 5 column volumes of lavation buffer solution first flushing, use 1-10 column volume of lavation buffer solution second wash-out then, collect ultraviolet absorption value under the 280nm illumination greater than 200 elutriant, the solution that obtains is interferon-alpha solution; The pH of described lavation buffer solution first is 5.5-9.5, is made up of TrisCl, NaCl and water, and TrisCl concentration is 0.1mol/L, and NaCl concentration is 0-150mM; The pH of described lavation buffer solution second is 5.5-9.5, is made up of TrisCl, NaCl and water, and TrisCl concentration is 0.1mol/L, and NaCl concentration is 150-2000mM.
The method of described protein purification is specific as follows: the solution that will contain the grass carp interferon-alpha is 6.5 with the vinegar acid for adjusting pH value, adopt HiLoad 26/10 SP Sepharose High Performance (internal diameter 26mm, height of bed 100mm, GE LifeScience) carries out cation-exchange chromatography; Sample adds in the chromatography column with 1ml/ minute speed, with lavation buffer solution first 5 column volumes of speed flushing with 5ml/ minute, with lavation buffer solution second 3 column volumes of speed wash-out with 5ml/ minute, collect ultraviolet absorption value under the 280nm illumination greater than 200 elutriant, the solution that obtains is interferon-alpha solution (available 0.22um filter membrane carries out filtration sterilization); The pH of described lavation buffer solution first is 6.5, is made up of TrisCl, NaCl and water, and TrisCl concentration is 0.1mol/L, and NaCl concentration is 50mM; The pH of described lavation buffer solution second is 6.5, is made up of TrisCl, NaCl and water, and TrisCl concentration is 0.1mol/L, and NaCl concentration is 500mM.
The interferon-alpha solution that described method prepares also belongs to protection scope of the present invention.
Described DNA, described recombinant vectors, described reorganization bacterium, described expression cassette or described transgenic cell line all can be used for preparing interferon-alpha.
Described DNA, described recombinant vectors, described reorganization bacterium, described expression cassette or described transgenic cell line all can be used for preparing viral inhibitors.Described virus can be infectious hematopoietic necrosis's poison (IHNV) and/or grass carp hemorrhage virus (GCHV) (GCHV).Described metachromia hematopoietic necrosis virus (IHNV) specifically can be the WRAC strain.
Described DNA, described recombinant vectors, described reorganization bacterium, described expression cassette or described transgenic cell line all can be used for being prepared as follows (a) and/or (b);
(a) treat and/or prevent the preparation of fish disease viral disease;
(b) preparation of raising shrimp survival rate.
Described fish disease viral disease specifically can be hemorrhagic disease of grass carp.Described shrimp specifically can be Chinese prawn.
The present invention has found a kind of ChIFN α gene of optimization, and described expression of gene ability is far above existing gene, and the multiple clone site of this gene being inserted pBV220 has obtained recombinant plasmid, and recombinant plasmid is imported bacillus coli DH 5 alpha, has obtained the reorganization bacterium.This reorganization bacterium just can be prepared a large amount of ChIFN α albumen by simple inducing culture.Gene provided by the invention, recombinant plasmid and reorganization bacterium have economic worth for the production of interferon-alpha, also have great value for culture fishery.
Description of drawings
Fig. 1 is the sequence alignment of GcIFN-α-1 gene (DNA shown in the sequence 2) and GcIFN-α-2 gene (DNA shown in the sequence 3).
Fig. 2 is the pcr amplification result's of grass carp interferon gene (GcIFN-α-1 and GcIFN-α-2) agarose gel electrophoresis figure; M is a dna molecular amount standard, the negative results of comparison of L1 (is template with water), and L2 is GcIFN-α-1 gene amplification result, L3 is GcIFN-α-2 gene amplification result.
Fig. 3 detects grass carp interferon gene (GcIFN-α-1 and GcIFN-α-2) in expression in escherichia coli product result for SDS-PAGE; Before L1 contrast bacterium was induced, L2 was that L3 was before recombinant bacterial strain is induced after the contrast bacterium was induced, and L4 is after recombinant bacterial strain is induced, and M is low molecular weight protein (LMWP) Marker.
Fig. 4 is the SDS-PAGE detected result of purified GcIFN; M is albumen Marker, and L1 is GcIFN-α-1 solution, and L2 is GcIFN-α-2 solution.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is ordinary method.Used test materials among the following embodiment if no special instructions, is to buy from routine biochemistry reagent shop and obtains.All primers synthesize and examining order is finished by the rich Deco skill Development Co., Ltd that steps in Beijing.Quantitative test in following examples all is provided with repeated experiments three times, results averaged.% in following examples if no special instructions, is the quality percentage composition.
(polyinosinic polycytidylic acid, PolyI:C): available from Shanghai Hefeng Pharmaceutical Co., Ltd., article No. is poly I:poly C: the accurate word H20003599 of traditional Chinese medicines.Grass carp kidney cell line (GIK): Chinese typical culture collection center, numbering GDC081.Infectious hematopoietic necrosis's poison (Infectious Hematopoietic Necrosis Virus, IHNV) (ATCC numbers VR-1392, and the strain name is called WRAC).
Grass carp hemorrhage virus (GCHV) (Grass Carp Hemorrhage Virus, GCHV): the public can obtain from Institute of Microorganism, Academia Sinica; (reference: GCHV 837 strains, Ke Lihua, Fang Qin, Cai Yiquan, the feature [J] of the grass carp hemorrhage virus (GCHV) isolate that a strain is new.The hydrobiont journal, 1990,14 (2): 153-159).
The 2*YT nutrient solution is made up of solute and water, and solute and concentration thereof are as follows: peptone 16g/L, yeast powder 10g/L, sodium-chlor 5g/L.
Fermention medium is made up of solute and water, and solute and concentration thereof are as follows: peptone 5 grams per liters, yeast powder 5 grams per liters, KH
2PO
42 grams per liters, K
2HPO
44 grams per liters, Na
2HPO
412H
2O 7 grams per liters, (NH
4)
2SO
41.2 grams per liter, NH
4Cl 0.2 grams per liter, MnSO
45H
2O 0.001 grams per liter, CoCl
26H
2O 0.004 grams per liter, Na
2MoO
42H
2O0.002 grams per liter, ZnCl
20.002 grams per liter, CuSO
45H
2O 0.001 grams per liter, H
3BO
40.005 grams per liter, FeSO
47H
2O 0.02 grams per liter, CaCl2H
2O 0.02 grams per liter, MgSO
47H
2O 0.3 grams per liter, defoamer 0.2 grams per liter.
Supplemented medium is made up of solute and water, and solute and concentration thereof are as follows: glycerine 150mL/L, peptone 30g/L, yeast powder 30g/L, MgSO
47H
2O 5.5mg/L.
The PBS pH of buffer is 8.0, is made up of solute and water, and solute and concentration thereof are as follows: NaCl 137mmol/L, KCl 2.7mmol/L, Na
2HPO
44.3mmol/L, KH
2PO
41.4mmol/L.
2 * Loading Buffer is made up of solute and water, and solute and concentration thereof are as follows: 100mM Tris-HCl (pH6.8), 4%SDS, 0.2% tetrabromophenol sulfonphthalein, 20% glycerine.
The sex change pH of buffer is 8.5, is made up of solute and water, and solute and concentration thereof are as follows: 6mol/L Guanidinium hydrochloride, 2mmol/L EDTA, 50mmol/L TrisCl, 10mmol/L DTT.
Renaturation buffer pH is 8.0, is made up of solute and water, and solute and concentration thereof are as follows: 0.5mol/L L-arginine (L-arg), 2mmol/L EDTA, 20% (volumn concentration) glycerine, 0.9mmol/L Sleep-promoting factor B (GSSG), 0.1mol/L TrisCl.
Embodiment 1, the grass carp alpha-IFN gene of optimizing and the synthetic of crt gene
One, the synthetic of the grass carp alpha-IFN gene of You Huaing (GcIFN-α-1 gene)
According to the merger of codon with to the preference type of intestinal bacteria to amino acid code, with reference to the grass carp alpha-IFN gene sequence D Q357216 that has delivered among the Genebank, design contains the encoding gene of the grass carp interferon-alpha of intestinal bacteria hobby codon, shown in the sequence 2 of sequence table, this optimization back gene neither changes grass carp interferon-alpha aminoacid sequence again for containing the gene order of codon that intestinal bacteria are liked.With DNA called after GcIFN-α-1 gene (totally 480 Nucleotide) shown in the sequence 2 of sequence table.
GcIFN-α-1 gene that is used as template among the embodiment 2,3 and 4 is synthetic by Shanghai biotechnology company limited.
Two, the synthetic of crt gene (GcIFN-α-2 gene)
Crt gene is the grass carp alpha-IFN gene of having delivered among the Genebank, as GENBANK ACCESSION NO.DQ357216 from shown in 5 ' the terminal 101-577 position Nucleotide, before 5 ' terminal the 101st Nucleotide, add initiator codon ATG at GENBANK ACCESSION NO.DQ357216, shown in the sequence 2 of sequence table.With DNA called after GcIFN-α-2 gene (totally 480 Nucleotide) shown in the sequence 3 of sequence table.
GcIFN-α-2 gene that is used as template among the embodiment 2,3 and 4 is synthetic by Shanghai biotechnology company limited.
Three, the sequence alignment of GcIFN-α-1 gene and GcIFN-α-2 gene
The sequence alignment of GcIFN-α-1 gene and GcIFN-α-2 gene is seen Fig. 1, grass carp (Ctenopharyngodon idellus) Interferon, rabbit shown in the sequence 1 of the equal code sequence tabulation of GcIFN-α-1 gene and GcIFN-α-2 gene.
Structure and the expression of gene of embodiment 2, recombinant plasmid and reorganization bacterium
One, contains the recombinant plasmid of GcIFN α-1 gene and the structure of engineering bacteria
1, with GcIFN α-1 gene as template, the primer of forming with F1 and R1 obtains pcr amplification product to carrying out pcr amplification.
F1:5 '-CGC
GAATTCATGTGCGAATGGCTG-3 ' (the line part is the EcoRI restriction enzyme site);
R1:5 '-CGC
CTCGAGTTAACGACGGTTAGC-3 ' (the line part is the BamHI restriction enzyme site).
The electrophorogram of pcr amplification product is shown in the swimming lane L2 of Fig. 2.
2, with restriction enzyme BamHI and EcoRI double digestion pcr amplification product, obtain enzyme and cut product.
3, (prokaryotic expression carrier available from Shanghai Jierui Biology Engineering Co., Ltd, GV0302), reclaims carrier framework to use restriction enzyme BamHI and EcoRI double digestion carrier pBV220.
4, the carrier framework of the enzyme of step 2 being cut product and step 3 is connected, and obtains connecting product.
5, will connect product transformed into escherichia coli DH5 α (available from Beijing health is the century bio tech ltd, and catalog number is CW0808) competence, picking list bacterium colony carries out bacterium colony PCR and enzyme is cut evaluation.The used primer of bacterium colony PCR is that the primer of F1 and R1 composition is right, obtains the positive bacterium colony of bacterium colony of 480bp left and right sides DNA.Enzyme is cut and is identified that used enzyme is restriction enzyme BamHI and EcoRI, obtains the positive bacterium colony of bacterium colony of 480bp left and right sides DNA.
Bacterium colony PCR and enzyme are cut and are identified that being the male bacterium colony is reorganization bacterium (engineering bacteria).The host bacterium of reorganization bacterium is a bacillus coli DH 5 alpha, contains recombinant plasmid GcIFN-α/pBV220.The recombinant plasmid that recombinant plasmid GcIFN-α/pBV220 obtains for the GcIFN α-1 gene gene shown in the sequence 2 of insertion sequence table between the BamHI of pBV220 carrier and EcoRI restriction enzyme site.
With a strain engineering bacteria called after DH5 α/pBV220-GCIFN α, this reorganization bacterium is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on August 23rd, 2010 and (is called for short CGMCC, the address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City), preserving number is CGMCC No.4111.
Engineering bacteria DH5 α/pBV220-GCIFN α is carried out 30 ℃, and (to bacterium liquid OD600=1) cultivated in 200 rev/mins of (rotation radius is 13mm) joltings, induces under 42 ℃ 6 hours then.Get 1 milliliter of nutrient solution before and after inducing respectively in the EP pipe, centrifugal 10 minutes of 5000g abandons supernatant, adds 50uL PBS damping fluid and 50uL 2 * Loading Buffer, boils 10 minutes cracking thalline, goes up sample 10uL then and carries out the SDS-PAGE electrophoresis detection.Electrophoresis detection result is (swimming lane L3 is for before inducing, and swimming lane L4 is for inducing the back) as shown in Figure 3, and the thalline of inducing the back to collect locates to occur a protein band about 19kD, conforms to the expection size.Reclaim this band protein carry out N end order-checking, 5 amino acid of N end are respectively Cys-Glu-Trp-Leu-Gly, show that this albumen is GcIFN-α albumen really, GcIFN α-1 gene is correctly expressed in intestinal bacteria.
The Interferon, rabbit product of determining engineering bacteria DH5 α/pBV220-GCIFN alpha expression through the shallow layer gel scanner in whole bacterial protein proportion greater than 65%.
Two, contain the recombinant plasmid of crt gene and the structure of engineering bacteria
1, with GcIFN α-2 gene as template, the primer of forming with F2 and R2 obtains pcr amplification product to carrying out pcr amplification.
F25 ' CGC
GAATTCATGTGCGAATGGCTC (the line part is the EcoRI restriction enzyme site);
R25 ' CGC
CTCGAGTTATCGTCTGTTGGC 3 ' (the line part is the BamHI restriction enzyme site).
The electrophorogram of pcr amplification product is shown in the swimming lane L3 of Fig. 2.
Step 2 is to 4 with 2 to 4 of step 1.
5, will connect product transformed into escherichia coli DH5 α competence, picking list bacterium colony carries out bacterium colony PCR and enzyme is cut evaluation.The used primer of bacterium colony PCR is that the primer of F2 and R2 composition is right, obtains the positive bacterium colony of bacterium colony of 480bp left and right sides DNA.Enzyme is cut and is identified that used enzyme is restriction enzyme BamHI and EcoRI, obtains the positive bacterium colony of bacterium colony of 480bp left and right sides DNA.
Bacterium colony PCR and enzyme are cut and are identified that being the male bacterium colony is contrast reorganization bacterium (contrast bacterium).The host bacterium of contrast bacterium is a bacillus coli DH 5 alpha, contains plasmid pBV220.
To contrast the reorganization bacterium and carry out 30 ℃, (to bacterium liquid OD600=1) cultivated in 200 rev/mins of (rotation radius is 13mm) joltings, induces under 42 ℃ 6 hours then.Get 1 milliliter of nutrient solution before and after inducing respectively in the EP pipe, centrifugal 10 minutes of 5000g abandons supernatant, adds 50uL PBS damping fluid and 50uL 2 * Loading Buffer, boils 10 minutes cracking thalline, goes up sample 10uL then and carries out the SDS-PAGE electrophoresis detection.Electrophoresis detection result is (swimming lane L1 is for before inducing, and swimming lane L2 is for inducing the back) as shown in Figure 3, and the thalline of inducing the back to collect locates to occur a protein band about 19kD, conforms to the expection size.Reclaim this band protein carry out N end order-checking, 5 amino acid of N end are respectively Cys-Glu-Trp-Leu-Gly, show that this albumen is GcIFN-α albumen really, GcIFN α-2 gene is correctly expressed in intestinal bacteria.
Determine that through the shallow layer gel scanner Interferon, rabbit product proportion in whole bacterial protein that the contrast bacterium expresses is about 40%, the ratio of the shared bacterial protein of Interferon, rabbit in the described reorganization of the step 1 bacterium.
Three, GcIFN α-1 gene and GcIFN α-2 expression of gene
Fermentation engineering bacterium DH5 α-GcIFN-α/pBV220 and contrast bacterium produce the grass carp interferon-alpha respectively, and concrete steps are as follows:
1, seed preparation
Engineering bacteria (or contrast bacterium) bacterium liquid is inoculated in 20ml LB liquid nutrient medium (containing 100 μ g/ml penbritins), and inoculum size is 1% (volumn concentration), 30 ℃, 200rmp shaking culture 8-10h; Be warming up to 42 ℃ of inducing culture 4h then, draw dull and stereotyped picking 5-10 single bacterium shake-flask culture (to OD600 ≈ 0.5) in LB liquid nutrient medium (containing 100 μ g/ml penbritins); Get bacterium liquid, every 750ul bacterium liquid adds 250ul 50% (volumn concentration) aqueous glycerin solution, is seed, and-20 ℃ of preservations are standby.
2, fermentation seed liquid preparation
The seed of step 1 preparation is inoculated in the 200ml 2*YT nutrient solution, and inoculum size is 0.05% (volumn concentration), and 30 ℃, 220rpm are cultivated 10-12h, and the bacterium liquid that obtains is fermentation seed liquid.
3, fermentative production grass carp interferon-alpha
Behind the fermention medium high-temperature sterilization, every liter of substratum adds the penbritin of 1mL 100mg/ml, the fermentation seed liquid of inoculation step 2 then, inoculum size is 5-10% (volumn concentration), 35 ℃ of aeration-agitations were cultivated 4 hours, be cooled to 30 ℃ after 4 hours and continue to cultivate 2-3 hour, be warming up to 42 ℃ then and continue to cultivate 6 hours, obtain fermented liquid; In the culturing process along with the growth of bacterial strain, sugar in the substratum (glycerine) consumes gradually, not regrowth of thalline after carbon source runs out of, dissolved oxygen gos up (rising about 30%), beginning flow feeding substratum, and flow acceleration (is set DO=30% by dissolved oxygen control, when adding pump greater than 30% stream, DO opens fed-batch medium, DO progressively descends, and closes with the dirty pump that adds when DO drops to 30%), approximately per hour stream adds the 26-35ml substratum; Keep pH value 7.2 with the 3M NaOH aqueous solution and 10% phosphate aqueous solution in the culturing process.
4, the purifying of grass carp interferon-alpha
Get the fermented liquid that 5L step 3 obtains, 5000g collected thalline in centrifugal 10 minutes, and the washing of PBS damping fluid uses the PBS damping fluid resuspended then; Ultrasonic (Φ 10 probes, ultrasonic 7 seconds 5 seconds at interval) 30 minutes make the thalline broken wall, 10000g, 4 ℃ of centrifugal 10 minutes collecting precipitations; PBS damping fluid washing precipitation (inclusion body), then with sex change damping fluid dissolving inclusion body, 10000g, 4 ℃ of centrifugal 10 minutes collections supernatant, i.e. metaprotein solution; Metaprotein solution is slowly added in the renaturation buffer, and 4 ℃ left standstill 48 hours, and 10000g, 4 ℃ of centrifugal 20 minutes collection supernatants are the solution that contains the grass carp interferon-alpha.
The solution that will contain the grass carp interferon-alpha is 6.5 with the vinegar acid for adjusting pH value, carries out cation-exchange chromatography.The cation-exchange chromatography post adopts HiLoad 26/10 SP Sepharose High Performance (internal diameter 26mm, height of bed 100mm, GE LifeScience); Sample adds in the chromatography column with 1ml/ minute speed, with lavation buffer solution first (0.1mol/L TrisCl, 50mM NaCl, pH 6.5) with 5 column volumes of speed flushing of 5ml/ minute, with lavation buffer solution second (pH 6.5 for 0.1mol/L TrisCl, 500mM NaCl) with 3 column volumes of 5ml/ minute speed wash-out, is that 280nm detects the wash-out target protein with Ultraviolet Detector at wavelength, collects ultraviolet absorption value greater than 200 elutriant.
The elutriant of collecting is carried out filtration sterilization with filter membrane (0.22um), and the solution that obtains is grass carp interferon-alpha solution.Grass carp interferon-alpha solution called after GcIFN α-1 solution that the fermentation engineering bacterium is obtained (batch 2008001), grass carp interferon-alpha solution called after GcIFN α-2 solution that fermentation contrast bacterium is obtained (batch 2008001).
GcIFN α-1 solution and GcIFN α-2 solution are carried out the SDS-PAGE electrophoresis detection.Detected result is (swimming lane M is low molecular weight protein (LMWP) Marker, and swimming lane L1 is GcIFN α-1 a solution purification product, and swimming lane L2 is GcIFN α-2 a solution purification product) as shown in Figure 4.The result shows that a protein band all appears in GcIFN α-1 solution and GcIFN α-2 solution in the 19kD vicinity, conform to expected results.
Four, the GcIFN-α protein content of GcIFN α-1 solution and GcIFN α-2 solution relatively
Solution to be measured is GcIFN α-1 solution that obtains of step 3 (batch 2008001) or GcIFN α-2 solution (batch 2008001).
(available from Beijing health is the century bio tech ltd to get BCA protein quantification test kit by 50: 1 volume ratio, article No.: solution A and solution B CW0014) are mixed into working fluid, and with BSA standard substance gradient dilution to 500mg/ml, 400mg/ml, 300mg/ml, 200mg/ml, 100mg/ml, 50mg/ml, 25mg/ml gets the standard substance or the solution to be measured 20 μ l of each concentration, and the working fluid that adds 200 μ l mixes, seal 37 ℃ with preservative film and hatch 30min, read OD with microplate reader after returning to room temperature
565Light absorption value.According to standard substance concentration and light absorption value drawing standard curve, again according to the protein concentration in the typical curve calculating testing protein sample.
The protein concentration of GcIFN α-1 solution (batch 2008001) is 3mg/ml, and the protein concentration of GcIFN α-2 solution (batch 2008001) is 1.9mg/ml.The result shows that GcIFN α-1 expression of gene ability provided by the invention is higher than existing GcIFN α-2 gene far away.
Embodiment 3, GcIFN α-1 gene and GcIFN α-2 expression of gene
One, contains the recombinant plasmid of GcIFN α-1 gene and the structure of engineering bacteria
1, with GcIFN α-1 gene as template, the primer of forming with F1 and R1 obtains pcr amplification product to carrying out pcr amplification.
F1 5 ' CGC
GAATTCATGTGCGAATGGCTG 3 ' (the line part is the EcoRI restriction enzyme site);
R1 5 ' CGC
CTCGAGTTAACGACGGTTAGC 3 ' (the line part is the BamHI restriction enzyme site).
2, with restriction enzyme BamHI and EcoRI double digestion pcr amplification product, obtain enzyme and cut product.
3, (prokaryotic expression carrier available from Shanghai Jierui Biology Engineering Co., Ltd, GV0302), reclaims carrier framework to use restriction enzyme BamHI and EcoRI double digestion carrier pBV220.
4, the carrier framework of the enzyme of step 2 being cut product and step 3 is connected, and obtains connecting product.
5, will connect product transformed into escherichia coli DH5 α (available from Beijing health is the century bio tech ltd, and catalog number is CW0808) competence, picking list bacterium colony carries out bacterium colony PCR and enzyme is cut evaluation.The used primer of bacterium colony PCR is that the primer of F1 and R1 composition is right, obtains the positive bacterium colony of bacterium colony of 480bp left and right sides DNA.Enzyme is cut and is identified that used enzyme is restriction enzyme BamHI and EcoRI, obtains the positive bacterium colony of bacterium colony of 480bp left and right sides DNA.
Bacterium colony PCR and enzyme are cut and are identified that being the male bacterium colony is reorganization bacterium (engineering bacteria).The host bacterium of reorganization bacterium is a bacillus coli DH 5 alpha, contains recombinant plasmid GcIFN-α/pBV220.The recombinant plasmid that recombinant plasmid GcIFN-α/pBV220 obtains for the GcIFN α-1 gene gene shown in the sequence 2 of insertion sequence table between the BamHI of pBV220 carrier and EcoRI restriction enzyme site.
Two, contain the recombinant plasmid of crt gene and the structure of engineering bacteria
1, with GcIFN α-2 gene as template, the primer of forming with F2 and R2 obtains pcr amplification product to carrying out pcr amplification.
F2 5 ' CGC
GAATTCATGTGCGAATGGCTC (the line part is the EcoRI restriction enzyme site);
R2 5 ' CGC
CTCGAGTTATCGTCTGTTGGC 3 ' (the line part is the BamHI restriction enzyme site).
Step 2 is to 4 with 2 to 4 of step 1.
5, will connect product transformed into escherichia coli DH5 α competence, picking list bacterium colony carries out bacterium colony PCR and enzyme is cut evaluation.The used primer of bacterium colony PCR is that the primer of F2 and R2 composition is right, obtains the positive bacterium colony of bacterium colony of 480bp left and right sides DNA.Enzyme is cut and is identified that used enzyme is restriction enzyme BamHI and EcoRI, obtains the positive bacterium colony of bacterium colony of 480bp left and right sides DNA.
Bacterium colony PCR and enzyme are cut and are identified that being the male bacterium colony is reorganization bacterium (contrast bacterium).The host bacterium of contrast bacterium is a bacillus coli DH 5 alpha, contains plasmid pBV220.
Three, GcIFN α-1 gene and GcIFN α-2 expression of gene
Fermentation engineering bacterium and contrast bacterium produce the grass carp interferon-alpha respectively, and concrete steps are with the step 3 of embodiment 2.
Grass carp interferon-alpha solution called after GcIFN α-1 solution that the fermentation engineering bacterium is obtained (batch 2008002), grass carp interferon-alpha solution called after GcIFN α-2 solution that fermentation contrast bacterium is obtained (batch 2008002).
Four, the GcIFN-α protein content of GcIFN α-1 solution and GcIFN α-2 solution relatively
Solution to be measured is GcIFN α-1 solution that obtains of step 3 (batch 2008002) or GcIFN α-2 solution (batch 2008002).Detection method is with the step 4 of embodiment 2.
The protein concentration of GcIFN α-1 solution (batch 2008002) is 2.8mg/ml, and the protein concentration of GcIFN α-2 solution (batch 2008002) is 1.75mg/ml.The result shows that GcIFN α-1 expression of gene ability provided by the invention is higher than existing GcIFN α-2 gene far away.
Embodiment 4, GcIFN α-1 gene and GcIFN α-2 expression of gene
One, contains the recombinant plasmid of GcIFN α-1 gene and the structure of engineering bacteria
Step 1 with embodiment 3.
Bacterium colony PCR and enzyme are cut and are identified that being the male bacterium colony is reorganization bacterium (engineering bacteria).The host bacterium of reorganization bacterium is a bacillus coli DH 5 alpha, contains recombinant plasmid GcIFN-α/pBV220.The recombinant plasmid that recombinant plasmid GcIFN-α/pBV220 obtains for the GcIFN α-1 gene gene shown in the sequence 2 of insertion sequence table between the BamHI of pBV220 carrier and EcoRI restriction enzyme site.
Two, contain the recombinant plasmid of crt gene and the structure of engineering bacteria
Step 2 with embodiment 3.
Bacterium colony PCR and enzyme are cut and are identified that being the male bacterium colony is reorganization bacterium (contrast bacterium).The host bacterium of contrast bacterium is a bacillus coli DH 5 alpha, contains plasmid pBV220.
Three, GcIFN α-1 gene and GcIFN α-2 expression of gene
Fermentation engineering bacterium and contrast bacterium produce the grass carp interferon-alpha respectively, and concrete steps are with the step 3 of embodiment 2.
Grass carp interferon-alpha solution called after GcIFN α-1 solution that the fermentation engineering bacterium is obtained (batch 2008003), grass carp interferon-alpha solution called after GcIFN α-2 solution that fermentation contrast bacterium is obtained (batch 2008003).
Four, the GcIFN-α protein content of GcIFN α-1 solution and GcIFN α-2 solution relatively
Solution to be measured is GcIFN α-1 solution that obtains of step 3 (batch 2008003) or GcIFN α-2 solution (batch 2008003).Detection method is with the step 4 of embodiment 2.
The protein concentration of GcIFN α-1 solution (batch 2008003) is 3.5mg/ml, and the protein concentration of GcIFN α-2 solution (batch 2008003) is 2.25mg/ml.The result shows that GcIFN α-1 expression of gene ability provided by the invention is higher than existing GcIFN α-2 gene far away.
The Determination of biological activity of embodiment 5, grass carp interferon-alpha
Three batches GcIFN α-1 solution with embodiment 2 to embodiment 4 preparations is divided into two groups respectively respectively: first group: 4 ℃ of-8 ℃ of preservations, respectively at 6 months, 12 months, 18 months and 24 months sampling detection interferon activities; Second group: 25 ℃ of preservations, respectively at 1 month, 3 months and 6 months sampling detection interferon activities; Carry out the Determination of biological activity of interferon-alpha then respectively.Measuring method suppresses method with reference to three appendix X of the Pharmacopoeia of the People's Republic of China in 2005 C cytoactive; with grass carp kidney cell line (GIK) (Chinese typical culture collection center; numbering GDC081)-infectious hematopoietic necrosis's poison (Infectious Hematopoietic Necrosis Virus; IHNV) system; adopt CPE (cell cause a disease change effect) to suppress the inhibition micromethod for the basis, examining the dilution inverse that the high dilution of product still can protect half cell (50%) to avoid virus attack with every milliliter of Interferon, rabbit is Interferon, rabbit unit.
The interferon activity detection method is specific as follows:
1, cell preparation
Get well-grown GIK cell, the digestion back prepares cell suspension with the DMEM that contains 10%FBS; Pair cell is counted, and adjusting cell concn is 5 * 10
5The suspension of individual/mL joins in (100 μ l/ hole) on the 96 porocyte culture plates 37 ℃, 5%CO then
2Cultivating 8-10h makes it become monolayer cell.
2, add Interferon, rabbit and handle cell
It is 0.001mg/ml that GcIFN α-1 solution is diluted to final concentration in advance with the DMEM that contains 10%FBS, as mother liquor, mother liquor is carried out 4 times of gradient dilutions again, dilutes 6 gradients, obtains various diluents.
3, with the nutrient solution sucking-off in the every hole of the Tissue Culture Plate of step 1; 6 holes in the Tissue Culture Plate (3 positive control holes, 3 negative control holes) add the cell culture fluid in 100 μ l/ holes, and all the other holes add the diluent (100 μ l/ holes, three repetitions of each gradient) of step 2 respectively; 37 ℃, 5%CO
2Cultivate 12-15h.
4, virus infection
Get IHNV virus, being diluted to final concentration with serum-free DMEM is 1000TCID
50The viral dilution liquid of/ml; Every hole, positive control hole adds 100 μ, 1 viral dilution liquid, and the every hole of negative control hole adds 100 μ l serum-free DMEM nutrient solutions, and all the other every holes, each hole add 100 μ l viral dilution liquid; Cultivate 24h.
5, violet staining
Abandon cell culture fluid, add violet staining liquid 100 μ l in every hole, room temperature is placed 30min.
6, decolouring
Abandon dyestuff, and wash not illuminating colour with tap water or distilled water, add destainer 100 μ l then in every hole, room temperature is placed 10min.
7, utilize microplate reader to measure OD
570Value and record.
8, data processing
Be defined as an activity unit can suppress 50% cytopathic Interferon, rabbit content, utilization Reed-Muench method is calculated Interferon, rabbit and is tired, and can suppress 50% cytopathic extension rate, the results are shown in Table 1.
Table 1 utilization Reed-Muench method is calculated Interferon, rabbit and is tired
X: the OD of negative control (virus-free contrast)
570Mean value;
Y: the OD of positive control (virus control)
570Mean value.
Calculate every value according to last table, calculate Interferon, rabbit tire (suppose in the aforementioned calculation G4 item calculated value greater than 0.5, and G5 item calculated value being less than 0.5) according to the G item according to following formula at last:
Interferon, rabbit to be detected (U/0.001mg)=in advance extension rate * 4 of tiring
(4+ (G4-0.5)/(G4-G5))
The Interferon, rabbit detected result of tiring sees Table 2.
The table 2 Interferon, rabbit detected result of tiring
The result shows: adopt the solution of method preparation of the present invention to deposit 24 months at 4 ℃-8 ℃, deposited 3 months for 25 ℃, biological activity does not have considerable change.
The disease-resistant test of embodiment 6, grass carp interferon-alpha (GcIFN-α albumen)
One, grass carp interferon-alpha (GcIFN-α albumen) is to the disease-resistant test of hemorrhagic disease of grass carp
About the long 340mm of grass carp average body, about mean body weight 750g, raise 23-27 ℃ of water temperature.Be divided into 5 groups, every group 100 tail, carry out following processing (volume of every group of injection grass carp interferon-alpha is all identical, and the volume of every group of injection grass carp hemorrhage virus (GCHV) is all identical) respectively:
First group: GcIFN α-1 solution of abdominal injection embodiment 2 preparation (batch 2008001), 10000U/ tail; After 24 hours, dorsal fin subcutaneous injection grass carp hemorrhage virus (GCHV) (GCHV), 500TCID
50/ tail; Raised for 2 weeks, observe day by day;
Second group: dorsal fin subcutaneous injection grass carp hemorrhage virus (GCHV) (GCHV), 100TCID
50/ tail; GcIFN α-1 solution of abdominal injection embodiment 2 preparations at once (batch 2008001), the 10000U/ tail; Raised for 2 weeks, observe day by day;
The 3rd group: dorsal fin subcutaneous injection grass carp hemorrhage virus (GCHV) (GCHV), 100TCID
50/ tail; After 24 hours, GcIFN α-1 solution of abdominal injection embodiment 2 preparation (batch 2008001), 10000U/ tail; Raised for 2 weeks, observe day by day;
The 4th group: dorsal fin subcutaneous injection grass carp hemorrhage virus (GCHV) (GCHV), 100TCID
50/ tail; Raised for 2 weeks, observe day by day;
The 5th group: dorsal fin subcutaneous injection PBS damping fluid; Raised for 2 weeks, observe day by day.
The result is as shown in table 3, and the administration of GcIFN α-1 injection of solution has tangible antiviral effect, and the survival rate of administration group exceeds 64% than control group (the 4th group), and immune protective rate reaches 72.3%.
Table 3 injection GcIFN is to the disease-resistant test-results of hemorrhagic disease of grass carp
Fish (tail) | Death toll (tail) | Survival number (tail) | Survival rate (%) | Protection (%) | |
|
100 | 25 | 75 | 75 | 75 |
|
100 | 28 | 72 | 72 | 72 |
The |
100 | 30 | 70 | 70 | 70 |
The |
100 | 100 | 0 | 0 | 0 |
The |
100 | 0 | 100 | 100 | -- |
Two, grass carp interferon-alpha (GcIFN-α albumen) is to improving the test of prawn resistibility
Chinese prawn is divided into six groups, every group 1000 tail, and three groups is experimental group, three groups is control group, carries out following processing respectively:
The dosage of GcIFN α-1 solution of experimental group: embodiment 2 preparation (batch 2008001) is 3,000,000 activity units/1000 tails, and processing mode is for soaking 3 hours;
Control group: be left intact.
The normal raising one month, statistics natural occurrence mortality ratio is calculated immune protective rate (RPS).
The result is as shown in table 4.Compare with control group, the experimental group surviving rate obviously improves, and immune protective rate reaches 34.6%, shows that GcIFN α-1 solution has Chinese prawn to improve the immune disease-resistance ability preferably.
Table 4 soaks GcIFN to improving the test-results of Chinese prawn resistibility
Claims (10)
1. the DNA shown in the sequence 2 of sequence table.
2. the recombinant vectors, reorganization bacterium, expression cassette or the transgenic cell line that contain the DNA shown in the sequence 2 of ordered list.
3. recombinant vectors as claimed in claim 2 is characterized in that: the recombinant plasmid that described recombinant vectors obtains for the multiple clone site of the DNA shown in the sequence 2 of sequence table being inserted pBV220; Described recombinant vectors is preferably the recombinant plasmid that obtains between the BamHI of the insertion of the DNA shown in the sequence 2 of sequence table pBV220 and EcoRI site.
4. reorganization bacterium as claimed in claim 2 is characterized in that: described reorganization bacterium is that the DNA shown in the sequence 2 of sequence table is imported the reorganization bacterium that bacillus coli DH 5 alpha obtains; Described reorganization bacterium is preferably the described recombinant vectors of claim 3 is imported the reorganization bacterium that bacillus coli DH 5 alpha obtains; Described reorganization bacterium most preferably is colon bacillus (Escherichia coli) DH5 α/pBV220-GCIFN α, and its deposit number is CGMCC No.4111.
5. a method for preparing interferon-alpha is with claim 2 or 4 described reorganization bacterium, induces 4~8 hours for 40~43 ℃, induced 6 hours for preferred 42 ℃, broken then thalline is collected inclusion body, washing inclusion body, dissolves inclusion body and with its renaturation, is obtained containing the solution of interferon-alpha.
6. method as claimed in claim 5 is characterized in that: described method also comprises the step of the described solution that contains interferon-alpha being carried out protein purification;
The method of described protein purification is as follows: is 5.5-9.5 with the described solution that contains interferon-alpha with the vinegar acid for adjusting pH value, adopt HiLoad 26/10 SP Sepharose High Performance to carry out cation-exchange chromatography, with 5 column volumes of lavation buffer solution first flushing, use 1-10 column volume of lavation buffer solution second wash-out then, collect ultraviolet absorption value under the 280nm illumination greater than 200 elutriant, the solution that obtains is interferon-alpha solution; The pH of described lavation buffer solution first is 5.5-9.5, is made up of TrisCl, NaCl and water, and TrisCl concentration is 0.1mol/L, and NaCl concentration is 0-150mM; The pH of described lavation buffer solution second is 5.5-9.5, is made up of TrisCl, NaCl and water, and TrisCl concentration is 0.1mol/L, and NaCl concentration is 150-2000mM.
7. the interferon-alpha solution for preparing of claim 5 or 6 described methods.
8. arbitrary described recombinant vectors, reorganization bacterium, expression cassette or transgenic cell tie up to the application for preparing in the interferon-alpha in described DNA of claim 1 or the claim 2 to 4.
9. arbitrary described recombinant vectors, reorganization bacterium, expression cassette or transgenic cell tie up to the application for preparing in the viral inhibitors in described DNA of claim 1 or the claim 2 to 4; Described virus is infectious hematopoietic necrosis's poison and/or grass carp hemorrhage virus (GCHV); Described metachromia hematopoietic necrosis virus is specially the WRAC strain.
Arbitrary described recombinant vectors in described DNA of claim 1 or the claim 2 to 4, reorganization bacterium, expression cassette or transgenic cell tie up to be prepared as follows (a) and/or (b) in application;
(a) treat and/or prevent the preparation of fish disease viral disease;
(b) preparation of raising shrimp survival rate;
Described fish disease viral disease is specially hemorrhagic disease of grass carp; Described shrimp is specially Chinese prawn.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010549303 CN102021175B (en) | 2010-11-18 | 2010-11-18 | Optimized grass carp alpha interferon encoding gene and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010549303 CN102021175B (en) | 2010-11-18 | 2010-11-18 | Optimized grass carp alpha interferon encoding gene and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102021175A true CN102021175A (en) | 2011-04-20 |
CN102021175B CN102021175B (en) | 2012-12-19 |
Family
ID=43862957
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201010549303 Active CN102021175B (en) | 2010-11-18 | 2010-11-18 | Optimized grass carp alpha interferon encoding gene and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102021175B (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102268438A (en) * | 2011-05-17 | 2011-12-07 | 上海海洋大学 | Grass carp matrix metalloproteinase inhibitor-2 gene, recombinant protein coded by same, and construction method and application of temporal and spatial expression pattern thereof |
CN105018512A (en) * | 2015-08-18 | 2015-11-04 | 浙江省淡水水产研究所 | Prokaryotic expression recombinant plasmid pET-IFN gamma, interferon and application |
CN105087623A (en) * | 2015-08-18 | 2015-11-25 | 浙江省淡水水产研究所 | Prokaryotic expression recombinant plasmid pET-IFNalpha, sodium-alginate-coated interferon and application thereof |
CN105200082A (en) * | 2015-08-18 | 2015-12-30 | 浙江省淡水水产研究所 | Eukaryotic expression plasmid pEGFP-IFNalpha wrapped with lipidosome and application |
CN108752457A (en) * | 2018-05-23 | 2018-11-06 | 华中农业大学 | A kind of derived peptides and its application from grass carp interferon |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1974775A (en) * | 2006-12-08 | 2007-06-06 | 浙江大学 | Recombinant plasmid and engineering bacterium containing grass carp interferon gene and their application |
-
2010
- 2010-11-18 CN CN 201010549303 patent/CN102021175B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1974775A (en) * | 2006-12-08 | 2007-06-06 | 浙江大学 | Recombinant plasmid and engineering bacterium containing grass carp interferon gene and their application |
Non-Patent Citations (6)
Title |
---|
《Fish & Shellfish immunology》 20031231 Yi-bing Zhang et al. Molecular cloning and characterization of crucian carp (Carassius auratus L.) interferon regulatory factor 7 453-466 1-10 第15卷, 2 * |
《GenBank》 20071030 Liu,W.J and Yang,L.M EU196760.1 全文 1-10 , 2 * |
《Gene》 20041231 Yi-Bing Zhang et al. Identification and expression analysis of two IFN-inducible genes in crucian carp (Carassius auratus L.) 43-51 1-10 第325卷, 2 * |
《中国优秀硕士学位论文全文数据库(基础科学辑)》 20050915 王莉 克隆与表达草鱼干扰素基因及其抗弹状病毒效果的研究 引言第7-8页、第三章材料与方法部分 1-10 , 第5期 2 * |
《水产学报》 20020228 邵建忠等 草鱼干扰素的分离纯化及某些理化和生物学特性 11-16 1-10 第24卷, 第1期 2 * |
《现代生物医学进展》 20091231 高昌等 斑马鱼干扰素gamma的克隆表达研究 2421-2423 1-10 第9卷, 第13期 2 * |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102268438A (en) * | 2011-05-17 | 2011-12-07 | 上海海洋大学 | Grass carp matrix metalloproteinase inhibitor-2 gene, recombinant protein coded by same, and construction method and application of temporal and spatial expression pattern thereof |
CN105018512A (en) * | 2015-08-18 | 2015-11-04 | 浙江省淡水水产研究所 | Prokaryotic expression recombinant plasmid pET-IFN gamma, interferon and application |
CN105087623A (en) * | 2015-08-18 | 2015-11-25 | 浙江省淡水水产研究所 | Prokaryotic expression recombinant plasmid pET-IFNalpha, sodium-alginate-coated interferon and application thereof |
CN105200082A (en) * | 2015-08-18 | 2015-12-30 | 浙江省淡水水产研究所 | Eukaryotic expression plasmid pEGFP-IFNalpha wrapped with lipidosome and application |
CN108752457A (en) * | 2018-05-23 | 2018-11-06 | 华中农业大学 | A kind of derived peptides and its application from grass carp interferon |
US10577404B2 (en) * | 2018-05-23 | 2020-03-03 | Huazhong Agricultural University | Polypeptide derivatives from grass carp interferon and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN102021175B (en) | 2012-12-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102021175B (en) | Optimized grass carp alpha interferon encoding gene and application thereof | |
CN107686832B (en) | Novel vibrio parahaemolyticus bacteriophage, and composition, preparation method and application thereof | |
CN100451034C (en) | Pig gamma interferon and encoding genes and use thereof | |
CN102399724B (en) | Haemophilus parasuis LC strain and application thereof | |
CN106947724B (en) | Method for increasing dissolved oxygen of gamma-polyglutamic acid fermentation liquor | |
CN106282216A (en) | A kind of preparation method of recombinant long-acting chicken interferon α | |
CN101381695B (en) | Riemerella anatipestifer blood serum 1 type genetic engineering attenuated strain and construction method thereof | |
CN112029696B (en) | Edwardsiella piscicola derived from turbot and application thereof | |
CN100484959C (en) | Modified recombinant porcine alpha interferon protein and coding gene and uses thereof | |
CN114807060B (en) | Coxsackie virus A6 type strain and immunogenic composition and application thereof | |
CN102796758A (en) | Recombinant porcine alpha interferon and application thereof in preparing medicines for treating Porcine cytomegalovirus (PCMV) | |
CN114774372A (en) | Coxsackie virus A10 type strain and vaccine and application thereof | |
CN102586311A (en) | Enterohemorrhage Escherichia coli (EHEC) O157:H7 multivalence fliC-hcpA-tir-eae recombinant strain and vaccine | |
CN102603885A (en) | Alexin and application thereof to preparation of antibacterial medicament | |
CN102139103A (en) | Preparation and application methods of photobacterium damsela vaccines of cynoglossus semilaevis | |
CN106047783B (en) | Kill sweetfish pseudomonad ExoU gene knockout mutant strain and its application | |
CN104004697B (en) | The production method of a kind of single-gene disappearance Rough Anti-Brucella and vaccine thereof | |
CN105039233A (en) | Brucella molecular marker vaccine strain for bovine species and application thereof | |
CN102533629B (en) | Preparation method of avian encephalomyelitis virus VP1 protein subunit vaccine | |
CN103275890A (en) | Vibrio anguillarum (listonella anguillarum) virulent strain and application thereof | |
CN102816815A (en) | Yeast fermentation production method of recombinant antibacterial peptide rCrustinI | |
CN104784684B (en) | A kind of fish gill-rot diseases cause of disease Yue Shi Flavobacteriums attenuated live vaccine and construction method | |
CN103933554B (en) | A kind of for preventing the interferon white oil compositions of Schweineseuche | |
CN102676421A (en) | Bordetella bronchiseptica gene deletion strain, vaccine prepared from Bordetella bronchiseptica gene deletion strain and application | |
CN105779370B (en) | It is a kind of for producing the specific peptide aptamer of fish septicaemia cause of disease Aeromonas veronii attenuated live vaccine |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |