CN102014626A - Steroidal ligands and their use in gene switch modulation - Google Patents

Abstract

The present invention relates to steroidal ligands for use in nuclear receptor-based inducible gene expression systems. The invention further relates to methods of modulating the expression of genes of interest with a system containing one or more nuclear receptor complexes and one or more steroidal ligands. Further aspects include ligand compositions including therapeutic compositions.

Description

Non-steroidal ligand and its application in gene switching regulation and control

Invention field

The present invention relates to the field of steroid chemical and gene controlled expression.More particularly it relates to the non-steroidal ligand of natural and mutation nuclear receptor, and their applications in the inducible gene expression system based on nuclear receptor.The invention further relates to the method using the goal of regulation and control gene expression in host cell of these parts and corresponding gene switching.The invention further relates to the composition containing one or more non-steroidal ligands and therapeutic combination.

Background of invention

All patents, patent application and the publication that the present invention is quoted integrally are all fully incorporated by reference herein.

Precise control gene expression is research, manipulates and control development and the valuable instrument of other physiology courses.Gene expression is related to a large amount of specific protein-protein interactions.DNA is transcribed into the activating transcription factor that RNA is related near the promoter of control genetic transcription.Generally, activating transcription factor is combined with a protein, and this protein has the DNA binding structural domains being combined with the site of gene promoter region.In order to produce gene expression, the albumen with DNA binding structural domains and transcriptional activation domain must be brought to the correct position of gene promoter region.

A kind of transgenic method drives the expression of transgenosis using cell type specific promoters.DNA constructions with transgenosis have been incorporated into host genome first, and when being transcribed activity factor triggering, the expression of transgenosis occurs in given cell type

Another method is by inducible promoter.Example includes the eukaryotic transcription activation system such as steroid hormone receptor system of PR-1a promoters, protokaryon repressor/operon system, immunosupress immunophilin system, and higher grade.

(Wurn etc., 1986, Proc.Natl.Acad.Sci.USA 83 are had been described based on the gene regulatory system by heat shock, interferon, the promoter of heavy metal induction：5414-5418；Arnheiter etc., 1990Cell 62：51-61；Filmus etc., 1992Nucleic Acids Research 20：27550-27560).However, because they are for the influence of the expression of non-target gene, these systems are leaky and have a limitation.

Protokaryon repressor/operon system is using bacterium repressor albumen and its unique operator DNA sequence dna combined.Tetracycline (" Tet ") and galactolipin (" Lac ") repressor/operon system from bacteria Escherichia coli have been used in plant and animal control the expression of gene.In Tet systems, tetracycline is attached to TetR repressor albumen, causes conformational change, and repressor albumen is discharged from operator, so that transcription occurs.In Lac systems, the presence to galactolipin or the analog of synthesis such as isopropyl ss-D- thiogalactosides produces response so that lac operators are activated.Using such system in plant and animal, the chemical instability of part (tetracycline and galactolipin), their toxicity, they naturally occurring are limited to, or induction or suppress to need of a relatively high level.

Immunosuppression molecule such as FK506, rapamycin and ciclosporin A can be incorporated into immunophilin FKBP12, cyclophilin on.Utilize this information, a kind of whole strategy taken any two albumen to together is devised, can be simply by FK506 be put into each in two albumen, or by the way that FK506 is placed on an albumen and ciclosporin A is put on another.It is then possible to which the compound (FKCsA) that homodimer (FK1012) or FK506- the cyclosporines fusion synthesized using FK506 is produced, induces dimerization (Spencer etc., 1993, Science 262 of these molecules：1019-24；Belshaw etc., 1996Proc Natl Acad Sci U SA93：4604-7).Using the Gal4DNA binding structural domains for being fused to FKBP12 and the VP16 activator domain for being fused to cyclophilin and FKCsA compounds, show as dimerization and activate the reporter gene under the control of the promoter with Gal4 binding sites.This system includes the immunodepressant that can have harmful side effect, limits the application in mammalian genes switch.

Transcriptional activation system such as steroid hormone receptor system has also been used.Steroid hormone receptor is the member of nuclear receptor superfamily and is present in vertebrate and spinal zooblast.

The growth of insect, cast off a skin and develop regulation and control (Dhadialla etc., 1998.Annu.Rev.Entomol.43 by cast off a skin sterol hormone (moulting hormone) and juvenile hormone：545-569).The molecular target of sterol of being casted off a skin in insect includes casting off a skin sterol acceptor (EcR) and super valve albumen (USP).EcR is a member of core steroid receptor superfamily, and the superfamily is characterised by significant DNA and ligand binding domains and an activation structure domain (Koelle etc. 1991, Cell, 67：59-77).EcR acceptors include commercially available tebufenozide to multiple steroids such as ponasterone A and meter Le sterones A and non-steroids and methoxyfenozide produces response (referring to PCT/EP96/00686 and US 5,530,028).

Insect molting sterol acceptor (EcR) and super valve albumen (USP, mammal RXR insect homologue) occur Heterodimerization, with reference to sterol of casting off a skin, with reference to sterol receptor dna response element of casting off a skin, and the transcription for sterol response gene of casting off a skin is activated.EcR/USP/ ligand complex plays a significant role in insect growth and reproductive process.EcR is a member of steroid hormone receptor superfamily and has 5 control domains, (DNA is combined by A/B (trans-activation), C, Heterodimerization), D (hinge, Heterodimerization), E (ligand binding, Heterodimerization and trans-activation) and F (trans-activation) domain.When being fused on other albumen, some of these domains, such as A/B, C and E remain their function.

The inducible gene expression system or " gene switching " strictly regulated and controled can be used for various applications, the extensive generation of such as gene therapy, albumen in cell, the test of the high flux screening based on cell, functional genome, and in genetically modified plants and animal characteristic regulation and control.

A kind of gene switching based on EcR uses Drosophila melanogaster EcR (DmEcR) and home mouse RXR (MmRXR), and show reporter gene (the Christopherson K.S in these receptor transactivation mammal cell lines and transgenic mice in the presence of steroids, ponasterone A, Mark M.R, Baja J.V, Godowski P.J.1992, Proc.Natl.Acad.Sci.U.S.A.89：6314-6318；No D, Yao T.P, Evans R.M, 1996, Proc.Natl.Acad.Sci.U.S.A.93：3346-3351).Later, Suhr etc. 1998, Proc.Natl.Acad.Sci.95：7999-8004 shows that tebufenozide passes through the reporter gene in silkworm EcR (BmEcR) trans-activation mammalian cell when lacking external source heterodimer companion.

The method that PCT/US97/05330 (WO 97/38117) and PCT/US99/08381 (WO99/58155) disclose regulating expression of foreign genes, wherein in the presence of part and alternatively can be in the presence of the acceptor as silence companion, the DNA constructions comprising foreign gene and sterol response element of casting off a skin be by a sterol receptor activation of casting off a skin.Cast off a skin what sterol acceptor was separated from Drosophila melanogaster.Generally, such system needs the presence of silence companion, for example Retinoid X Receptor (RXR), to provide optimal activation.In mammalian cell, insect molting sterol acceptor (EcR) and Retinoid X Receptor (RXR) Heterodimerization, and regulate and control in the way of ligand-dependent the expression of target gene.PCT/US98/14215 (WO99/02683) discloses the sterol acceptor of casting off a skin separated from silkworm silkworm moth and played a role in mammlian system, without external source dimer companion.

The various members that US 6,265,173B1 disclose various steroids/thyroid gland superfamily receptors can be combined with Drosophila melanogaster USP or its fragment with least one USP dimerization domain, for a gene expression system.US 5,880,333 discloses Drosophila melanogaster EcR and USP a heterodimer system being applied in plant, and wherein transactivation domain with DNA binding structural domains is located on two different hybrid proteins.These systems based on USP are composing type in zooblast, so being unable to the expression of Effective Regulation target gene.

At each occurrence, transactivation domain and DNA binding structural domains (can be such as the natural EcR in the PCT/US98/14215 or EcR such as the modification in PCT/US97/05330) are incorporated into individual molecule, and other heterodimers companion, USP or RXR, is used with their native state.

The shortcoming of the above-mentioned gene regulatory system based on EcR has considerable background vigor when being included in shortage part, and these systems are unable to plant and animal and are all suitable for (referring to US 5,880,333).

So, this area needs to improve the system based on EcR, and accuracy controlling is endogenous in plant and animal or expression of external source target gene.The system so improved can be used for following application, such as gene therapy, large-scale production albumen and antibody, high flux screening based on cell are tested, functional genome and in transgenic animals characteristic regulation and control.It is good and insensitive to steroids such as such as endogenous steroids to non-steroidal ligands response for some application such as gene therapies, it would be desirable to there is the gene expression system of an induction type.Therefore, simple, complicated and dependent on part improved system can be used for regulation and control biosystem, and the part is relatively cheap, be readily available and low to host toxicity.

Have shown that a kind of inducible gene expression system based on nuclear receptor, wherein they are separated from each other by the way that trans-activation and DNA binding structural domains are placed on two different albumen, so that background vigor when lacking part is substantially reduced, and vigor will be significantly higher than background (PCT/US01/09050) when there is part.Compared with the system disclosed in application PCT/US97/05330 and PCT/US98/14215, this two-hybrid system is a significantly improved inducible gene expression regulator control system.This two-hybrid system make use of a pair of interaction proteins that transcriptional activation domain is brought in into a position more favourable relative to DNA binding structural domains, so that when DNA binding structural domains are attached on the DNA binding sites of gene, transactivation domain more effectively activating promoters (referring to such as US 5,283,173).In brief, double cross gene expression system includes two expression casettes, and first assembly encodes a DNA binding structural domain being fused on nuclear receptor polypeptide, and the second component encodes a transactivation domain being fused on different IPs receptor polypeptides.When there is part, the first polypeptide and peptide interaction more than second effectively connect DNA binding structural domains and transactivation domain.It is located at because DNA is combined with transactivation domain on two different molecules, the background vigor when lacking part is substantially reduced.

In addition, two-hybrid system avoids some due to side effect caused by RXR is overexpressed generally occurring when unmodified RXR is used as switch companion.In one embodiment of two-hybrid system, the n DNA for eliminating EcR or RXR is combined and transactivation domain.As a result, these hybrid molecules and other steroid hormones interaction of intracellular presence are reduced, and cause side effect to reduce.

With the improvement of the gene regulatory system based on acceptor, for the increase in demand of the part higher than existing ligand activity.The invention discloses the new non-steroidal ligand that can adjust transgene expression, discussed referring to SilviaLapenna special topics, Britain.

Other gene switching systems that applicant possesses include those systems described in following documents, and every document is all incorporated herein by reference：US 7,091,038；WO2004078924；EP1266015；US20010044151；US20020110861；US20020119521；US20040033600；US20040197861；US20040235097；US20060020146；US20040049437；US20040096942；US20050228016；US20050266457；US20060100416；WO2001/70816；WO2002/29075；WO2002/066612；WO2002/066613；WO2002/066614；WO2002/066615；WO2005/108617；US 6,258,603；US20050209283；US20050228016；US20060020146；EP0965644；US7,304,162；US 7,304,161.

Brief description

Fig. 1 show preparation cast off a skin sterol O- alkyl ethers protection/deprotection scheme.Before etherification reaction (E); by being converted into corresponding 20; 22- phenylboronates (25a), 2; 3- acetonides (25b) and 2,3,14; the acetonides of 22- bis- (25c) analog; optionally protect 20E (25) 2,3- and/or 20,22- glycol.Protection/deprotection condition：(a) phenylboric acid (PBA), dry DMF, room temperature 1 hour.(b)H₂O₂: THF 9: 1 (v/v), pH=7, room temperature 2.5 hours.(c) 1.2,2- dimethoxy propanes (DMP), anhydrous propanone, the p-TsOH of fusing, room temperature 3 hours；2.H₂O₂/ THF 9: 1 (v/v), pH=7, room temperature 2.5 hours.(d)0.1M HCl_aq: Isosorbide-5-Nitrae-dioxane 1: 1, room temperature 2.5 hours.(e) DMP, anhydrous propanone, the p-TsOH of fusing, room temperature 6 hours.(f) AcOH 70%, Isosorbide-5-Nitrae-dioxane flows back 8 hours.PoA 2 is synthesized from PoA (26), 3- acetonides (26a) are carried out under similar reaction condition.

Fig. 2 shows structure, title and the coding of cast off a skin steroid enol ether analogs (1-23) and reference compound (24-30).

Fig. 3, which is shown, uses Drosophila melanogaster B_IIGene switching test of the choristoneura fumigerana of biological test (BII) and use wild type (WT) EcR or EcR E274V/V390I/Y410E mutant based on EcR, to determine the sterol of casting off a skin (1-23) of O- alkylations and the effect and effect of reference compound (24-30).^aRMFI=relative maximums fold induction (relative to diacyl hydrazide)；^b3T3cells；Average background~1；With reference to FI (1 micro- rub)=806 (WT-CfEcR), 1012 (CfEcR of E274V/V390I/Y410E mutation).

During Fig. 4 A-4D show that the gene switching of the VgEcR/RXR systems in the CfEcR being mutated based on E274V/V390I/Y410E, wild type Aedes Aegypti EcR, Drosophila melanogaster EcR and mouse 3T3 fibroblasts is tested, the comparison dose response curve of PoA 22- methyl ethers, PoA and MuA.Reporter gene is luciferase；Fold induction relative to DMSO standard items is mapped in left axle, and definitely relative light unit (RLU) is mapped in right axle.Calculate for each part and the EC of switching system₅₀Value, and show on the diagram.

Fig. 5 shows the statistics summary (CoMFA/CoMSIA applied fields, leave one cross validation analysis and routine PLS analyses) of 3D-QSAR models.Abbreviation：Minimum σ=column filter (kcal/mol), S_PRESS=normative forecast error, r²=conventional (non-authentication) matching coefficient correlation, S=standard error estimates, q²=leave one cross validation coefficient correlation, PSA=polar surface areas.

Fig. 6 shows ether functional group to the contribution of the sterol vigor of casting off a skin measured in BII biological tests.Discrepancy delta-logEC between vigor difference compound pair when presence or absence of the substituent for being expressed as-OR₅₀Represent.

Fig. 7 shows that, for a set of O- alkyl steroids, the octanol-water partition coefficient of calculating, blood-brain barrier penetration, Caco-2 Premeabilisation of cells, human serum albumins (HAS) is combined and water-soluble.¹Test logD values：20- hydroxyl ecdysterones, 0.01；Ponasterone A, 1.95；Diacyl hydrazide 30,3.4.²Experiment value：20- hydroxyl ecdysterones, 6.7mg/mL；Ponasterone A, 0.18mg/mL；Rice happy sterone A, ＞ 2.9mg/mL；The μ g/mL of diacyl hydrazide 30,6.2.

Fig. 8 shows the effect and effect of casted off a skin with the measured selected O- alkylations of the gene switching test based on Aedes Aegypti (Aa) and Drosophila melanogaster (Dm) EcR sterol and reference compound.^aRMFI=relative maximums fold induction (relative to diacyl hydrazide 30).

Fig. 9 shows the steroids changed with hydroxyl.

Figure 10 shows the steroids changed with side chain.

Figure 11 shows the steroids with changes such as the state of oxidation, degree of hydroxylation, loop system and side chain cut-outs.

Figure 12 shows silkworm (silkworm (Bombyx mori), BmEcR), maduca sexta (maduca sexta (Manduca sexta), MsEcR), Spruce budworm (choristoneura fumigerana (Choristoneura fumiferana), the CfEcR of CfEcR and E274V/V390I/Y410E mutation), fruit bat (Drosophila melanogaster (Drosophila melanogaster), DmEcR), yellow fever mosquito (Aedes Aegypti (Aedes aegypti), AaEcR), hard tick (lone star tick (Amblyomma americanum), AmaEcR), Bemisia argentifolii (Bemisia argentifolii (Bemisia argentifolii), BaEcR), leafhopper (rice green leafhopper (Nephotettix cincticeps), ) and yellow meal worm (yellow meal worm (Tenebrio molitor) NcEcR, TmEcR the sequence alignment of EcR ligand binding domains).Coil region has been marked above sequence alignment.The identical that marked with an asterisk residue；Colon has marked conservative residue.(not guarding) residue that (conservative) that is marked with solid circles or black triangle are marked is positioned at the HvEcR's for combining ponasterone A

In (only heavy atom).The residue marked with empty circles is positioned at the HvEcR's for combining ponasterone A

In (only heavy atom).The CfEcR of E274V/V390I/Y410E mutation is marked with the boldface type underlined.

Figure 13 shows that one in NIH 3 T 3 cells in vitro uses in GAL4-EcR (DEF regions), the two-hybrid system of VP16-RXR-USP chimeras and luciferase reporter gene, gene switching EC of the steroids measured to Lepidoptera EcR₅₀Value.FI=fold inductions；RMFI, relative to the maximum fold induction of RSL1 maximums；"~", observes the EC of assessment by visual observation₅₀.EcR originates：BmEcR, silkworm；MsEcR, maduca sexta；CfEcR, Spruce budworm；The CfEcR of E274V/V390I/Y410E mutation.

Figure 14 shows that one in NIH 3 T 3 cells in vitro uses in GAL4-EcR (DEF regions), the two-hybrid system of VP16-RXR-USP chimeras and luciferase reporter gene, gene switching EC of the steroids measured to non-Lepidoptera EcR₅₀Value.Include BII cell transformations EC₅₀Value is with making comparisons.FI, fold induction；RMFI, relative maximum fold induction；"~", observes the EC of assessment by visual observation₅₀.EcR originates：BII, fruit bat, DmEcR, fruit bat；AaEcR, yellow fever mosquito；AmaEcR, hard tick；BaEcR, Bemisia argentifolii；NcEcR, leafhopper；TmEcR, yellow meal worm.

Figure 15 shows that one in NIH 3 T 3 cells in vitro uses in GAL4-EcR (DEF regions), the two-hybrid system of VP16-RXR-USP chimeras and luciferase reporter gene, gene switching EC of the steroids measured to Lepidoptera EcR₅₀Value.FI=fold inductions；RMFI, relative to the maximum fold induction of RSL1 maximums；"~", observes the EC of assessment by visual observation₅₀.EcR originates：BmEcR, silkworm；MsEcR, maduca sexta；CfEcR, Spruce budworm；The CfEcR of E274V/V390I/Y410E mutation.

Figure 16 shows that one in NIH 3 T 3 cells in vitro uses GAL4-EcR (DEF regions), VP16-RXR-USP chimeras, or in the two-hybrid system of VgEcR/RxR systems and luciferase reporter gene, gene switching EC of the steroids measured to non-Lepidoptera EcR₅₀Value.Include BII cell transformations EC₅₀Value is with making comparisons.FI, fold induction；RMFI, relative maximum fold induction；"~", observes the EC of assessment by visual observation₅₀.EcR originates：BII, fruit bat, DmEcR, fruit bat；AaEcR, yellow fever mosquito；AmaEcR, hard tick；BaEcR, Bemisia argentifolii；NcEcR, leafhopper；TmEcR, yellow meal worm.

Figure 17 shows the effort levels of selected steroids and EcR relation, is arranged according to system order of occurrence.Lepidoptera EcR is shown in the left side, and non-Lepidoptera is on the right.Every horizontal line represents a different part.Cross means effect is inverted, i.e., two parts and EcR in the both sides of intersection are orthogonal.Dotted lines represent that CfEcR//carinula element B/AaEcR that the CfEcR//Atyiplex canescen sterone/BaEcR and cyasterone/E274V/V390I/Y410E of cyasterone/E274V/V390I/Y410E mutation are mutated is orthogonal.

Figure 18 A and 18B show the dose response of cyasterone (solid circles) and Atyiplex canescen sterone (empty circles) and (a) E274V/V390I/Y410E EcR being mutated and (b) BaEcR.Fold induction (ratios of the proof load RLU to background RLU) is marked on the left longitudinal axis.Approximate RLU measurements are marked in right axle.Some points of higher dosage are omitted.

Figure 19 A and 19B show cyasterone (solid circles) and carinula element B (open triangles) and (a) E274V/V390I/Y410E EcR being mutated and (b) AaEcR dose response.Fold induction (ratios of the proof load RLU to background RLU) is marked on the left longitudinal axis.Approximate RLU measurements are marked in right axle.Some points of higher dosage are omitted.

Figure 20 shows steroids effect (- log (ECs of the CfEcR to BaEcR of E274V/V390I/Y410E mutation₅₀)/-log(EC₅₀)) collection of illustrative plates.

Summary of the invention

The present invention relates to the non-steroidal ligand being used together with gene switching, inducible gene expression regulator control system of the gene switching for example based on nuclear receptor, and with the method for these parts and gene switching goal of regulation and control gene expression in host cell.

An embodiment of the invention is directed to use with the method that controlling gene is expressed in host cell of the Gene expression regulation system with part of the present invention.One aspect of the present invention provides a kind of method of the goal of regulation and control gene expression in host cell, comprises the following steps：A) a Gene expression regulation system as described in the present invention is imported to host cell；B) import an expressed sequence to host cell to combine, the combined sequence includes i) response element, the domain of the DNA binding structural domains of the first hybrid polypeptide from Gene expression regulation system comprising a combination；Ii) a promoter, is activated by the transactivation domain of the second hybrid polypeptide of Gene expression regulation system；And iii) expression need the target gene that is regulated and controled；And c) to host cell a part is imported, once so that part is imported into host cell, the expression of goal of regulation and control gene.

Another aspect of the present invention includes being used for the orthogonal gene switching of the multiple target gene expression of independent control.The orthogonal gene switching of the present invention includes thoseing the gene switching based on nuclear receptor, such as steroid receptor, and it includes ecdysterone acceptor.In addition, orthogonal gene switching includes the independent switch based on wild-type sequence or mutant nucleotide sequence or its combination.

Another aspect of the present invention includes gene switching, it includes H group nuclear receptor ligands binding structural domains, ecdysterone receptor ligand binding domain, ecdysterone receptor ligand binding domain, the substitution mutant of choristoneura fumigerana ecdysterone receptor ligand binding domain, the V390I/Y410E mutant of choristoneura fumigerana ecdysterone receptor ligand binding domain or the E274V/V390I/Y410E mutant of choristoneura fumigerana ecdysterone receptor ligand binding domain.

Another aspect of the present invention is a kind of recombination switching system comprising at least one gene switching and at least one activating ligands, wherein activating ligands be one or more compounds disclosed in this invention or non-steroids or diacyl hydrazide, acid amides ketone or

Bisoxazoline.

Another aspect of the present invention is a kind of system for including multiple gene switchings, and plurality of gene switching is one or more nucleic acid codings as present on same vector polynucleotides.

Another aspect of the present invention is a kind of recombination switching system, wherein each separately operable gene switching controls a different target gene, wherein target gene is therapeutic objective gene, cell factor and/or toxin.

Another aspect of the present invention is that a kind of compound disclosed by the invention by giving effective dose activates the method that recombination is switched, and wherein recombination switching system produces response to the compound.

Another aspect of the present invention is related to composition and therapeutic combination with one or more non-steroidal ligands.Other aspects of the present invention include the composition of the gene switching part comprising steroid and/or on-steroidal structure.Such composition includes therapeutic cocktail.

Detailed description of the invention

An embodiment of the invention provides the part being used in combination with the inducible gene expression system based on steroid receptor, carrys out the expression of the intracellular target gene of modulate host.In one embodiment, the invention provides a kind of gene switching system, the background genes expression of the system reduces and produces response to the non-steroidal ligand less than micro- concentration of rubbing, instant invention overcomes the limitation of existing inducible expression system, and there is provided a kind of effective ways of control gene expression.

When needing control gene expression dose, the present invention can be used for following application, such as gene therapy, extensive expressing protein and antibody, the high flux screening test based on cell, functional genome, protein group, metabolism group and in genetically modified organism characteristic regulation and control.It is one advantage of the present invention that the expression of gene can be adjusted to meet the demand of user.

The present invention relates to the compound of following chemical formula：

Or

Wherein R¹、R²、R³And R⁴For

A) H, (C₁-C₆) alkyl；(C₁-C₆) alkylhalide group；(C₁-C₆) cyanoalkyl；(C₁-C₆) hydroxyalkyl；(C_1-4) alkoxy (C₁-C₆) alkyl；(C₂-C₆) alkenyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；(C₂-C₆) alkynyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；C₃-C₅Cycloalkyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；Epoxy ethyl, optionally by halogen, cyano group or (C₁-C₄) alkyl substitution；Or

B) unsubstituted or substituted benzyl, wherein substituent stand alone as 1-5 H, halogen, nitro, cyano group, hydroxyl, (C₁-C₆) alkyl or (C₁-C₆) alkoxy；And

R⁵For H；OH；F；Cl；Or (C₁-C₆) alkoxy.

In one embodiment, R is worked as¹、R²、R³And R⁴During for H, then R⁵It is not H or hydroxyl.

In one embodiment, R¹、R²、R³And R⁴In at least one be H.In another embodiment, R¹、R²、R³And R⁴In at least two be H.In another embodiment, R¹、R²、R³And R⁴Middle at least three is not H.In another embodiment, R¹、R²、R³And R⁴In each be H.

In one embodiment,

Work as R¹、R²、R³And R⁴During for H, then R⁵It is not methoxyl group,

Work as R¹、R²、R³And R⁴During for isopropyl, then R⁵It is not hydroxyl, and

Work as R¹、R²And R³For H and R⁵During for hydroxyl, then R⁴It is not methyl or ethyl.

In certain embodiments, R¹、R²、R³And R⁴For

A) H, (C₁-C₆) alkyl；(C₁-C₆) alkylhalide group；(C₁-C₆) cyanoalkyl；(C₁-C₆) hydroxyalkyl；(C_1-4) alkoxy (C₁-C₆) alkyl；(C₂-C₆) alkenyl；(C₂-C₆) alkynyl；Epoxy ethyl, optionally by halogen, cyano group or (C₁-C₄) alkyl substitution；Or

B) unsubstituted or substituted benzyl, wherein substituent stand alone as 1-5 H, halogen, cyano group or (C₁-C₆) alkyl；And

R⁵For H, OH, F, Cl or (C₁-C₆) alkoxy.

In other particular implementations, R¹、R²、R³And R⁴For H, (C₁-C₆) alkyl；(C₂-C₆) alkenyl；(C₂-C₆) alkynyl；2 '-ethyl epoxy ethyl, or benzyl；And

R⁵For H；OH or F.

In certain embodiments,

Work as R¹、R²、R³And R⁴During for isopropyl, then R⁵It is not hydroxyl；

Work as R⁵During for H, hydroxyl, methoxyl group or fluorine, then R¹、R²、R³And R⁴In at least one be H；

Work as R¹、R²、R³And R⁴Middle only one of which is methyl and R⁵During for H or hydroxyl, then R¹、R²、R³And R⁴In it is remaining be H；

Work as R⁴And R¹、R²And R³In one when being methyl, then R⁵Neither it is H nor is hydroxyl；

Work as R¹、R²、R³And R⁴When being all methyl, then R⁵It is not hydroxyl；And

Work as R¹、R²And R³All it is H and R⁵During for hydroxyl, then R⁴It is not ethyl, n-propyl, normal-butyl, pi-allyl or benzyl.

The method that embodiments of the present invention are directed to goal of regulation and control gene expression, this method includes one nuclear receptor compound of contact, comprising：

A) a DNA binding structural domain

B) ligand binding domains

C) transactivation domain；With

D) part；

And a DNA construction, comprising

One target gene, and

One response element

Wherein target gene is under the control of response element；And

In the presence of part, DNA binding structural domains are attached on response element, cause to activate or suppress target gene.

In one embodiment, part is the compound of following chemical formula：

Or

Wherein R¹、R²、R³、R⁴And R⁵With implication recited above.

Only certain exemplary embodiments of this invention is including the use of following steroid gene switching part：20- hydroxyl ecdysterone -2- methyl ethers；20- hydroxyl ecdysterone -3- methyl ethers；20- hydroxyl ecdysterone -14- methyl ethers；20- hydroxyl ecdysterone -2,22- dimethyl ethers；20- hydroxyl ecdysterone -3,22- dimethyl ethers；20- hydroxyl ecdysterone -14,22- dimethyl ethers；20- hydroxyl ecdysterone -22,25- dimethyl ethers；20- hydroxyl ecdysterones -2,3,14,22- tetramethyl ethers；20- hydroxyl ecdysterone -22- n-propyl ethers；20- hydroxyl ecdysterone -22- n-butyl ethers；20- hydroxyl ecdysterone -22- allyl ethers；20- hydroxyl ecdysterone -22- benzylic ethers；20- hydroxyl ecdysterones；22- (28R, S) -2 '-ethyl epoxy ethyl ether, ponasterone A's -2- methyl ethers, ponasterone A's -14- methyl ethers, ponasterone A's -22- methyl ethers, ponasterone A -2,22- dimethyl ether, ponasterone A -3,22- dimethyl ethers, ponasterone A -14,22- dimethyl ether, Dacryhainansteronc -22- methyl ethers.

The other embodiment of the present invention is including the use of following steroid gene switching part：25, the double dehydrogenation ponasterone As of 26-, (different stachysterone C (Δ 25 (26))), this reaches sterone (shidasterone) (stachysterone (stachysterone) D), stachysterone C, 22- deoxidation -20- hydroxyls ecdysterones (Japanese yew sterone), ponasterone A, bracket fungus sterone B, 22- dehydrogenation -20- hydroxyl ecdysterones, dimethyl furan base ecdysterone, (22R) -20- (2, 2 '-dimethyl furan base) ecdysterone, 22 deoxidation ecdysterones, 25- deoxidation ecdysterones, 22- dehydrogenation ecdysterones, ecdysterone, 22- tables-ecdysterone, 24 methyl ecdysterones (20- deoxygenates makisterone A), ecdysterone -22- succinates, 25- deoxidation ecdysterone -22- β-D- glucopyranosides, ecdysterone -22- myristates, the different ecdysterones of 22- dehydrogenations -20-, the different ecdysterones of 20-, the iso- 22- tables ecdysterones of 20-, 2- deoxidation ecdysterones, this Lenno glucosides E (β glucosides of 2- deoxidations ecdysterone 3；Cloth indigo plant glucosides A (blechnoside A)),2- deoxidation ecdysterone -22- acetic acid esters,2- deoxidations ecdysterone -3,22- diacetate esters,2- deoxidation ecdysterone -22- β-D- glucopyranosides,2- deoxidation ecdysterone -25- β-D- glucopyranosides,2 deoxidation -21- hydroxyl ecdysterones,The iso- ecdysterones of 3- tables -22-,3- dehydrogenation -2- deoxidations ecdysterones (silenosterone),3- dehydrogenation ecdysterones,3- dehydrogenation -2- deoxidation ecdysterone -22- acetic acid esters,Ecdysterone -6- carboxymethyl oximes,Ecdysterone -2,3- acetonides,14- table -20- hydroxyls ecdysterone -2,3- acetonides,20 hydroxyl ecdysterones -2,3- acetonides,20- hydroxyls ecdysterone -20,22- acetonides,14- table -20- hydroxyls ecdysterone -2,3,20,The acetonides of 22- bis-,The western sterone -20 of handkerchief,22- is to hydroxyl benzylidenei acetal,Loose sterone,(20R)-dihydro pine sterone,(20S) dihydro pine sterone,The red sulfohydrazides of loose sterone -20-,(20S)-dihydro pine sterone -2,3,20- tribenzoates,(20R)-dihydro pine sterone -2,3,20- tribenzoates,(20R) dihydro pine sterone -2,3- acetonides,(20S) dihydro pine sterone -2,3- acetonides,(5 α-H)-dihydro rubrosterone,2,14,22,- 5 α of deoxidation of 25- tetra--ecdysterone,5 α -one glycol,Bake sterol (bombycosterol),2α,3α,22S,- 5 α of 25- tetrahydroxys-cholestane -6- ketone,(5 α-H) -2- deoxidation -21- hydroxyl ecdysterones,Chestnut sterone,24- Biao-chestnut sterone,Sterone A is integrated in (5 α-H) -2- deoxidations,Sterone A is integrated in (5 α-H) -22- deoxidations,(5 α-H) -20- hydroxyl ecdysterones,24,The dehydrogenation Dacryhainansteroncs of 25- bis-,25,The dehydrogenation Dacryhainansteroncs of 26- bis-,5- deoxidations aldosterone (Dacryhainansteronc),(14 α-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,25- hydroxyl Dacryhainansteroncs,Rubrosterone,(5 β-H)-dihydro rubrosterone,- 17 β of dihydro rubrosterone-acetic acid esters,This ground sterone (sidisterone),20- hydroxyls ecdysterone -2,3,22- triacetates,14- deoxidations (14 β-H) -20- hydroxyl ecdysterones,14- table -20- hydroxyl ecdysterones,9α,20- dihydroxy ecdysterones,Malaysia sterone (malacosterone),2- deoxidation ecdysterones,B-3- β-D- glucopyranosides,Ajugalactone,Its blue ketone B (cheilanthone B),2β,3β,6 α-the β of trihydroxy-5-cholestane,2β,3β,6 β-the β of trihydroxy-5-cholestane,14- dehydrogenations this reach sterone,Stachysterone B,2β,3β,9α,20R,22R,- 5 β of 25- hexahydroxys-cholesteric -7,14- diene -6- ketone,OK a karaoke club reaches sterone,(14 β-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,4- dehydrogenation -20- hydroxyl ecdysterones,14- methyl isophthalic acid 2- alkene-Si Da sterones,14- methyl isophthalic acid 2- alkene -15,20- dihydroxy ecdysterones,Sufficient sterone B,2β,3β,20R,Fluoro- 5 β of 22R- tetrahydroxys -25--cholesteric -8,14- diene -6- ketone (25- fluorine foot sterone B),Charon sterone (calonysterone),14- deoxidations -14,18- ring -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyl ecdysterones,9β,14 beta epoxide -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyls ecdysterone 2,3,20,The acetonides of 22- bis-,28- high rape plain lactones,Different high rape plain lactone.

One aspect of the present invention is combined the expression for carrying out control targe gene including the use of steroid molecule as described in the present invention and gene switching.The gene switching of one energy control targe gene expression as described in the present invention can include the fragment of at least one ecdysterone acceptor.Optionally, a kind of gene switching for being capable of control targe gene expression as described in the present invention can combine at least one fragment of the nuclear receptor of steroid molecule comprising another.

Work as R^xGroup be specify when, wherein x is represented with numeral 1-4, and identical R^xGroup also specify long alkyl chains such as " (C₁-C₃) ", it should be understood that the chain length specified is only referred to work as R^xFor the situation of alkyl, and it is not related to and works as R^xCan not be the situation of alkyl, for example, H or aryl.

Term " alkyl " includes side chain and straight chained alkyl.Typical alkyl includes such as methyl, ethyl, n-propyl, isopropyl, normal-butyl, sec-butyl, isobutyl group, the tert-butyl group, n-pentyl, isopentyl, n-hexyl, n-heptyl, iso-octyl, nonyl and decyl.

Term " halo " refers to fluoro, chloro, bromo or iodo.

Term " haloalkyl " refers to the alkyl replaced by one or more halogen groups, such as chloromethyl, 2- bromoethyls, 3- iodine propyl group, trifluoromethyl and perfluoro propyl.

The aliphatic ring structure of term " cycloalkyl " finger ring shape, is optionally replaced by alkyl, hydroxyl or halogen, for example cyclopropyl, methylcyclopropyl groups, cyclobutyl, 2- hydroxycyclopents base, cyclohexyl and 4- chlorine cyclohexyl.

Term " hydroxy alkyl " refers to the alkyl replaced by one or more hydroxyls, such as hydroxymethyl and 2,3- dihydroxy butyl.

Term " alkyl sulphonyl " refers to by alkyl-substituted sulfonyl, such as mesyl and n-propyl sulfonyl.

Term " alkenyl " refers to the alkylene unsaturated carbon hydrogen group of straight or branched, with one or more ethylene linkages, such as vinyl, acrylic, 1- cyclobutenyls, 2- cyclobutenyls, isopropenyl and 2- pentenyls.

Term " haloalkenyl group " refers to the alkenyl replaced by one or more halogen groups.

Term " alkynyl " refers to the unsaturated carbon hydrogen group of straight or branched, with 1 or 2 acetylene bonds, such as acetenyl and propinyl.

Term " alkyl-carbonyl " refers to alkyl ketone group functional group, such as acetyl group, positive bytyry etc..

Term " heterocyclic radical " or " heterocycle " refer to unsubstituted or substituted, saturation, fractional saturation or undersaturated five yuan or hexatomic ring, with 1,2 or 3 hetero atoms, such as one or two hetero atom, independently selected from the following group：Oxygen, nitrogen and sulphur.The example of heterocyclic radical includes such as pyridine radicals, thienyl, furyl, pyrimidine radicals, pyrazinyl, quinolyl, isoquinolyl, pyrrole radicals, indyl, tetrahydrofuran base, pyrrolidinyl, piperidyl, THP trtrahydropyranyl, morpholinyl, piperazinyl, dioxolane base and dioxane base.

Term " alkoxy " includes the side chain and straight chained alkyl for being connected with terminal oxygen atoms.Typical alkoxy includes such as methoxyl group, ethyoxyl, positive propoxy, isopropoxy and tert-butoxy.

Term " halogenated alkoxy " refers to the alkoxy replaced by one or more halogen groups, such as chloromethoxy, trifluoromethoxy, difluoro-methoxy and perfluoroisobutoxy.

Term " alkoxyalkyl " refers to the alkyl replaced by alkoxy, such as isopropoxymethyl.

Term " non-steroids " or " non-steroidal ligands " refer to the compound for not deriving from 1,2- cyclopentenoperhydrophenanthrene skeletons：

It activates a gene switching.Akhrem, A.A and the Yu.A.Titov.'s published see, for example, New York Pu Lainan publishing company in 1970《Total steroids synthesis》.(Akhrem, A.A.and Yu.A.Titov.Total Steroid Sythesis.New York：Plenum Press, 1970.)

Term " diacyl hydrazide " refers to a kind of-N for carrying N '-substitution, the compound of N '-diacyl hydrazide kernel.Such compound is disclosed in such as U.S. Patent No. 4,985,461, the 5,225th, No. 443, No. 5,354,762, the 5,117th, No. 057, No. 6,013,836, the 5,424th, No. 333, No. 5,344,958, the 5,530th, No. 028, No. 5,482,962, the 7,456th, in No. 315 and No. 7,304,161 and WO2008/153801.In one embodiment, term " diacyl hydrazide " refers to the compound with following chemical formula：

Wherein R¹For alkyl, and Ar¹And Ar²The phenyl with the 1-3 substituents being selected from the group independently is, the substituent includes halogen, alkyl and alkoxy.In one embodiment, R¹For the C of side chain₄-C₈Alkyl, such as-C (CH₃)₃、-C(CH₃)C(CH₃)₃、-C(CH₂CH₃)C(CH₃)₃Or-C (CH₂CH₂CH₃)C(CH₃)₃.In one embodiment, benzene substituent independently is C₁-C₄Alkyl or alkoxy, such as Ar¹For 2- ethyl -3- methoxyphenyls and Ar²For 3,5- 3,5-dimethylphenyls.The representational diacyl hydrazide of present embodiment is disclosed in as in U.S.7,456,315 and WO 2008/153801.

Term " acid amides ketone " refers to the compound with following chemical formula：

Such as it is disclosed in U.S.7,365,093.

Term

Bisoxazoline " refers to the compound with following chemical formula：

Such as it is disclosed in U.S.7,304,162.

Term " carrier " includes any standard vector known in the art.In one embodiment, carrier is pharmaceutically acceptable carrier.Term " pharmaceutically acceptable carrier " includes pharmaceutical carrier, buffer and the excipient of any standard, including phosphate buffered salt solution, water and emulsion (such as oil/water or water/oil emu), and various types of wetting agents and/or adjuvant.What suitable pharmaceutical carrier and their preparation were published in the Mack Publishing Company of nineteen ninety-five Easton, PA《Remington pharmaceutical science》It is described in 19th edition (Remington ' s Pharmaceutical Sciences, Mack Publishing Co, Easton, PA, 19th ed.1995).It is preferred that pharmaceutical carrier depend on active agents expection administering mode.

" silica gel column chromatography " refers to a kind of purification process, wherein target chemical substances is added to the top of vertical column as concentrating sample, the post is made up of the silica gel or the silica gel of chemical modification in glass, plastics or metal cylinder, and is eluted with solvent or solvent mixture from such post.

" flash chromatography " refers to the silica gel column chromatography carried out under air, argon gas or nitrogen pressure, and usual pressure is in the range of 10-50psi.

" gradient chromatography " refers to chemical substance use and the silica gel column chromatography that the solvent mixture of composition is eluted from post is changed stepwise.

Terminology used in the present invention has the usual meaning that they are used in this area.

Term " separation " is used to show that biomaterial (nucleic acid or albumen) is separated from its primal environment (its naturally occurring environment) in the present invention.For example, the polynucleotides being present in native state in plant or animal are not separation, but the identical polynucleotides separated from its naturally occurring adjacent nucleic acid are considered as " separation ".Term " purifying " do not need material with definitely it is pure, without other compounds in the form of exist.It is a relative definition.

Polynucleotides from original material or natural material after at least one order of magnitude has been purified, such as 2 or 3 or 4 or 5 orders of magnitude, in " purifying " state,.

" nucleic acid " or " nucleic acid molecules " or " polynucleotides " are comprising the polymer for being covalently attached the subunit for being referred to as nucleotides.Nucleic acid includes poly ribonucleic acid (RNA) and polydeoxyribonucleotide (DNA), both can be single-stranded or double-stranded.DNA includes but is not limited to cDNA, genomic DNA, DNA, the DNA and semi-synthetic DNA of synthesis.DNA can be linear, ring-type or supercoil.Nucleic acid can refer to ribonucleotide (adenosine, guanosine, uridine or cytidine；" RNA molecule "), or the phosphate Multimeric forms of dezyribonucleoside (desoxyadenossine, deoxyguanosine, AZT or deoxycytidine), or its any phosphate analogs, such as thiophosphate and sulfuric ester, it is single stranded form or double-stranded helical.May there are double-stranded DNA-DNA, DNA-RNA and RNA-RNA spirals.The term includes restriction fragment, plasmid and chromosome.DNA or RNA sequence description can provide sequence according to normal convention according to the direction along non-transcribed DNA (i.e. with the chain with mRNA homologous sequences) from 5 ' to 3 '." recombinant DNA molecules " are the DNA moleculars for passing through molecular biology manipulations.

Term " nucleic acid fragment " is interpreted as the nucleotide sequence shortened relative to control nucleic acid sequence length, and includes the shared part of a nucleotide sequence identical with control nucleic acid.When appropriate, such nucleic acid fragment of the invention can be included in larger polynucleotides.The length of fragment can for the nucleic acid of the present invention at least 6,8,9,10,12,15,18,20,21,22,23,24,25,30,39,40,42,45,48,50,51,54,57,60,63,66,70,75,78,80,90,100,105,120,135,150,200,300,500,720,900,1000 or 1500 continuous nucleotides.

As used in the present invention, " nucleic acid fragment of separation " is single-stranded or double-stranded RNA or DNA polymers, alternatively with nucleotide base that is synthesis, non-natural or changing.The nucleic acid fragment of the separation of DNA polymer forms can be made up of one or more cDNA, genomic DNA or the DNA fragmentation of synthesis.

" gene " refers to one polypeptide of coding or encodes the nucleotide pools of a bioactivity RNA molecule.Term " gene " includes cDNA and genomic DNA nucleic acid." gene " also refers to the nucleic acid fragment of expression specific protein or polypeptide, including before coded sequence after (5 ' non-coding sequence) and coded sequence (3 ' non-coding sequence) regulating and controlling sequence." natural gene " refers to the gene with its own regulating and controlling sequence as naturally found." mosaic gene " refers to any gene of non-native gene, includes the regulating and controlling sequence and/or coded sequence that will not naturally occur together.Therefore, mosaic gene can include regulating and controlling sequence and coded sequence from separate sources, or regulating and controlling sequence and coded sequence are arranged from same source but in the mode different from its natural environment.Mosaic gene can include the coded sequence from separate sources and/or the regulating and controlling sequence from separate sources." endogenous gene " refers to the natural gene on its natural place on organism genome." external source " gene or " heterologous " gene criticize the gene often not appeared in host organisms, but are imported into by gene transfer in host organisms." transgenosis " is by the gene in transform mode quiding gene group.

" heterologous " DNA refers to the DNA on the natural chromosomal foci not in cell or not in cell.In one embodiment, allogeneic dna sequence DNA includes the alien gene of cell.

Term " genome " includes chromosome and mitochondria, chloroplaset and viral DNA or RNA.

Nucleic acid molecules are and another nucleic acid molecules " can hybridize ", such as cDNA, genomic DNA or RNA, the single stranded form of nucleic acid molecules, which can anneal, under the conditions of suitable in temperature and solution ion strength is connected on other nucleic acid molecules and (is seen below referring to Sambrook etc., 1989).Hybridization and wash conditions are Sambrook, J, Fritsch, E.F and the Maniatis that CSH Press that is well-known and being set forth in Cold SpringHarbor in 1989 is published, T.'s《Molecular Cloning:A Laboratory guide》The second edition (Sambrook, J, Fritsch, E.F.and Maniatis, T.Molecular Cloning：ALaboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989)) in, Chapter 11 and table 11.1 (being generally introduced the present invention as reference) especially therein.Temperature and ionic strength conditions determine " rigor " of hybridization.

High stringency conditions can be adjusted to screen appropriate similar fragment, such as homologous sequence from distant organism；To the gene of highly similar fragment, such as the copy function enzyme from close organism.For preliminary screening homologous nucleic acid, it can use and correspond to T_mThe hybridization conditions of 55 DEG C of low rigor, such as 5xSSC, 0.1%SDS, 0.25% milk and no formamide；Or 30% formamide, 5x SSC, 0.5%SDS.Corresponding to higher T_mAppropriate stringent hybridisation conditions be such as 40% formamide, and 5x or 6xSCC.Corresponding to highest T_mHigh stringent hybridisation conditions, such as 50% formamide, 5x or 6x SCC.

Hybridization needs 2 nucleic acid to include complementary series, although may mispairing between the rigor dependent on hybridization, base.Term " complementation " is used to describe the relation between the nucleotide base of energy phase mutual cross.For example, for DNA, adenosine is complementary with thymidine, and cytimidine is complementary with guanine.Therefore, the present invention also includes the nucleotide fragments of separation, the fragment and presently disclosed or complete sequence used and their similar nucleic acid array complementations substantially.In the particular implementation of the present invention, polynucleotides are detected using hybridization conditions, the hybridization conditions include a T _m55 DEG C of hybridization step, and use condition as described above.In one embodiment, T_mFor 60 DEG C.In another embodiment, T_mFor 63 DEG C.In another embodiment, T_mFor 65 DEG C.

Washing after hybridization also determines high stringency conditions.A set of condition employs a series of washing, and from 6X SSC are used at room temperature, 0.5%SDS washings 15min starts, and then repeats to use 2X SSC, 0.5%SDS to wash 30min at 45 DEG C, and is then repeated twice and uses 0.2X SSC, and 0.5%SDS washes 30min at 50 DEG C.Another set of high stringency conditions use higher temperature, wash identical with above-mentioned condition, and except finally using 0.2X SSC twice, 0.5%SDS washings 30min temperature brings up to 60 DEG C.Another set of highly rigorous condition uses last washing twice to use 0.1X SSC, 0.1%SDS to wash at 65 DEG C.Hybridization needs two nucleic acid to include complementary series, although may have mispairing between the rigor dependent on hybridization, base.

The suitable rigor of nucleic acid hybridization depends on the length and complementarity of nucleic acid, and variable is known in the art.Similarity or homology between two nucleotide sequences is higher, the T of the heterozygote of the nucleic acid with those sequences_mValue is bigger.The relative stability of nucleic acid hybridization (corresponds to higher T_m) reduced according to following order：RNA:RNA、DNA:RNA、DNA:DNA.For the hybridization more than 100 length of nucleotides, there is calculating T_mEquation (referring to Sambrook etc., see on, 9.50-0.51).It is the hybridization of oligonucleotides for shorter nucleic acid, the position of mispairing becomes even more important, and the length of oligonucleotides determines its specificity (referring to Sambrook etc., seeing upper 11.7-11.8).

In the particular implementation of the present invention, polynucleotides are detected using following hybridization conditions, hybridization conditions include a hybridization step, and salinity is less than 500mM and at least 37 DEG C；And a washing step, with 2XSSPE and at least 63 DEG C.In one embodiment, hybridization conditions include hybridization and washing step all at least 200mM salt and 63 DEG C of progress.

In one embodiment, the length of interfertile nucleic acid is at least about 10 nucleotides.The example of the minimum length of one interfertile nucleic acid is at least about 15 nucleotides；Another length is at least about 20 nucleotides；And another length is at least 30 nucleotides.In addition, those of skill in the art can be appreciated that, according to factors such as such as probe lengths, temperature and wash solution salinity can be adjusted on demand.

Term " probe " refers to can form the single stranded nucleic acid molecule of duplex molecule with complementary single-stranded target nucleic acid base pairing.

As used in the present invention, term " oligonucleotides " refers to a kind of nucleic acid molecules that can hybridize with genomic DNA molecule, cDNA molecules, DNA or mRNA molecules.Oligonucleotides can add label, such as³²P- nucleotides or the nucleotides for being covalently attached such as biotin label.Tagged oligonucleotides can be used as probe to detect the presence of nucleic acid.Oligonucleotides (one or two in both can carry label) can be used as PCR primer, the presence for Cloning of full length nucleic acid or nucleic acid fragment, or detection nucleic acid.Oligonucleotides can also be used for and DNA molecular three spirals of formation.Generally, oligonucleotides is synthetically prepared, for example, use nucleic acid synthesizer.Therefore, oligonucleotides can be prepared with the similar key of non-naturally occurring di-phosphate ester, such as thioester bond.

" primer " is under suitable conditions with target nucleic acid sequence hybridization to produce the oligonucleotides that double-strandednucleic acid region synthesizes starting point as DNA.Such primer can be used for PCR.

" PCR " abbreviation PCR, represents a kind of in-vitro method of use enzymatic amplification specific nucleic acid sequence.PCR is related to a series of temperature cycles of repetitions, and each circulation includes three phases：Template nucleic acid denaturation is with isolation of target molecules chain, by single-stranded PCR Oligonucleolide primers annealed combination to template nucleic acid, and extends with archaeal dna polymerase the primer of annealing.PCR provide it is a kind of detect the method that target molecule is present, and under the conditions of quantitatively or semi-quantitatively, it is determined that in initial nucleic acid pond that target molecule relative quantity.

" reverse transcriptase polymerase chain reaction " abbreviation RT-PCR, represents a kind of in-vitro method, target cDNA molecules is produced from RNA molecule with enzyme, then as described above in the target specific nucleotide sequence of cDNA intramolecular enzymatic amplifications or sequence.RT-PCR also provide it is a kind of detect the method that target molecule is present, and under the conditions of quantitatively or semi-quantitatively, it is determined that in initial nucleic acid pond that target molecule relative quantity.

DNA " coded sequence " is the inner or in vitro double chain DNA sequence for transcribing and/or translating into the cell polypeptide when under the control for being placed in appropriate regulatory sequences." regulating and controlling sequence " refers to the nucleotide sequence positioned at the upstream (5 ' non-coding sequence) of coded sequence, central or downstream (3 ' non-coding sequence), and its influence transcription, RNA processing or the translation of stability or related coding sequences.Regulating and controlling sequence may include promoter, translate targeting sequencing, introne, Polyadenylation recognition sequence, RNA Processing positions, effector binding site and loop-stem structure.The border of coded sequence is determined by an initiation codon held in 5 ' (amino) and a translation termination codon held in 3 ' (carboxyls).Coded sequence may include but be not limited to, protokaryon sequence, siRNA, Microrna, shRNA or other biological activity RNA, the cDNA from mRNA, genomic dna sequence, and the DNA sequence dna even synthesized.If coded sequence is the expression for the target protein in eukaryotic, poly-adenosine signal and transcription terminator are usually located at the 3 ' of coded sequence and held.

As used in the present invention, term " head to head " refers to the direction of two polynucleotide sequences each other.When 5 ' ends of a polynucleotide encoding chain are held close to the 5 ' of another polynucleotide encoding chain, two polynucleotides are located at direction " head to head ", so that 5 ' ends outwards progress of the transcriptional orientation of each polynucleotides from another polynucleotides.Term " head to head " can be abbreviated as (5 ')-available symbols (←) or (3 ' ← 5 ' 53 ') are represented to-(5 '), and also.

As used in the present invention, term " tail is to tail " describes the direction of two polynucleotide sequences each other.When 3 ' ends of a polynucleotide encoding chain are held close to the 3 ' of another polynucleotide encoding chain, two polynucleotides are located at the direction of " tail is to tail ", so that the transcriptional orientation of each polynucleotides is carried out towards another polynucleotides.Term " tail is to tail " can be abbreviated as (3 ')-available symbols (←) or (5 ' .3 ' 3 ← 5 ') are represented to-(3 '), and also.

As used in the present invention, term " head is to tail " describes the direction of two polynucleotide sequences each other.When 5 ' ends of a polynucleotide encoding chain are held close to the 3 ' of another polynucleotide encoding chain, two polynucleotides are located at the direction of " head is to tail ", so that the transcriptional orientation of each polynucleotides is carried out with another polynucleotides identical direction.Term " head is to tail " can be abbreviated as (5 ')-available symbols () or (5 ' .3 ' 53 ') are represented to-(3 '), and also.

Term " downstream " refers to 3 ' that a nucleotide sequence is located at control nucleotide sequence.Particularly, downstream nucleotide sequence is usually directed to the sequence after transcription initiation site.For example, the translation initiation codon of a gene is located at the downstream of transcription initiation site.

Term " upstream " refers to 5 ' that a nucleotide sequence is located at control nucleotide sequence.Particularly, upstream nucleotide sequence is usually directed to the sequence of the 5 ' sides positioned at coded sequence or transcription initiation site.For example, most promoters are located at the upstream of transcription initiation site.

Term " restriction enzyme " and " Restriction Enzyme " refer to the enzyme of specific nucleotide sequence in cutting double-stranded DNA.

" homologous recombination " refers to an exogenous DNA array and is inserted into another DNA molecular, and such as one carrier is inserted into chromosome.For example, carrier, which attacks specific chromosomal foci, carries out homologous recombination.For specific homologous recombination, carrier is contained in the sufficiently long region of the sequence homology of chromosome, it is allowed to which complementation is combined and carrier is attached on chromosome.Homologous sequence is longer, and sequence similarity is higher, can improve the efficiency of homologous recombination.

Several methods known in the art can be used for breeding polynucleotides of the present invention.Once establishing suitable host system and growth conditions, it can breed and preparation in quantity recombinant expression carrier.As described herein, available expression vector includes but is not limited to following carrier or their derivative：Human or animal's virus such as vaccinia virus or adenovirus；Insect viruses such as baculoviral；Yeast vector；Bacteriophage carrier (such as λ) and plasmid and cosmid DNA vectors, are named just a few.

" carrier " is for by nucleic acid clone and/or being transferred to any instrument of host cell.Carrier can be a replicon that may be coupled on another DNA fragmentation, so as to realize the duplication of junction fragment." replicon " is can be replicated in vivo as any genetic elements (such as plasmid, bacteriophage, clay, chromosome, virus) of autonomous DNA replication dna unit under its own control.Term " carrier " includes being used in vitro, through external in vivo or in vivo by the viral or non-viral instrument of nucleic acid into cells.A large amount of carriers known in the art can be used for operation nucleic acid, and integrating remark element and promoter are medium to gene.Possible carrier includes, and the virus of such as plasmid or modification is included such as bacteriophage such as λ derivatives, or plasmid such as pBR322 or pUC plasmid derivatives thing, or Bluescript vector.For example, insertion can be realized corresponding to the DNA fragmentation of response element or promoter by connecting suitable DNA fragmentation to the selected carrier with complementary cohesive tennini into suitable carrier.Optionally, the end of DNA molecular can be enzyme modification or any site, can be produced by connecting nucleotide sequence (joint) to DNA ends.Such carrier can be with engineered into selected marker thing gene, and the marker gene is used for the cell that selection markers thing is incorporated into cellular genome.Such label can recognize and/or screen the cell for the albumen for integrating and expressing label coding.

Viral vectors, especially retroviral vector, have been used to the various gene delivery applications to cell and live animal object.Workable viral vectors includes but is not limited to, retrovirus, adeno-associated virus, acne, baculoviral, cowpox, herpe simplex, Epstein-Barr virus, adenovirus, Geminivirus and cauliflower mosaic virus carrier.Non-virus carrier includes plasmid, liposome, charged lipids (cytofectin), DNA- protein complexes, biopolymer.Except nucleic acid, carrier may also include one or more regulatory regions, and/or for screening, detecting and monitoring the selected marker thing (being transferred to which tissue, expression duration etc.) of nucleic acid transfer effect.

Term " plasmid " refers to an extrachromosomal element, generally with one be not a cell central metabolic part gene, and the usually form of circular double stranded DNA molecule.This element can be the single-stranded or double-stranded DNA or RNA of autonomously replicating sequence, genome integration sequence, bacteriophage or nucleotide sequence, linear, ring-type or supercoil, it may be from any source, wherein a large amount of nucleotide sequences have been connected or recombinated into a unique design thing, and the DNA sequence dna and suitable 3 ' non-translated sequence of promoter fragment and selected genes product can be imported into cell by the construction.

" cloning vector " is one " replicon ", and it is such as DNA nucleic acid of unit length, can subsequent duplicate and comprising a replication orgin, such as plasmid, bacteriophage or clay can connect another nucleic acid fragment, so as to occur the duplication of junction fragment.Cloning vector can also replicate in a kind of cell type and express (" shuttle plasmid ") in another cell.

Vector introduction can use methods known in the art into expected host cell, such as transfection, electricity turn, microinjection, transduction, cell fusion, deae dextran, calcium phosphate precipitation, liposome (lysosome fusion), use particle gun, or DNA vector conveyer is (see, for example, Wu etc., 1992, J.Biol.Chem.267：963-967；Wu and Wu, 1988, J.Biol.Chem.263：14621-14624；The Hartmut submitted with 5 days March nineteen ninety etc. Canadian Patent Application No. 2,012,311).

The polynucleotides of the present invention can also be imported with liposome in vivo.The cation lipid of the synthesis for the difficulty and danger for overcoming liposome-mediated transfection to be run into is intended to, available for liposome (Felgner etc., 1987, PNAS 84 for preparing transfection coded markings thing gene in vivo：7413；Mackey etc., 1988.Proc.Natl.Acad.Sci.U.S.A.85：8027-8031；With Ulmer etc., 1993, Science 259：1745-1748).The lipid compounds and composition shifted available for nucleic acid are described in WO95/18863, WO96/17823 and US5,459,127.Lipid is also chemically connected to other molecules (Mackey etc., 1988, see on) for orientation.The peptide of targeting can be chemically attached on liposome, such as hormone or neurotransmitter and albumen such as antibody, or non-peptide molecule.

Other molecules can also be used for promoting the transfection of nucleic acid in vivo, such as cation oligopeptides (such as WO95/21931), from the peptide (such as WO96/25508) of DBP, or cationic polymer (such as WO95/21931).

Also carrier can be imported (referring to US 5,693,622,5,589,466 and 5,580,859) as exposed DNA plasmid in vivo.Receptor-mediated DNA transmission methods (Curiel etc., 1992, Hum.Gene Ther.3 can also be used：147-154；And Wu and Wu, 1987, J.Biol.Chem.262：4429-4432).

Term " transfection " refers to cellular uptake RNA or DNA.When such RNA or DNA have been transferred in cell, cell is by RNA or DNA " transfection ".When the RNA or DNA of transfection cause phenotypic alternation, cell is by RNA or DNA " conversion ".Conversion RNA or DNA can be integrated (covalent attachment) to chromosomal DNA, the genome of modified cells.

" conversion " refers to nucleic acid fragment and is transferred on the genome of host organism, causes succession stable in heredity.Host organisms with transformed nucleic acid fragment are referred to as " transgenosis " or " restructuring " or " conversion " organism.

" gene region " refers to nucleic acid molecules or the region of nucleotide sequence of gene comprising coded polypeptide.

In addition, the recombinant vector of the polynucleotides comprising the present invention may include to be used to expanding or expressing label or selected marker thing in one or more of cell host replication origin.

Term " selected marker thing " represents a recognition factor, usually antibiotic or chemo-resistance gene, can be by being screened based on marker gene effect, resistance i.e. to antibiotic, the resistance to herbicide, colorimetric marker, enzyme, fluorescent marker etc., wherein effect are used for the succession for following the trail of target nucleic acid and/or recognize cell or the organism for having inherited target nucleic acid.The example of selected marker that is known in the art and having used includes：There is provided to ampicillin, streptomysin, gentamicin, kanamycins, hygromycin, the gene of the resistance of double third ammonia phosphorus herbicides, sulfonamide etc.；And the gene as phenotypic markers thing, i.e. anthocyanidin controlling gene, isopentenyl transferase gene etc..

The nucleic acid for the recognition factor that term " reporter gene " presentation code can be identified according to the effect of reporter gene, wherein effect is used for the succession for following the trail of target nucleic acid, to recognize the cell or the organism that have inherited target nucleic acid, and/or measurement base is because of induced expression or transcription.Reporter gene that is known in the art and having used includes：Luciferase (Luc), red fluorescent protein (RFP), cyan fluorescent protein (CFP), yellow fluorescence protein (YFP), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), beta galactosidase (LacZ), GRD beta-glucuronidase (GUS) etc..Selected marker is also considered as reporter gene.

" promoter " refers to the DNA sequence dna that coded sequence or function RNA can be controlled to express.Generally but not it is eternal, coded sequence is located at 3 ' ends of promoter sequence.Promoter can from natural gene or by nature the different elements of different promoters constitute, or even include synthetic DNA fragment.It should be understood by those skilled in the art that different promoter may be guided expression of the gene in different tissues or cell type, or the different phase in development expression, or produce response for varying environment or physiological condition.So that the promoter that gene is expressed in most time in most cell types, commonly referred to as " constitutive promoter ".So that the promoter that gene is expressed in particular cell types, commonly referred to as " cell specificity promotor " or " tissue-specific promoter ".So that the promoter that gene is expressed in the moment of development or cell differentiation, commonly referred to as " development-specific promoter " or " cell differentiation specificity promoter ".The promoter for inducing and causing gene to be expressed after with a kind of medicament for inducing the promoter, biomolecule, chemicals, part, light etc. contact or processing, commonly referred to as " inducible promoter " or " regulation type promoter ".It is also realized that, because as a rule, the actual boundary of regulating and controlling sequence is not determined also completely, the DNA fragmentation of different length there can be similar promoter vigor.

" promoter sequence " is that one kind can combine RNA polymerase in cell and originate the DNA regulatory regions of downstream (3 ' direction) coded sequence transcription.In order to define the present invention, promoter sequence, using transcription initiation site as boundary, and extends to the base or element of the minimum number that upstream (5 ' direction) is needed with the transcription comprising starting higher than the detectable level of background in its 3 ' ends.In promoter sequence, it is possible to find transcription initiation site (is such as defined) by s1 nuclease collection of illustrative plates, and the responsible protein binding domain (concensus sequence) combined with RNA polymerase.

When coded sequence is transcribed into mRNA by RNA polymerase, coded sequence " is controlled by " or " being operably connected " transcription and translation regulating and controlling sequence in cell, then by trans RNA montages (if coded sequence include introne) and translates into the albumen encoded by coded sequence.

" transcription and translation control sequence " is DNA regulating and controlling sequences, such as promoter, enhancer, terminator etc., for expression of the coded sequence in host cell.In eukaryotic, poly-adenosine signal is control sequence.

Term " response element " represents one or more cis-acting DNA elements, and it makes promoter produce response by the interaction with DNA binding structural domains.Response element can be (perfect or faulty) palindromic sequence, or the sequence motifs or half site separated by variable number nucleotides constitute.Half site can be similar or identical, and be arranged in repetition forward or backwards, be used as single half site or the polymer one in front and one in back of adjacent half site.The cell or the characteristic of organism imported according to response element, response element can include a minimal promoter separated from different organisms.DNA binding structural domains are attached on the DNA sequence dna of response element, originate or inhibit the transcription of the downstream gene under response element control.The example of the DNA sequence dna of response element as sterol acceptor of naturally casting off a skin includes RRGG/TTCANTGAC/ACYY (SEQ ID NO：28) (referring to Cherbas L etc., (1991), Genes Dev.5,120-131)；AGGTCAN_(n)AGGTCA, wherein N_(n)Can be one or more introns nucleotides (SEQ ID NO：29) (referring to D ' Avino PP. etc., (1995), Mol.Cell.Endocrinol, 113,1-9)；And GGGTTGAATGAATTT (SEQ ID NO：30) (referring to Antoniewski C. etc., (1994) .Mol.Cell Biol.14,4465-4474).

Term " being operably connected " refers to connects nucleotide sequence in single nucleic acid fragment so that the function of a fragment is influenceed by another.For example, when it can influence expression (i.e. coded sequence is transcribed under the control of promoter) of that coded sequence, promoter is operatively connected on a coded sequence.Coded sequence can justice or the direction of antisense be operatively connected on regulating and controlling sequence.

As used in the present invention, term " expression " refers to the justice (mRNA) from nucleic acid or polynucleotides or the transcription and stable aggregation of antisense RNA.Expression can also refer to mRNA and translate into albumen or polypeptide.

Term " box ", " expression cassette " and " expression casette " refers to the DNA fragmentation that can be inserted into specific restriction site or by homologous recombination in nucleic acid or polynucleotides.DNA fragmentation includes the polynucleotides of an encoding target polypeptide, and box and restriction site are designed, to ensure that the suitable encoder block in transcription and translation inserts box." conversion box " refer to the polynucleotides comprising encoding target polypeptide and also have the box for promoting particular host cell conversion in addition to polynucleotides.The box of the present invention, expression cassette, expression casette can also include the element for make it that the polynucleotides of encoding target polypeptide express rising in host cell.These elements may include but be not limited to, promoter, minimal promoter, enhancer, response element, terminator sequence, poly-adenosine sequence etc..

For purposes of the present invention, term " gene switching " refers to a system based on nuclear receptor, the including but not limited to system based on EcR, when there is one or more parts, regulate and control the expression of at least one target gene, wherein target gene is operatively connected in predetermined response element and promoter.Gene switching can include the polypeptide for forming homodimer or the polypeptide of formation heterodimer.

Term " regulation and control " represents induction, reduction or the expression for suppressing nucleic acid or gene, causes the generation for inducing, reducing or suppressing albumen or polypeptide respectively.

The promoter that the plasmid or carrier of the present invention can also be expressed comprising at least one suitable for driving gene host cell.Term " expression vector " represents carrier, plasmid or the carrier that can express insertion nucleotide sequence after conversion enters host.The gene of clone, that is, the nucleotide sequence inserted, is usually placed under the control of control element, for example promoter, minimal promoter, enhancer etc..Initiation control regions domain or promoter, are substantial amounts of and to be appreciated by those skilled in the art for driving expression of the nucleic acid in expected host cell.In fact, any promoter that can drive these gene expressions is applied to the present invention, include but is not limited to, viral promotors, promoters, Animal Promoters, mammalian promoter, synthetic promoter, constitutive promoter, tissue-specific promoter, development-specific promoter, inducible promoter, light regulation and control promoter；CYC1, HIS3, GAL1, GAL4, GAL10, ADH1, PGK, PHO5, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI, alkaline phosphatase promoter (are used to express in saccharomyces cerevisiae)；AOX1 promoters (are used to express in Pichia pastoris)；Beta-lactamase, lac, ara, tet, trp, lPL, lPR, T7, tac and trc promoters (are used in expression in escherichia coli)；Light regulates and controls promoter, seed specific promoters, pollen specific promoter, ovary-specific promoter, disease occurs or the related promoter of disease, cauliflower mosaic virus 35 S promoter, CMV 35S minimal promoters, cassava vein mosaic virus (CsVMV) promoter, chlorophyll a/b associated proteins promoter, ribulose 1, 5 diphosphonic acid carboxylase promoters, bud specificity promoter, root-specific promoter, chitinase promoter, stress-induced type promoter, rice tungro bacilliform virus promoter, plant super promoter, potato leucine aminopeptidase promoter, nitrate reductase promoter, mannopine synthase promoter, rouge alkali synthetase promoter, ubiquitin promoter, zein promoter, anthocyanidin promoter (is used to express in plant cell)；Animal known in the art and mammalian promoter include but is not limited to, SV40 early stage (SV40e) promoter regions, promoter included in the 3 ' LTRs (LTR) of Rous sarcoma virus (RSV), the E1A of adenovirus (Ad) or the promoter of major late promoter (MLP) gene, cytomegalovirus (CMV) early promoter, herpes simplex virus (HSV) thymidine kinase (TK) promoter, baculoviral IE1 promoters, extension factor 1 α (EF1) promoter, phosphoglyceride kinases (PGK) promoter, ubiquitin (Ubc) promoter, albumin promoter, Mouse Metallothionein-L promoters and the regulating and controlling sequence of transcriptional control regions, promoter (the HPRT of generally existing, vimentin, α-actin, tubulin etc.)；The promoter (desmin, nerve fibre, keratin, GFAP etc.) of median fiber, promoter (the MDR of therapeutic genes, CFTR's or Factor IX promoter etc.), disease occurs or the related promoter of disease, and show tissue specificity and use the promoter of transgenic animals, the active elastase I gene control zone such as in pancreatic acinar cell；The active insulin gene control region in pancreatic beta cell, the active immunoglobulin gene control zone in lymphocyte, in testis, mammary gland, active mouse mammary tumor virus control zone in lymph and mast cell, the active albumin gene in liver, the control zone of apolipoprotein AI and apolipoprotein aii, the active a-fetoprotein gene control zone in liver, the active alpha1-antitrypsin gene-controlled area in liver, in the active beta-globin gene-controlled area of bone marrow cell, the active MBP gene control zone in the oligodendroglia of brain, the active gene-controlled area of myosin light chain -2 in skeletal muscle, and in hypothalamus active gonadotropin releasing hormone gene control zone, pyruvate kinase promoter, fine hair promoter, the promoter of aliphatic acid combination Erepsin, smooth muscle cell alpha Actinin promoter etc..Modified in addition, these expressed sequences can add enhancer or regulating and controlling sequence etc..

Enhancer available for embodiments of the present invention includes but is not limited to：SV40 enhancers, cytomegalovirus (CMV) enhancer, extension factor 1 (EF1) enhancer, Yeast enhancers, viral gene enhancer, etc..

Control zone, i.e. terminator and polyadenylation sequence are terminated, the various genes that also naturally can just have from host.Alternatively, terminator sequence can be unwanted.In an embodiment of the invention, terminating control sequence can include or from the sequence of a synthesis, the polyadenylation signal of synthesis, SV40 late polyadenylation signals, SV40 polyadenylation signals, bovine growth hormone (BGH) polyadenylation signal, virus terminator sequence, etc..

Term " 3 ' non-coding sequence " or " 3 ' non-translational regions (UTR) " refer to the DNA sequence dna positioned at coded sequence downstream, and Polyadenylation [poly (A)] recognition sequence can be included, and coding can influence the other sequences of the adjustment signal of mRNA processing or gene expression.Polyadenylation signal generally has the 3 ' ends that poly-A tail can be influenceed to be added to mRNA precursor.

" control region " represents the nucleotide sequence of regulation and control second nucleotide sequence expression.Control region may include the natural sequence for being responsible for expressing special nucleic acid (homologous region), or may include to be responsible for the different albumen of expression or the even different homing sequences (heterologous area) of synthetic proteins.Particularly, sequence can be with specificity or non specific manner, activated with induction type or non-induced type mode or suppressor transcription protokaryon, eucaryon or virus gene sequence or derived sequence.Control region includes replication origin, and RNA splice sites, promoter, enhancer, transcription terminator, guiding polypeptide enters the signal sequence that target cell secretes path.

Control region from " heterologous " for naturally with the expressed incoherent regulatory region of nucleic acid.Heterolgous regulatory area includes the control region from different plant species, the control region from different genes, hybrid regulatory sequence, and regulating and controlling sequence that is natural non-existent but being designed by the those of ordinary skill of ability language.

" rna transcription sheet " refers to the product for the DNA sequence dna transcription being catalyzed from RNA polymerase.When rna transcription is originally the perfection complementation copy of DNA sequence dna, it is referred to as primary transcription sheet, or it can be the RNA sequence from primary transcription this transcription post-processing, and is referred to as ripe RNA." mRNA (mRNA) " refer to without introne and can by cell translation into albumen RNA." cDNA " refers to mRNA complementations and from mRNA double-stranded DNA." justice " RNA refer to including mRNA and can by cell translation into albumen transcript." antisense RNA " refers to the rna transcription sheet that is all or part of complementary and suppressing target gene expression with objectives Primary transcript or mRNA.The complementary of antisense RNA can be any part with specific gene transcript, i.e., in 5 ' non-coding sequences, 3 ' non-coding sequences or coded sequence." function RNA " or " bioactivity RNA " refers to antisense RNA, ribozyme rna, or does not translate but other RNAs influential on cell processes.

" polypeptide " is a kind of poly-compounds being made up of the amino acid residue being covalently attached.

According to side chain R, amino acid is segmented into 7 groups：(1) aliphatic lateral chain, (2) side chain of hydroxyl (OH) is carried, (3) side chain of sulphur atom is carried, (4) side chain with acid or amide group, (5) side chain of basic group is carried, (6) side chain of aromatic rings, and (7) proline, the imidic acid that a kind of side chain melts with amino are carried.

Term " albumen ", " polypeptide " and " peptide " in the present invention can be with used interchangeably.

" polypeptide of separation " or " albumen of separation " is many peptide or proteins for being substantially free of compound (such as other albumen or polypeptide, nucleic acid, carbohydrate, lipid) combined with it under native state." separation " is not meant to exclude the mixture with other compounds artificial or synthesis, or exists and do not influence the impurity of bioactivity, and may be present for example because not exclusively purifying, add stabilizer, or be added in pharmaceutically acceptable preparation.

" substitution mutant polypeptide " or " substitution mutant " is understood to mean that one includes at least one wild type or naturally occurring amino acid by one relative to wild type or the mutant polypeptide of the different 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor of naturally occurring polypeptide.Substitution mutant polypeptide can include only one wild type or naturally occurring 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor and can be described as " point mutation body " or " single-point mutants " polypeptide.Optionally, substitution mutant polypeptide can be comprising two or more wild types or naturally occurring amino acid by the mutant polypeptide of the two or more 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors different relative to wild type or naturally occurring polypeptide.According to the present invention, the H group nuclear receptor ligands integrated structures domain polypeptide with a substitution mutation includes at least one wild type or naturally occurring amino acid by a 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor different from wild type or naturally occurring H groups nuclear receptor ligands integrated structure domain polypeptide.

When replacing mutant polypeptide to have the substitution of 2 or multiple wild types or naturally occurring amino acid comprising one, the wild type or naturally occurring amino acid that the substitution can include equivalent are lacked from substitution, i.e., two wild types or naturally occurring amino acid are fallen by two non-wildnesses or non-naturally occurring amino acid replacement；Or the wild type or naturally occurring amino acid of non-equivalent are lacked from substitution, i.e., two wild-type amino acids are displaced (substitution+deletion mutation) by a non-wild-type amino acid；Or two wild-type amino acids are displaced (substitution+insertion mutation) by three non-wild-type amino acids.

Substitution mutant can be described with abbreviation naming system, represent amino acid residue and the sequence number being replaced in control polypeptide, and new substituted amino acid residue.For example, the substituted substitution mutant of the 20th amino acid residue of a polypeptide, can be abbreviated as " x20z ", wherein " x " is amino acid to be replaced, " 20 " are the position of amino acid residue or sequence number in polypeptide, and " z " is new substituted amino acid.So, substitution mutant is interchangeably abbreviated as " E20A " or " Glu20Ala ", represents that the mutant substituted for glutamic acid in No. 20 sites of polypeptide comprising an alanine residue (this area is commonly abbreviated as " A " or " Ala ")

(this area is commonly abbreviated as " E " or " Glu ").

Substitution mutation can be prepared with any mutating technology known in the art, be included but is not limited to, external rite-directed mutagenesis (Hutchinson, C. etc., 1978, J.Biol.Chem.253：6551；Zoller and Smith, 1984, DNA 3：479-488；Oliphant etc., 1986, Gene 44：177；Hutchinson etc., 1986, Proc.Natl.Acad.Sci.U.S.A.83：710), use

Joint (Pharmacia Corp, Pharmacia), digestion with restriction enzyme/fragment deletion and substitution, PCR- mediations/oligonucleotides orthomutation etc..The technology of PCR-based can be used for rite-directed mutagenesis, and (H.Erlich published referring to Stockton Press in 1989 is compiled《Round pcr：The principle of DNA cloning and application》The Higuchi's of 6th the 61-70 pages of chapter " uses the engineered DNA " of PCR (Higuchi, 1989, " Using PCR to EngineerDNA ", in PCR Technology：Principles and Applications for DNA Amplification, H.Erlich, ed, Stockton Press, Chapter 6, pp.61-70)).

" polypeptide fragment " is understood to mean that amino acid alignment according to the shorter polypeptide of polypeptide as described in the present invention, and includes the intact part identical amino acid sequence that polypeptide is compareed with these.In due course, such fragment can be included in a larger polypeptide as a part.Such fragment length of polypeptide as described in the present invention can be at least 2,3,4,5,6,8,10,13,14,15,16,17,18,19,20,21,22,25,26,30,35,40,45,50,100,200,240 or 300 amino acid.

" variant " of many peptide or proteins can be any analog, fragment, derivative or mutant, its at least one biological nature for deriving from many peptide or proteins and remaining many peptide or proteins.The different variants of many peptide or proteins can be naturally occurring.These variants can be allelic variant, it is characterised in that encode the nucleotide sequence difference of the structural gene of this albumen, or can include alternatively splicing or posttranslational modification.Those skilled in the art can be produced with single or multiple 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors, missing, insertion or the variant of displacement.These variants may include that especially, (a) one or more amino acid residues are substituted by the variant of conservative or nonconserved amino acid；(b) variant of one or more amino acid residues is added in many peptide or proteins；(c) one or more amino acid include the variant of a substituted radical；And the variant on (d) polypeptide or protein fusion to another polypeptide such as seralbumin.Technology for obtaining these variants, including genetic technique (suppression, missing, mutation etc.), chemical technology and zymotechnic, are with known to the people of ordinary skill.

" heterologous protein " refers to albumen not naturally-produced in cell.

" maturation protein " refers to the polypeptide that any propetide or former peptide have been removed present in the polypeptide by post translational processing, i.e. primary translation product." precursor " albumen refers to the Primary product of mRNA translations, i.e., also there is propetide and former peptide.Propetide and former peptide can be but be not limited to intracellular localization signals.

Term " homology " refers to the percentage in two same sexes of phase between polynucleotides or peptide molecule.From a half molecule to the correspondence another half point subsequence, it can be determined by techniques known in the art.For example, homology can be determined by directly comparing the sequence information between two peptide molecules, by matching sequence information and using existing computer program.Optionally, carry out polynucleotides hybridization under conditions of homologous double-strand that can be by the way that stabilization can be formed between homology region and then digested with single-stranded specific nuclease and determine the size of fragment obtained by digestion to determine.

As used in the present invention, all grammatical forms and the term " homologous " of spelling change, refer to the correlation between the albumen with " common evolutionary source ", homologous protein (such as myosin light chain) (Reeck including the albumen from superfamily (such as immunoglobulin superfamily) and from different plant species, 1987, Cell 50：667).This albumen (and its encoding gene) has sequence homology, shows as their sequences highly similar.However, in same use and directly applying, when with adverbial word such as " height " modification, it is similar and without common evolutionary source that term " homologous " can refer to sequence.

Therefore, the term " sequence similarity " of various grammatical forms, refers to the homogeneity or correspondence degree between nucleic acid or the amino acid sequence of albumen, can have or can not have identical evolution starting point (referring to Reeck etc., 1987, Cell 50：667).

In a particular implementation, when the nucleotides for having at least about 50% (for example, at least about 75%, 90% or 95%) and DNA sequence dna it is determined that length on match when, two DNA sequence dnas are " substantially homologous " or " substantially similar ".Substantially homologous sequence can be by using existing comparison sequence in sequence library, or used in being such as that Southern under high stringency conditions that the particular system is determined hybridizes and is identified.It is determined that suitable hybridization conditions are included in the technology of this area.Referring to such as Sambrook etc., 1989, see on.

As used in the present invention, " substantially similar " refers to nucleic acid sequence fragments, and the change of wherein one or more nucleotide bases causes one or more 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors, but does not influence the functional characteristic of the albumen of DNA sequence encoding." substantially similar " also refers to nucleic acid fragment, and the change of wherein one or more nucleotide bases does not influence nucleic acid fragment to express the ability changed by antisense or co-suppression technology come mediated gene." substantially similar " also refers to the nucleic acid fragment of the modification present invention, for example, lack or insert the one or more nucleotide bases for the functional characteristic for having substantially no effect on gained transcript.Therefore, it should be understood that the present invention is including more more than specific sequence example.Each proposed modification determines the biologos that coded product is kept in the ordinary skill in the art, such as.

And, skilled artisans appreciate that, the substantially similar sequence that this area includes also can by them under high stringency conditions (0.1X SSC, 0.1%SDS, 65 DEG C, and use 2X SSC, 0.1%SDS washings, then 0.1X SSC, 0.1%SDS are used) ability that mutually hybridizes with the sequence enumerated of the present invention determines.The DNA sequence dna for the nucleic acid fragment that the substantially similar nucleic acid fragment of the present invention is reported for DNA sequence dna with the present invention has those nucleic acid fragments of at least 70% identical.The DNA sequence dna that the substantially similar nucleic acid fragment of the present invention includes the nucleic acid fragment that DNA sequence dna is reported with the present invention has those nucleic acid fragments of at least 80% identical.The DNA sequence dna at least 90% of other nucleic acid fragments that similar nucleic acid fragment includes with the present invention is reported substantially is identical.Other similar nucleic acid fragments substantially include the DNA sequence dna of the nucleic acid fragment reported with the present invention and have those nucleic acid fragments of at least 95% identical.

When the amino acid more than about 40% is identical or amino acid more than 60% is similar (function phase is same), two amino acid sequences are " substantially homologous " or " substantially similar ".In one embodiment, similar or homologous sequence is by such as GCG (Genetics Computer groups, GCG is set with the program operation instruction of the 7th edition, Madison, Wisconsin State (Genetics Computer Group, Program Manualfor the GCG Package, Version 7, Madison, Wisconsin)) progression program be compared to determine.

As used in the present invention, term " corresponding to " refers to similar or homologous sequence, definite site can with to determine the molecule of similitude or homology identical or different.Nucleic acid or amino acid alignment may include interval.Therefore, term " corresponding to " refers to sequence similarity, and does not refer to the numbering of amino acid residue or nucleotide base.

" essential part " of amino acid or nucleotide sequence includes the amino acid sequence of enough polypeptides or the nucleotide sequence of gene recognizes that polypeptide or gene to estimate, by the manual sequence estimation of those skilled in the art, or by using such as BLAST (basic Local Alignment Search Tools；Altschul, S.F. etc., (1993) J.Mol.Biol.215：403-410；Referring also to www.ncbi.nlm.nih.gov/BLAST/) scheduling algorithm carry out computer automation sequence compare and recognize.In general, in order to estimate one polypeptide of identification or nucleotide sequence be with known albumen or DNA homolog, 10 or more continuous amino acids or 30 or more a nucleotides are required.In addition, according to nucleotide sequence, the gene specific oligonucleotides probe with 20-30 continuous nucleotide can be used for the gene recognition method (such as Southern hybridization) and separation method (such as bacterial clump or the in situ hybridization of bacteriophage bacterial plaque) that sequence is relied on.In addition, in order to obtain the specific nucleic acid fragment for including primer, the short oligonucleotide of 12-15 base can be used as the amplimer in PCR.Therefore, " essential part " of nucleotide sequence includes enough sequences, for the nucleic acid fragment of specific recognition and/or separation with the sequence.

As it is known in the art, term " same percentage " is the relation between two or more peptide sequences or two or more nucleotide sequences, determined by comparative sequences.In the art, " homogeneity " also refers to the sequence degree of correlation between polypeptide or polynucleotide sequence, and situation can be to match to determine by the rigor of these sequences." homogeneity " and " similarity " can be calculated with known method, including but not limited to those described in the following documents：What the Leski that the Oxford University Press of New York in 1988 is published, A.M. were compiled《Computational molecular biology》(Computational Molecular Biology (Lesk, A.M, ed.) OxfordUniversity Press, New York (1988))；The Smith that new york academic publishing house in 1993 publishes, what D.W. was compiled《Biological computation：Informatics and genome plan》(Biocomputing：Informaticsand Genome Projects (Smith, D.W, ed.) Academic Press, New York (1993))；Griffin, A.M. and Griffin that Ha Menna publishing houses of New Jersey in 1994 publish, what H.G was compiled《The computer analysis of sequence data》First (Computer Analysis of Sequence Data, PartI (Griffin, A.M, and Griffin, H.G, eds.) Humana Press, New Jersey (1994))；The von Heinje that academic press in 1987 is published, what G. was compiled《Sequence analysis in molecular biology》(Sequence Analysis in Molecular Biology (von Heinje, G, ed.) Academic Press (1987))；And Gribskov, M. and the Devereux that the Stockton Press in New York in 1991 publishes, J. volume《Sequence analysis primer》(Sequence Analysis Primer (Gribskov, M.and Devereux, J, eds.) Stockton Press, New York (1991)).Determine that the method for homogeneity is designed as providing the best match between institute's cycle tests.Determine that the method for homogeneity and similitude is programmed in disclosed computer program.The Megalign programs (DNASTAR companies, Madison, Wisconsin State) that sequence alignment and calculating homogeneity percentage can calculate external member with LASERGENE bioinformatics are carried out.The multiple alignment of sequence can (Gap Penalty=10, Gap Length Penalty=10) compare (Higgins and Sharp (1989) CABIOS.5 with Clustal methods using default parameters：151-153) carry out.Can select using Clustal methods carry out in contrast with to default parameters：KTUPLE 1, Gap Penalty=3, window=5 and diagonal=5 preserved.

Term " sequence analysis software " refers to any computerized algorithm or software for nucleotides or amino acid sequence analysis." sequence analysis software " can be commercially available or stand-alone development.Typical sequence analysis software bag includes but is not limited to GCG program assemblies (winconsin external member 9.0 editions, genetic computation group (GCG, Madison, Wisconsin State) (GCG suite of programs (Wisconsin PackageVersion 9.0, Genetics Computer Group (GCG), Madison, WI)), BLASTP, BLASTN, BLASTX (Altschul etc., J.Mol.Biol.215：403-410 (1990), and DNASTAR (DNASTAR companies .1228S. Parkers street, Madison, Wisconsin State 153715, the U.S.) (DNASTAR, Inc.1228S.Park St, Madison, WI 53715USA).But under the situation of the application it should be understood that when sequence alignment software be used for analyze when, " default value " of the result based on program reference of analysis, unless specifically stated otherwise.As used in the present invention, " default value " represents initial handling any value in software or parameter set when software initial start-up.

The oligonucleotides component that " gene of synthesis " can chemically be synthesized using method known to those skilled in the art proceeds by assembling.These components are connected and annealed to produce genetic fragment, enzyme assembling is then carried out, complete gene is built." chemical synthesis ", such as relating to DNA sequence dna, represents that composition nucleotides is assembled in vitro.The synthesis of DNA Manual chemicals can be completed using perfect method is had built up, or automatic chemistry synthesis can be carried out using one of a variety of commercial instruments.Therefore, reflect the codon preference of host cell to optimize according to nucleotide sequence, gene can be transformed to obtain the gene expression of optimization.Those of skill in the art are wished if tended to using the preferred codon of those hosts, can successful expressing gene.When there is sequence information, preferred codon can be determined based on the investigation of the gene from host cell.

As used in the present invention, two or more separately operable gene regulatory systems be known as it is orthogonal, when：A) each given system is regulated and controled by their respective parts under selected concentration, causes the expression degree of target gene in that system to produce detectable change；And b) compared with the expression change of the every other system of operation simultaneously in cell, tissue or organism, change is that no matter actual regulation and control simultaneously or sequentially occur with statistically-significant difference.For example, change that the regulation and control of each separately operable gene regulatory system produce gene expression is higher than every other exercisable system in cell, tissue or organism at least 2 times, 5 times, 10 times, 100 times or 500 times.Completely orthogonal gene switching system can independently regulate and control each group of switches by respective part.A switch target gene expression detectable change of degree in systems, the detectable change for not influenceing the target gene of other operable systems in cell, tissue or organism to express.The present invention can be used for retrieving orthogonal part and the orthogonal gene expression system based on acceptor.

Term " regulation and control " represents given ligand/receptor compound induction or suppressor or the ability of target gene expression.

It is external gene that term " foreign gene ", which is represented for object, i.e., the mutation version of the gene of object, the unmutated version of endogenous mutant gene or endogenous unmutated gene is imported by method for transformation.Endogenous gene can be natural or synthetic gene and the therapeutic genes being imported into DNA or rna form in object, and RNA can play a role for example, by the DNA intermediate of reverse transcriptase.Such gene can be imported into target cell, be importing directly into object, or is imported indirectly by the way that the cell of conversion is transferred in object.Term " therapeutic genes " represents there is the gene of beneficial effect for expressing the host cell of this gene.Therapeutic genes can be for toxin-encoding or for the gene of killing other contributive products of cell.For example, such target gene can be used for treatment of cancer.

Term " receptor complex " is often referred to include the albumen composition of nuclear receptor component, including ecdysterone acceptor (EcR) and/or super valve (USP) albumen (referring to Yao, wait (1993) Nature 366,476-479；Yao etc., (1992) Cell 71,63-72).Functional receptor compound may also comprise other albumen such as immunophilin.The member of steroid receptor family protein, it is known that transcription factor (such as DHR38, β-FTZ-1 or other insect homologues), or EcR and/or USP ligand dependent or the companion of dependent/non-dependent.Receptor complex is alternatively ecdysterone receptor protein and super valve albumen, the heterodimer of the vertebrate homologue of retinoic acid-X- acceptors (" RXR ") albumen.Receptor complex also includes EcR-EcR homodimers or USP-USP homodimers or RXR-RXR homodimers.

Receptor complex can be attached on an albumen of compound to activate by an active steroid or non-steroidal ligands, and the albumen in the compound includes EcR but is not excluded for other albumen of compound.

Nuclear receptor compound includes the albumen of steroid receptor superfamily member, and wherein member is characterised by there are the transactivation domain separated by hinge region of amino terminal, DNA binding structural domains (" DBD ") and ligand binding domains (" LBD ").Some members of family also can have another transactivation domain in LBD c-terminus side.DBD is characterised by there are 2 cysteine zinc finger proteins, midfeather 2 amino acid motifs P-Box and D-Box, and it provides the specificity of response element.These domains can be the chimera of natural, modification or heteroreceptor albumen different structure territory.

Primitive bacteria, prokaryotic such as Escherichia coli, hay bacillus or other enterobacterias, or eukaryotic such as plant or zooblast can be incorporated into by constituting the DNA sequence dna of target gene, response element and receptor complex.These cells can be unicellular or multicellular organism form.The nucleotide sequence of target gene, response element and receptor complex can also be integrated as RNA molecule, such as in the form of function viral RNA such as tobacco mosaic virus (TMV).Vertebrate cells are advantageous, because they naturally lack the molecule of the part response to the present invention.As a result, their parts to the present invention are insensitive.So, cell can grow and express required product, be substantially not subject to the influence of the presence of part in itself.

Term " object " refers to complete plant or animal, or the cell from plant or animal.Also, it is contemplated that when object is fungi or yeast, part equally can be with works fine.When object is complete animal, animal includes vertebrate or mammal.

When being used together with can be incorporated into the receptor complex being connected on target gene response element, part of the invention can be provided temporarily to be regulated and controled to the outside that target gene is expressed.The order that different component be combined with each other is unimportant, i.e., ligand binding is attached to the order of response element to receptor complex and receptor complex.Generally, the regulation and control of target gene expression are receptor complex to be attached on specific control or regulating DNA element to produce response.As other members of steroid receptor family, ecdysterone receptor protein carries at least three domains, a transactivation domain, a DNA binding structural domain and a ligand binding domains.The same with steroid receptor family Asia collection, this acceptor is also comprising the unclear region of the definition for being responsible for Heterodimerization.Part can be coupled to homologous dimerization nanocrystal composition (such as EcR-EcR or USP-USP).One or more receptor domains can produce different mosaic gene switches.Generally, one or more of three domains can be from a source selection different from other structures and source, so that Chimerical receptor is that trans-activation vigor is optimized in selected host cell or organism, combined with the complement of part, and recognize specific response element.In addition, response element can be modified or be replaced by the response element of other DBP domains in itself, GAL-4 albumen for example from yeast is (referring to Sadowski, Deng (1988) Nature, 335,563-564) the LexA albumen or from Escherichia coli is (referring to Brent and Ptashne (1985), Cell, 43,729-736).Chimeric system another advantage is that, they allow according to desired final results, the promoter of selection driving target gene.Such double control is even more important in field of gene, particularly when producing cytotoxic protein, because can the time that reached with control table and the cell expressed.Sequence is under suitable conditions can the specific site for originating transcription.When endogenous or external source the target gene being operatively connected in a suitable promoter is imported into subject cell, the expression of gene is controlled by the presence of the part of the present invention.Promoter can be combined into the regulation and control of type or induction type, or can be that tissue specificity (that is, only being expressed in the cell of specific type) or some stages of development of organism are specific.

Another aspect of the present invention be it is a kind of regulate and control the method for one or more target genes expression in object, including give the part of object effective dose, the part includes the compound of the present invention, and the cell of wherein object is included：

A) receptor complex, comprising：

One DNA binding structural domain；

One ligand binding domains；With

One transactivation domain；And

B) a DNA construction, comprising：

One target gene；

One response element；

Wherein target gene is under the control of response element；And when there is part, DNA binding structural domains are attached on response element, cause the activation or suppression of target gene.

The related fields of the present invention are a kind of endogenous or allogeneic gene expression method to be adjusted in transgenosis object, it is included in subject cell and contacts the part of the present invention with sterol acceptor of casting off a skin, wherein cell includes the DNA binding sequence row for sterol acceptor of casting off a skin, and the expression of the formation induced gene of sterol receptor-ligand of wherein casting off a skin-DNA binding sequence row compound.

As the advantage for the time that control cell produces polypeptide, this aspect of the invention provides another advantage, and in the case of the aggregation meeting damaging cells of this polypeptide, the expression of polypeptide may be limited in short-term.When foreign gene is therapeutic genes, such control is particularly important.Therapeutic genes can be produced the polypeptide for controlling required function by convening.They can also be used for producing damaging or even lethal albumen, for example, can make the albumen of cancer cell death.

The several genes group and cDNA nucleotide sequences for encoding various polypeptides are known in the art.The exogenous genetic material or other target genes that can be used together with the part of the present invention, include the gene of encoding bioactive target protein, such as secreted protein；Enzyme, including can by substrate from noxious material be metabolized as innocuous substance or from inactive metabolism be active material enzyme；Modulin；Cell surface receptor；And other.Available gene also includes the gene for encoding following material：Clotting factor；Hormone such as peptide hormone, insulin, parathyroid hormone, luetinizing hormone releasing factor, α and β sperms chalone and human growth hormone (HGH)；The gene of following albumen is encoded, such as enzyme can cause the generation of pathosis during shortage；The cell factor of coding or the gene of lymphokine, such as interferon, granulocyte macrophage colony stimulating factor, colony-stimulating factor -1, TNF and hematopoietin；Encode the gene of inhibitor material, such as alpha1-antitrypsin；The gene of pharmaceutically-active material, such as diphtheria and cholera toxin are encoded；And other.Available gene also includes available for treatment of cancer and treated the gene of genetic disease.Those skilled in the art result in the nucleic acid sequence information of nearly all known, it is possible to directly obtain nucleic acid molecules from public resource storehouse, the research institute for delivering the sequence, or be prepared using conventional methods the molecule.

In order to which for gene therapy, part of the present invention can be absorbed in pharmaceutically acceptable carrier, such as solution, suspension, tablet, ointment, elixir and injectable composition.Pharmaceutical preparation can include percentage by weight from 0.01% to 99% part.Preparation can be single dose form or multiple dose form.The amount of part in any certain drug preparation depends on effective dose, that is, the dosage required for gene expression needed for exciting or suppressing.

The suitable method of administration of pharmaceutical preparation includes oral, rectum, part (including skin, oral cavity and sublingual), vagina, parenterally (including subcutaneous, intramuscular, intravenous, intracutaneous, intrathecal and Epidural cavity) and is administered, and is administered by nose catheter.It should be understood by those skilled in the art that it is preferred that method of administration depend on treated illness, and can be changed with the state of an illness of such as recipient.

Part of the present invention also can be with other pharmaceutically active compound administering drug combinations.It will be understood by those within the art that can select with the ligand united pharmaceutically active compound used of the present invention, to avoid that adverse reaction occurs on recipient or occur between compound undesirable interaction.It can include with the example of ligand united other pharmaceutically active compounds used,Such as AIDS chemotherapeutics,Amino acid derivativges,Antalgesic,Anesthetic,Anal intestine product,Antacid and anti-flatulence medicine,Antibiotic,Anticoagulant,Antidote,Antifibrinolysis agent,Antihistamine,Antiinflammatory,Antitumor agent,Antiparasitic,Antiprotozoan agent,Antipyretic,Preservative,Anti-spasm and anticholinergic drug,Antiviral agent,Appetite inhibitor,Arthritis drug,BRM,Bone m etabolism conditioning agent,Enteron aisle cathartic,Cardiovascular drugs,Central nervous system stimulant,Brain metabolic improver,Go earwax agent,Anticholinesterase,Flu and cough preparation,Colony stimulating factor,Contraceptive,Cell-protecting,Dental formulations,Deodorant,Dermatology drug,Antidote,Diabetes medicament,Diagnosticum,Anti-diarrhea drug,Dopamine-receptor stimulant,Electrolyte,Enzyme and digester,Ergot preparation,Pregnancy agent,Dietary fiber,Antifungal agent,Overflow breast inhibitor,Acid secretion inhibitors,Gastrointestinal prokinetic agent,Gonadotropin suppressive agent,Hair growth promoting agent,Antianaemics,Hemorheology agent,Styptic,Histamine H2 receptor antagonist,Hormone,Hyperglycaemia agent,Hypolipidemic,Immunodepressant,Laxative,Antileprotic,Leucocyte seprating assistant medicine,Curosurf,Migraine agent,Mucolytic,Muscle relaxant antagonist,Muscle relaxant,Narcotic antagonist,Nasal mist,Vomit medicine,Nucleoside analog,Nutritious supplementary pharmaceutical,Osteoporosis medicine,Oxytocic,Parasympatholytic,Parasympathomimetics,Op parkinson's disease drug,Penicillin adjuvant,Phosphatide,Platelet suppressant drug,Porpharia medicine,Prostaglandin analogue,Prostaglandin,Proton pump inhibitor,Itch disease drug,Psychotropic agent,QNS,Breathe accelerator,Saliva stimulating agents,Salt replacement products,Harden disease drug,Skin trauma medicament,Smoking cessation ancillary drug,Sulfa drug,Block sympathetic nerve medicine,Thrombolytic agent,Gilles de la Tourette's syndrome medicine,Tremble medicine,Pulmonary tuberculosis medicament,Uricosuric eccritic,Urinary tract medicine,Uterine tonic,Uterine relaxant,Vagina medicament,Dizziness agent,Novel vitamin D analogues,Vitamin and medical imaging contrast agent.In some cases, part may be used as the ancillary drug of drug therapy, for example, " closing " one can produce the gene for the enzyme for being metabolized certain certain drug.

For agricultural application, except application as described above, part of the invention can also be used for controlling the expression of insecticidal proteins, such as Dipel (Bt) toxin.Such expression can be that tissue or plant are specific.In addition, particularly when being also required to control plant pest, one or more agricultural chemicals can be used with ligand binding of the present invention, so that extra advantage and effect is provided, including the total access times of reduction compared with the exclusive use of the agricultural chemicals.When using and agricultural chemicals mixture when, according to pending crop, insect pest and/or weeds, the relative scale of each component depends on the relative potency and required cost of use of every kind of agricultural chemicals in the composition.It would be recognized by those skilled in the art that the mixture of agricultural chemicals can provide such as some advantages, such as than a kind of agricultural chemicals more wide spectrum is used alone.The example of the agricultural chemicals of composition, including fungicide, herbicide, insecticide, acaricide and bactericide can be turned into ligand combination as described in the present invention.

Part of the present invention can be used as aqueous spraying by conventional method and is administered on plant leaves, such as traditional high titre hydraulic atomizing, low titre spraying, airblast and aerial spraying.

The host cell of the present invention and non-human organism

The part of gene expression system for regulating and controlling the present invention can be used for the intracellular gene expression of modulate host.Expression in genetically modified host cell can be used for expressing various target genes.The invention provides the part for the controlling gene expression in protokaryon and eukaryotic host cell.Expression in host cell is used to express various target polypeptides, includes but is not limited to, the antigen produced in plant such as vaccine；The enzyme of enzyme, including picture alpha-amylase, phytase, dextranase and zytase, gene to the resistance of insect, nematode, fungi, bacterium, virus and abiotic stress, antigen, health food, medicine are provided, vitamin, for the gene of modified amino acid composition, Herbicid resistant, cold-resistant, drought-enduring and heat resistance, industrial products, grease, albumen, carbohydrate, antioxidant, male sterile plants, flower, fuel, other output type characters, therapeutical peptide, the intermediate of path；Test based on cell, functional genome's test, biotherapeutic protein production, protein group is tested and other.

Host cell can be bacterial cell, fungal cell, elegans cell, insect cell, fish cell, plant cell, birds cell, zooblast, mammalian cell or human body cell.In further embodiment, the present invention relates to the part for the gene expression in modulate host cell, wherein this method is included under conditions of the expression of polypeptides for the nuclear receptor ligands binding structural domain for allowing the substituted mutation of coding-belt, host cell as described above is cultivated in the medium, and separates from culture the nuclear receptor ligands binding structural domain with substituted mutation.

In a particular implementation, the host cell of separation is prokaryotic host cell or eukaryotic host cell.In another particular implementation, the host cell of separation is invertebrate host cell or vertebrate host cell.Such host cell can be selected from：Bacterial cell, fungal cell, yeast cells, elegans cell, insect cell, fish cell, plant cell, birds cell, zooblast and mammalian cell.More specifically, host cell is yeast cells, elegans cell, insect cell, plant cell, zebra fry cell, chicken cell, hamster cell, mouse cell, rat cell, rabbit cell, cat cell, dog cell, ox cell, goat cells, milk cow cell, pig cell, horse cell, ovine cells, ape cell, monkey cells, chimpanzee cell or human body cell.The example of host cell includes but is not limited to, fungi or yeast specie, such as aspergillus, trichoderma, saccharomyces cerevisiae category, pichia, candida, Hansenula；Or bacterial species, such as synechocystis, Synechococcus category, Salmonella, bacillus, acinetobacter, Rhod, streptomyces, Escherichia, pseudomonas, methylomonas, first O- alkanisation Pseudomonas, alcaligenes, synechocystis, necklace Trentepohlia, Thiobacillus, Methanobacterium and Klebsiella；Animal；And mammalian host cell.

In a particular implementation, host cell is elegans cell (Caenorhabditis elegans).

In another particular implementation, host cell is the mammalian cell being selected from the group：Including hamster cell, mouse cell, rat cell, rabbit cell, cat cell, dog cell, ox cell, goat cells, milk cow cell, pig cell, horse cell, ovine cells, monkey cells, chimpanzee cell and human cell.

Transformation of host cells is known in the art, can be included but is not limited to electricity by accomplished in many ways and turn, virus infection, plasmid/carrier transfection, the transfection of non-virus carrier mediation, Agrobacterium-medialed transformation, particle bombardment etc..Gene outcome needed for expression is related to the host cell for cultivating conversion under suitable conditions, and induces the expression of institute's transformed gene.The condition of culture and gene expression method of protokaryon and eukaryotic are well known in the art.Can be with harvesting and according to the specific method of gene outcome come separate gene products.

Furthermore, it is possible to host cell is selected, the polynucleotides expression of the host cell regulation and control insertion, or with required ad hoc fashion modification and processing polypeptides product.There is different hosts cell characteristic and specific mechanism to be used for protein translation and post translational processing and modification.Suitable cell line or host system can be selected, to ensure that the foreign protein to expression carries out required modification and processing.For example, expression can be used for producing non-glycosylated core protein product in bacterial system.Expression can produce glycation product in yeast.The possibility that expression can increase " natural " glycosylation of heterologous protein and fold in eukaryotic.In addition, expression can provide an instrument for being used to recombinating or constituting polypeptide active in mammalian cell.In addition, the possibility influence processing reaction of different carrier/host expression systems reaches different degree, such as protein hydrolysis cutting.The invention further relates to the non-human organism of the host cell of the separation comprising the present invention.

In a particular implementation, non-human organism is prokaryotes body or most eukaryotes.In another particular implementation, non-human organism is spinal animal organism or vertebrate organism.In a particular implementation, non-human organism is non-human mammal.

For example, non-human organism is selected from the group, including bacterium, fungi, yeast, nematode, insect, fish, plant, bird, animal and mammal.More specifically, non-human-organism is yeast, nematode, insect, plant, zebra fish, chicken, hamster, mouse, rat, rabbit, cat, dog, ox, goat, milk cow, pig, horse, sheep, ape, monkey, or chimpanzee.In another particular implementation, non-human-organism is home mouse (Mus musculus).

The Gene expression regulation system of the present invention

The present invention relates to the part that one group can be used for the inducible gene expression system based on nuclear receptor.Particularly, the present invention relates to the part for being capable of genes transactivated by human gene expression regulation system, the Gene expression regulation system includes the expression casette that at least one can be expressed in host cell, the polynucleotides of the polypeptide with nuclear receptor ligands binding structural domain, such as H groups nuclear receptor comprising coding.H groups nuclear receptor ligands combine and are derived from steroid receptor, sterol acceptor of casting off a skin, and are mutated ecdysterone acceptor, all in acceptor, orphan receptor 1, NER-1, steroid hormone and acceptor 1, Retinoid X Receptor action protein -15, liver X receptor β, steroid hormone receptor sample albumen, liver X receptor, Liver X receptor alpha, farnesoid X receptor, Receptor interacting protein 14, fanesol acceptor.In one embodiment, H groups nuclear receptor ligands binding structural domain is from sterol acceptor of casting off a skin.

In a particular implementation, Gene expression regulation system includes the expression casette of the polynucleotides comprising coded polypeptide, the polypeptide includes a transactivation domain, one identification and the DNA binding structural domains of the response element of the gene-correlation of required regulating and expressing, and a H group nuclear receptor ligands binding structural domain with substituted mutation.Gene expression regulation system can also include second expression casette, comprising an i) response element, the DNA binding structural domains identification of polypeptide coded by the first expression casette；Ii) a promoter, the transactivation domain of polypeptide is activated coded by the first expression casette；And iii) expression need the target gene that is regulated and controled.

In another particular implementation, Gene expression regulation system includes an expression casette, the box includes the polynucleotides of an a) coded polypeptide, the polypeptide includes a transactivation domain, one identification needs the DNA binding structural domains of the response element of the gene-correlation regulated and controled, and a H group nuclear receptor ligands binding structural domain with substituted mutation with expression；And b) the second nuclear receptor ligands binding structural domain that is selected from the group, including vertebrate retinoid X receptor ligand binding domains, spinal animal retinoid X receptor ligand binding structural domain, super valve protein ligand binding domain, and include the chimeric ligand binding domain of two polypeptide fragments, wherein the first polypeptide fragment comes from vertebrate retinoid X receptor ligand binding domains, spinal animal retinoid X receptor ligand binding structural domain, or super valve protein ligand binding domain, and second polypeptide fragment from different vertebrate retinoid X receptor ligand binding domains, spinal animal retinoid X receptor ligand binding structural domain or super valve protein ligand binding domain.Gene expression regulation system can also include an i) response element comprising second expression casette, the box, the DNA binding structural domains identification of polypeptide coded by the first expression casette；Ii) a promoter, the transactivation domain of polypeptide is activated coded by the first expression casette；And iii) expression need the target gene that is regulated and controled.

In another particular implementation, Gene expression regulation system includes first expression casette and second expression casette, first expression casette includes the polynucleotides of first polypeptide of coding, first polypeptide needs the DNA binding structural domains and a nuclear receptor ligands binding structural domain of the response element of the gene-correlation regulated and controled comprising an identification with expression, second expression casette includes the polynucleotides of second polypeptide of coding, second polypeptide includes a transactivation domain and a nuclear receptor ligands binding structural domain, one of nuclear receptor ligands binding structural domain is the H group nuclear receptor ligands binding structural domains with substituted mutation.In one embodiment, the first polypeptide is substantially without transactivation domain and the second polypeptide is basic without DNA binding structural domains.For purposes of the present invention, " substantially without " represents that discussed albumen does not include the sequence being enough to provide activation or combine vigor of discussed domain.Gene expression regulation system can be also comprising the 3rd expression casette, and the component includes an i) response element, recognized by the DNA binding structural domains of the first polypeptide of the first expressed sequence element；Ii) a promoter, is activated by the transactivation domain of the second polypeptide of the second expression casette；And iii) expression need the target gene that is regulated and controled.

When only one of which nuclear receptor ligands binding structural domain is the H group ligand binding structural domains with substituted mutation, another nuclear receptor ligands binding structural domain can come from any other nuclear receptor with the H group ligands binding structural domain formation dimer with substituted mutation.For example, when the H group nuclear receptor ligands binding structural domain with substituted mutation is the sterol receptor ligand binding domain of casting off a skin with substituted mutation, other nuclear receptor ligands binding structural domains (" companion ") may be from steroid receptor, cast off a skin sterol acceptor, mammal Retinoid X Receptor (RXR), spinal animal RXR, super valve albumen, or chimeric nuclear receptor, the chimeric nuclear receptor its carry at least two different IPs receptor ligand binding domain polypeptide fragments, selected from vertebrate RXR, spinal animal RXR and USP are (referring to PCT/US01/09050, PCT/US02/05235 and PCT/US02/05706)." companion " nuclear receptor ligands binding structural domain can also include the combination of truncated mutant, deletion mutation, substitution mutation or other modifications or above-mentioned mutation.

In one embodiment, vertebrate RXR ligand binding domains are from people, mouse, rat, chicken, pig, frog, zebra fish (Danio rerio), ascidian or jellyfish (Tripedaliacysophora) RXR.

For example, spinal animal RXR ligand binding domains are to come from locust (migratory locusts, Locustamigratoria) super valve polypeptide (" LmUSP "), hard tick (lone star tick, Amblyommaamericanum) RXR analogs 1 (" AmaRXR1 "), hard tick (lone star tick, Amblyommaamericanum) RXR analogs 2 (" AmaRXR2 "), fiddler crab (Celuca pugilator) RXR analogs (" CpRXR "), beetle (yellow meal worm, Tenebrio molitor) RXR analogs (" TmRXR "), honeybee (Apis mellifera) RXR analogs (" AmRXR "), aphid (black peach aphid, Myzus persicae) RXR analogs (" MpRXR "), or non-Diptera/non-Lepidoptera RXR analogs.

Chimeric RXR ligand binding domains can include at least two polypeptide fragments, selected from vertebrate class RXR polypeptide fragments, spinal animal class RXR polypeptide fragments, and non-Diptera/non-Lepidoptera spinal animal class RXR analogue polypeptide fragments.Chimeric RXR ligand binding domains for the present invention can include the RXR polypeptide fragments of at least two different plant species, or when species are identical, two or more polypeptide fragments may be from two or more different isomers of species RXR polypeptide fragments.

In one embodiment, RXR ligand binding domains are fitted together to and include at least one vertebrate class RXR polypeptide fragment and a spinal animal class RXR polypeptide fragment.

In another embodiment, RXR ligand binding domains are fitted together to and include at least one vertebrate class RXR polypeptide fragment and a non-Diptera/non-Lepidoptera spinal animal class RXR analogue polypeptide fragment.

In a particular implementation, target gene is endogenous gene for host cell.In another particular implementation, target gene is foreign gene for host cell.

In a particular embodiment, the combination of the ligand binding domains and its nuclear receptor ligands binding structural domain companion of part and H group nuclear receptors so that gene expression is suppressed.In a particular implementation, one or more receptor domain differences produce heterozygosis (chimeric) gene switching.Generally, one or more of three domains such as DBD, LBD and transactivation domain may be selected from being different from the source that other structures domain is originated so that the hybrid protein of heterozygous genes and gained optimizes transactivation activity and the compensatory combination of part in selected host cell or organism and recognizes specific response element.In addition, response element can be modified or be replaced by other DBP domains in itself, GAL-4 albumen for example from yeast and the LexA albumen from Escherichia coli, or synthetic reaction element, the synthetic reaction element pair interact specific with the targeting of albumen, the albumen is designed, modifies and screened for specificity interaction, (see, for example, Kim, (1997), Proc.Natl.Acad.Sci are waited to accommodate hybrid receptors, USA, 94：3616-3620).Another advantage of two-hybrid system is that it allows to select the promoter for driving gene expression according to required final effect.Such double control is particularly important in field of gene, especially when producing cytotoxic protein, because the time of expression and the cell expressed all are controllable.When the channel genes being operatively connected in a suitable promoter are into subject cell, the expression of foreign gene is controlled by the system of the present invention.Promoter can be combined into type or inducible regulatory, or can be tissue specificity (that is only being expressed in the cell of specific type) or the specificity of some stages of development for organism.

Sterol acceptor of casting off a skin is a member of nuclear receptor superfamily, and is divided into subfamily 1, and H groups (are referred to as " H groups nuclear receptor ") in the present invention.The member of each group shares 40-60% amino acid identity (Laudet etc. in E (ligand binding) domain, " uniform nomenclature system of nuclear receptor subunit family " (AUnified Nomenclature System for the Nuclear Receptor Subfamily), 1999；Cell97：161-163).Other members of nuclear receptor subunit family 1 (H groups) include：All at acceptor (UR), orphan receptor 1 (OR-1), steroid hormone nuclear receptor 1 (NER-1), Retinoid X Receptor interaction protein -15 (RIP-15), liver X receptor β (LXR β), steroid hormone receptor sample albumen (RLD-1), liver X receptor (LXR), Liver X receptor alpha (LXR α), farnesoid X receptor (FXR), receptor interacting protein 14 (RIP-14), and fanesol acceptor (HRR-1).

Particularly, the present invention describes the Novel Ligands available for the Gene expression regulation system comprising the H group nuclear receptor ligands binding structural domains with substituted mutation.The gene expression system may be based on " single switch " gene expression system, and wherein transactivation domain and DNA binding structural domains is located on the polypeptide coded by one.Optionally, Gene expression regulation system may be based on the Gene expression regulation system of " biswitch " or " double cross ", wherein transactivation domain, and DNA binding structural domains are located on two different coded polypeptides.

The Gene expression regulation system based on sterol acceptor of casting off a skin of the present invention can be heterodimer or homodimer.Feature EcR compounds are often referred to the heterodimeric protein compound of two members of nuclear receptor family, cast off a skin sterol receptor protein and super valve albumen or the USP analogs of vertebrate, Retinoid X Receptor albumen.However, compound is alternatively homodimer.Other members of steroid receptor family protein, referred to as transcription factor (such as DHR38 or β FTZ-1), or EcR, USP and/or RXR ligand dependent or dependent/non-dependent companion.

Sterol receptor complex of casting off a skin generally includes the albumen of nuclear receptor superfamily member, the feature of wherein all members is generally placed at the ligand binding domains (" LBD ") separated in the presence of an amino terminal transactivation domain, a DNA binding structural domain (" DBD ") and one with DBD by hinge area.As used in the present invention, minimum peptide sequence of the term " DNA binding structural domains " comprising a DBP is until the full length sequence of a DBP, as long as DNA binding structural domains play the function of being combined with response element.The member of nuclear receptor superfamily is further characterized in that in the presence of four or five domains：A/B, C, D, E, and in some members for F (referring to US 4,981,784 and Evans, Science 240：889-895(1988))." A/B " domain corresponds to transactivation domain, and " C " corresponds to DNA binding structural domains, and " D " corresponds to hinge area, and " E " corresponds to ligand binding domains.Some members of family with another LBD carboxyl terminal transactivation domain, corresponding to " F ".

DBD is characterised by there are two cysteine zinc fingers, between the two with two amino acid motifs, P-box and D-box, and it provides the specificity to sterol response element of casting off a skin.These domains can be the chimera of natural, modification or heteroreceptor albumen different structure territory.The a subset of EcR acceptors, such as steroid receptor family, it may have be responsible for Heterodimerization in not bery clear and definite region.Because the domain of nuclear receptor is naturally modular, LBD, DBD and transactivation domain can be exchanged.

The method of controlling gene expression of the present invention

The invention provides a kind of method of the goal of regulation and control gene expression in host cell, comprise the following steps：A) Gene expression regulation system of the present invention is imported into host cell；And b) part is imported into host cell, wherein target gene is a component of expression casette, and the box includes an i) response element, the domain that the DNA binding structural domains comprising one by gene expression system are recognized；Ii) a promoter, it is activated by the transactivation domain of gene expression system；And iii) expression needs the target gene that is regulated and controled, once so that part is imported into host cell, the expression of target gene is adjusted.

Present invention also offers a kind of method of controlling gene in host cell expression, comprise the following steps：A) Gene expression regulation system of the present invention is imported into host cell；B) expression casette as described in the present invention is imported into host cell, wherein expression casette includes an i) response element, the domain that the DNA binding structural domains comprising one by gene expression system are recognized；Ii) a promoter, it is activated by the transactivation domain of gene expression system；And iii) expression need the target gene that is regulated and controled；And c) part is imported into host cell, once so that part is imported into host cell, the expression of target gene is adjusted.

The target gene for using method disclosed by the invention regulating and expressing in host cell can be endogenous gene or foreign gene.The nucleic acid or amino acid sequence information of required gene or albumen can be located in one of multiple public databases, such as GENBANK, EMBL, Swiss-Prot and PIR, or in many magazines.Then, these information can be used for construction needed for building, for target gene to be inserted into the expression casette for the method for the invention.

The example of target gene includes but is not limited to：The antigen produced in plant such as vaccine；Enzyme such as alpha-amylase, phytase, dextranase and zytase, there is provided to insect, nematode, fungi, bacterium, the gene of virus and the resistance of abiotic stress, health food, medicine, vitamin, gene for modified amino acid composition, Herbicid resistant, it is cold-resistant, drought-enduring and heat resistance, industrial products, grease, albumen, carbohydrate, antioxidant, male sterile plants, flower, fuel, other output type characters, encode therapeutic expected polypeptide or product can be used for treatment illness, disease, it is disorderly, dysfunction, the gene of genetic defect, such as monoclonal antibody, enzyme, protease, cell factor, interferon, insulin, hematopoietin, toxin, clotting factor, other blood factors or component, viral vectors for gene therapy, virus as vaccine, the target of drug development, functional genome, and proteomic assays and application, and other.

Detect gene expression/transcription

It is a kind of to be detected as detection Intracellular transcription state available for the inventive method, include RNA homogeneity and abundance, such as mRNA classes.Such detection is realized typically by with any of several existing gene expression techniques to determine cDNA abundance.

Nucleic acid array technology is a kind of technology that can be used for determining mRNA differential expressions.This technology includes, such as oligonucleotide chip and DNA microarray.These technologies are based on the DNA fragmentation or oligonucleotides corresponding to different genes or cDNA, and it is immobilized on solid support and hybridized with probe, and the probe is from the preparation of total mRNA ponds of cell, tissue or full organism extraction and is converted into cDNA.Oligonucleotide chip is the oligonucleotide arrays synthesized with photoetching technique in matrix.DNA microarray is the array of DNA sample, usually automates the PCR primer on mechanical printing to slide.Each gene is analyzed with the target DNA sequence of total length or partial-length.

Another abundance for being detected as detecting constitutive protein present in cell by using methods known in the art available for the inventive method, so that it is determined that the translation state of cell.

When needing to recognize the gene related to various physiological functions, the test of some changes of function, the function such as cell growth can be there occurs using detection, Apoptosis, aging, differentiation, adhesion, is attached on a specific molecular, is attached on another cell, cell tissue, organ occurs, intracellular transport, promote transhipment, energy conversion, metabolism, muscle development, neurodevelopment, and/or hematopoiesis.

In addition, selected marker thing or reporter gene expression can be used for detection using the gene expression regulation of the present invention.

Detect that the other method of gene expression product is known in the art, including Southern hybridization (DNA detections), point or slot trace (DNA, RNA), Northern hybridization (RNA), RT-PCR (RNA), western blot (polypeptide detection) and ELISA (polypeptide) analyses.The protein of mark can be used for the specific nucleotide sequence that detection is hybrid with it.

In certain situations it is desirable to the amount of amplifying nucleic acid sequence.This may be by implementing using one or more of a variety of appropriate methods, including, for example, PCR (" PCR "), ligase chain reaction (" LCR "), strand displacement amplification (" SDA "), amplification based on transcription etc..PCR is carried out according to known technique, wherein for example in the presence of a heat-stable DNA polymerase, nucleic acid samples are handled with a pair of Oligonucleolide primers under hybridization conditions.

Conventional method

Standard recombinant dna and molecule clone technology used by the present invention are known in the art, and describe the Sambrook, J., Fritsch that are published in the CSH Press of New York Cold SpringHarbor in 1989, E.F. and Maniatis, T's《Molecular Cloning:A Laboratory guide》(Sambrook, J, Fritsch, E.F.and Maniatis, T.Molecular Cloning：A Laboratory Manual；ColdSpring Harbor Laboratory Press：Cold Spring Harbor, N.Y. (1989) (Maniatis)) and New York Cold SpringHarbor in 1984 CSH Press T.J.Silhavy, M.L.Bennan and L.W.Enquist for publishing《Gene fusion experiments》(T.J.Silhavy, M.L.Bennan, and L.W.Enquist, Experiments with Gene Fusions, Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y. (1984)) and the Ausubel that publishes of Green publishing houses in 1987 and Wei Li International Science Press, F.M etc.《Molecular biology prior art》In (Ausubel, F.M.et al, Current Protocols in Molecular B iology, GreenePublishing Assoc.and Wiley-Interscience (1987)).

The material and method for maintaining and growing suitable for bacterial cultures are known in the art.Technology suitable for the following example can be found in the following documents, American Society of Microbiology's publication of Washington D.C. in 1994《General bacteriology method handbook》(Phillipp Gerhardt, R.G.E.Murray, Ralph N.Costilow, Eugene W.Nester, Willis A.Wood, Noel R.Krieg and G.BriggsPhillips are compiled) (Manual of Methods for General Bacteriology (Phillipp Gerhardt, R.G.E.Murray, Ralph N.Costilow, Eugene W.Nester, Willis A.Wood, Noel R.Krieg and G.Briggs Phillips, eds.), American Society for Microbiology, Washington, DC. (1994))) or Massachusetts in 1989 Sunderland the Thomas D.Brock that publish of Si Nuo affiliated companies《Biotechnology：Industrial microbiology teaching material》The second edition (Thomas D.Brock in Biotechnology：A Textbook of Industrial Microbiology, Second Edition, Sinauer Associates, Inc, Sunderland, MA (1989)).It is all to come from Aldrich Chemical company (Aldrich Chemicals) (Milwaukee for host cell growth and the reagent, Restriction Enzyme and the material that maintain, Wisconsin State), DIFCO laboratories (Detroit, the state of Michigan), GIBCO/BRL (lid plug Regensburg, the Maryland State) or sigma chemical company (Sigma ChemicalCompany) (St. Louis, the Missouri State), unless specifically stated otherwise.

The operation of gene order can complete (winconsin suit 9.0 editions using the suite of programs that can be obtained from Genetics Computer group company, Genetics Computer group (GCG), Madison, Wisconsin State) (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, WI).

The implication of abbreviation is as described below：" h " represents hour," min " represents minute," sec " represents the second," d " represents day," μ L " expressions microlitre," mL " represents milliliter," L " represents to rise," μM " represents micromoles per liter," mM " expression mM/l," M " represents mol/L," mol " expression mole," mmol " expression mM," μ g " represent microgram," mg " represents milligram," A " represents adenine or adenosine," T " represents thymidine or thymidine," G " represents guanine or guanosine," C " represents cytimidine or cytidine," x g " represent time weighting," nt " represents nucleotides," aa " represents amino acid," bp " represents base-pair," kb " represents kilobase pair," k " represents thousand," μ " represents micro-," DEG C " expression degree Celsius," C " expression degree Celsius in chemical equation," THF " represents tetrahydrofuran," DME " represents glycol dimethyl ether," DMF " represents dimethylformamide," NMR " represents nuclear magnetic resonance," psi " expression pound/square inch," TLC " represents thin-layer chromatography," approx. " represents close," cal. " represents what is calculated," cm " expression centimetre," EC50 " represents that the valid density of 50% response is presented," eq " represents equivalent," g " expression gram," i.d. " represents internal diameter," [M] " represents molecular weight," μm ol " represents micromole," N " represents normal concentration," nm " represents nanometer," NMR " represents NMR spectrum," nOe " represents Overhauser effect," NP " represents normal phase," ppm " expression million/," Rf " represents retention factor," RP " represents anti-phase," r.t. " represents room temperature," R.t. " represents retention time," UV " represents ultraviolet," v/v " or " v/v/v " represents volume/volume ratio," w/v " represents weight/volume,And " λ " represents wavelength.

Compound formulation

Chemicals and reagent

Silver oxide (Ag₂O), methyl iodide (CH₃I), iodoethane (CH₃CH₂I), 1- iodopropanes (CH₃CH₂CH₂I), 1- iodobutanes (CH₃CH₂CH₂CH₂I), allyl bromide, bromoallylene (CH₂=CHCH₂Br), benzyl bromide a-bromotoluene (C₆H₅CH₂Br), the bromo- 2- butanone (CH of 1-₃CH₂COCH₂Br), anhydrous N, dinethylformamide (DMF), 2,2-dimethoxypropane (DMP), phenyl boric acid (PBA), single hydrogenation p-methyl benzenesulfonic acid (p-TsOH), tetrahydrofuran (THF), 1,4- dioxanes, Methyl triflate (CF₃SO₂OCH₃), 2,6- di-t-butyl -4- picolines (C₁₄H₂₃N) and p-anisaldehyde be purchased from aldrich company (Aldrich).Celite is purchased from BDH.Minisart filters are purchased from Sai Duolisi companies (Sartorius).Hydrogen peroxide (H₂O₂) 100 times of volumes, sulfuric acid (H₂SO₄), hydrochloric acid (HCl), acetic acid (AcOH), NaOH (NaOH), acetone, ethyl acetate (AcOEt) and HPLC- grades of methanol (MeOH), ethanol (EtOH), chloroform (CHCl₃) and dichloromethane (CH₂Cl₂) purchased from winged generation that scientific ＆ technical corporation (Fisher Scientific).Methanol-d₄Purchased from Gus's scientific instrument Co., Ltd (Goss ScientificInstruments Ltd).20- hydroxyls ecdysterone (20E) be the Russian Academy Of Sciences biological study by Russian Se Ketefu karrs doctor V.Volodin (Syktyvkar, Russia) provide.Ponasterone A (PoA) is provided by Pi Aier and Ren é doctors Lafont of Mary Curie university (Universit é Pierre et Marie Curie).Anhydrous propanone is that solvent is stored in after distilling

Obtained in molecular sieve.

General reactions condition

Anhydrous response condition is to dry Schlenk reaction tube by flame under vacuo and nitrogen or argon atmosphere are introduced before reagent is imported, and transmits liquid using anhydrous solvent and sleeve pipe, and be freeze-dried the steroids as parent material.It is related to Ag₂O reaction is by by Schlenk pipe bag lucifuge in aluminium foil.Reaction is monitored with thin-layer chromatography (TLC) and/or high performance liquid chromatography (HPLC).TLC is to use Merck HPTLC aluminium thin layer 20 × 20cm silica gel 60F₂₅₄(Merck HPTLC aluminum sheets 20×20cmsilica gel 60F₂₅₄) carry out.Plate is observed under ultraviolet light, is then immersed in 5% p-anisaldehyde/5%H₂SO₄Ethanol solution in and heat.The mobility R of compound_fValue represents (R_fThe distance of the distance of=compound movement/solvent front movement).Reaction monitoring is carried out with HPLC need to be spaced at a fixed time to take out isometric reactant mixture from retort, sample is quenched with methanol, centrifuge and with Minisart0.20 μm of filter filtering supernatant.In filtrate decompression concentration, 30% methanol is used: water (v/v) is prepared, and is injected into an analytic type C with DAD₁₈30% to 100% methanol: water of 25min linear gradient is run on-HPLC (being discussed in detail for post is seen below), then the 10min under the methanol of equal strength 100%, flow velocity is 1mL/min and is all monitored at λ=242 and λ=300nm, with the retention time (Rt) according to shown characteristic, and the observation at the specific peak for passing through full ultraviolet spectra, to recognize different products.

Separation, is purified and quantitative

Waters

Vac 35cc C₁₈- 10g extraction columns are used to carry out prepurification to crude product mixture.Sample is loaded as the form of 5% methanol aqueous solution, and the gradient then stepped up with solution strength is washed (methanol aqueous solution of usual 30%, 80% and 100%) come selective elution target compound.Isolated or purified can be carried out by RP- or NP-HPLC, wherein steroids chromophore is seen if there is in 242nm monitoring effluxes to occur, can use gloomy 170 diode array detector (DAD) of gill (Gilson170Diode Array Detector) or the gloomy Single wavelength holochrome/115UV detectors of gill (Gilsonsingle wavelength Holochrome/115UV detector).Analytic type HPLC C₁₈Post (Phenomenex Sphereclone ODS2,5 μm, 150 × 4.60mm or Phenomenex ProdigyODS2,5 μm, 250 × 4.60mm) or C₆Post (Phenomenex Sphereclone, 5 μm, 150 × 4.60 millimeters) or glycol post (Jones Apex II Diol, 5 μm, 150 × 4.60mm or GRACEApex II Diol, 5 μm, 150 × 4.60mm) or silicagel column (Zorbax Sil, 5 μm, 250 × 4.60mm) carry out, it is all use 1mL/min flow velocity.Semi-preparative HPLC is to use C₁₈Post (Phenomenex Sphereclone ODS2,5 μm, 250 × 10mm) or silicagel column (Zorbax Sil, 5 μm, 250 × 9.40mm), or glycol post (GRACE Apex II, 5 μm, 150 × 8.00mm) carry out, all flow velocitys for all using 2mL/min.Preparation HPLC is to use C₁₈Post (PhenomenexSphereclone ODS2,5 μm, 250 × 21.20mm) is carried out under 5mL/min flow velocity.It is quantitatively to carry out ultraviolet spectrophotometry using Shimadzu Corporation UV-2401PC to contain 14 Alpha-hydroxy -7- alkene -6- ketone half molecule (242nm extinction coefficients：12400Lmol^-1cm^-1) and Dacryhainansteronc sample conjugated system (299nm extinction coefficients：14190Lmol^-1cm^-1) compound.Concentration is calculated according to bright Bobi's ear equation (Lambert-Beer equation).

Spectral technique and biological test

Nuclear magnetic resonance (NMR) spectrum record is carried out using the nuclear magnetic resonance spectrometers of Bruker company Avance/DRX 400 under proton frequency 400MHz and carbon frequency 100MHz, or is carried out with Bruker companies ACF300 nuclear magnetic resonance spectrometers under proton frequency 300MHz and carbon frequency 75MHz.Sample is dissolved in deuterated methanol, and internal reference is used as using tetramethylsilane.Chemical shift is represented with million/(ppm).High resolution mass spec is carried out using chemi-ionization pattern (CIMS) or cation fast atom bombardment MS (FABMS) pattern.CIMS is recorded with the Micromass GCT mass spectrographs equipped with direct probe or the Jeol MS700 mass spectrographs equipped with direct probe, and all solvent is used as reacting gas and methanol with methane in the case of two kinds.FABMS is recorded on Jeol MS700 mass spectrographs, matrix is used as reacting gas and " wonderful recipe " (4: 1 mixtures of the thio-L- Soviet Union's butanol of Isosorbide-5-Nitrae-two and Isosorbide-5-Nitrae-dithioerythritol) using xenon, or VG Quattro mass spectrographs, solvent is used as using glycerine matrix and methanol.

Prepare 20E 2,3- acetonides

20E (197.7mg, 411.9 μm of ol) and PBA (58.6mg, 480 μm of ol) are dissolved in dry DMF (4.5mL), and mixture is stirred at room temperature 1 hour in anhydrous conditions.Then p-TsOH (the 39.3mg of fusing are added, 0.5eq, Bunsen burner is gradually heated up preparing until reaching that molten condition removes the crystallization water from single water p-TsOH in blanket of nitrogen) and DMP (2.3mL) anhydrous propanone solution (4.6mL), mixture stirs 3 hours.Then decompression removes acetone and DMP, and mixture is diluted with AcOEt (20mL), with salt water washing (3 × 10mL), and removes organic solvent under reduced pressure.15mL THF/H is added into residue₂O₂9∶1v/v(H₂O₂100 times of volumes, pre-neutralized with 0.1N NaOH), and 2.5 hours maintenance neutral pHs are stirred at room temperature in mixture (pH is reduced naturally, causes 20E2, and 3- acetonides are re-converted into 20E).THF, and mixture 25%MeOH/H are removed with rotary evaporation₂O solution is resuspended, and is cooled to 0 DEG C.Suspension is filtered by cotton-wool and collects precipitation, and residue is reclaimed with MeOH dissolvings, then rotary evaporation produces pure 20E 2,3- acetonides (138.5mg, the of yield=65%)

Prepare 20E 22- methyl ethers

Ag₂O (207.0mg, 10eq) and CH₃I (90 μ L, 15eq) is added in 20E 2, the 1.3mL anhydrous DMF solutions of 3- acetonides (48.0mg, 92.3 μm of ol), and mixture is stirred under room temperature anhydrous condition.After reaction 2.5 hours, mixture is proceeded as follows：AcOEt (25mL) is added, and mixture is filtered with Celite pads, pad is washed and rotary evaporation of solvent with AcOEt (150mL).Then crude product mixture C₁₈

Carry out prepurification, and the semi-preparative C of product₁₈- HPLC system coordinates equicohesive 70%MeOH/H₂O is purified, and which creates 24.1mg (49%) 22- methyl ethers 20E 2,3- acetonides (R.t.=23min).2,3- isopropylidenes are removed to operate as follows：Aqueous HCl (0.1M, 1.0mL) is added dropwise in Isosorbide-5-Nitrae-dioxane solution (1.0mL) of product, and mixture is stirred at room temperature.After reaction 2.5 hours, mixture 5%1,4- dioxanes/H₂O solution dilutes, and uses C₁₈

Prepurification.Then the semi-preparative C of required product₁₈- HPLC (58%MeOH/H₂O) purify, it produces 22 milligrams of (48%) 20E 22- methyl ethers (R.t.=17min).Qualitative obtained using 400MHz NMR analyses (table 3a-3e) and CIMS (is calculated [M+H] comprehensively⁺495.3322. [M+H] is surveyed⁺=495.3348).

Prepare 20E 2- methyl ethers and 20E 3- methyl ethers

Ag₂O (116.0mg, 10eq) is added in freshly prepared 20E 20, the DMF solution (2mL) of 22- phenylboronates (30mg, 53 μm of ol).Add CH in four times during the course of the reaction₃I (258 μ L, 44.7eq), and mixture stirs under room temperature anhydrous condition.After reaction 4 hours, Ag is added again₂O (10eq), and mixture continues stirring 7.5 hours altogether.The progress of reaction and removal phenylboronate such as 20E 2, described in the preparation of 3- acetonides.It is assumed that the semi-preparative C of product₁₈- HPLC system coordinates equicohesive 50%MeOH/H₂O is purified, and has been eluted after wherein 20min and 20E 2- methyl ethers (13mg, 50%) have been eluted after 20E 3- methyl ethers (6mg, 25%) and 23min.It is comprehensively qualitative that (20E 2- methyl ethers are obtained using 400MHz NMR analyses (table 3a-3e) and CIMS：Calculate [M+H]⁺=495.3322, survey [M+H]⁺=495.3337.20E 3- methyl ethers：Calculate [M+H]⁺495.3322, survey [M+H]⁺=495.3344).

Prepare 20E-2,3；20,22- bis- acetonides

20E(236mg；492 μm of ol) it is dissolved in anhydrous conditions in anhydrous propanone (10mL).Also dry DMF (0.5mL) is added to help to dissolve.By p-TsOH (51mg, the 0.2eq of fusing；Prepare as described above) and DMP (0.2mL) be transferred in retort, and mixture is stirred 6 hours under room temperature under nitrogen stream.Then part removes solvent under reduced pressure, and remaining solution is added in AcOEt (100mL) and uses H₂O (50mL) is washed, and is then washed (3 × 50mL) with the NaCl solution of saturation.Organic phase TLC (CHCl₃/MeOH；15: 1, v/v；R_{The acetonides of f20E 2,3,20,22- bis-}=0.35；R_{The mono- acetonide of f 20E 20,22-}=0.13) and analytic type C₁₈- HPLC is analyzed, the acetonides (R.t.=23.2) of 20E 2,3,20,22- bis- and the mono- acetonide of 20E 20,22- (R.t.=19.5min) mixed.The separation of two kinds of products is carried out using open post (2.5i.d. × 25cm) chromatography of silica gel (Merck, Kieselgel 60), uses CH₂Cl₂/ MeOH (17: 1, v/v) elutes 79.7mg (29%) previous compound, and uses CH₂Cl₂/ MeOH (13: 1, v/v) elutes 142.4mg (52%) latter compound.With NMR and CIMS analysis carry out it is qualitative, and find data fit literature value (ecdybase.org.)。

Prepare the methyl ethers of 20E 14

Ag₂O (324.4mg, 20eq) and CH₃I (260 μ L, 60eq) is added in 2,3,20,22- bis- acetonides (39.3mg, 70.2 μm of ol) solution, and mixture is stirred under 60 DEG C of anhydrous conditions.After 3 hours, reactant mixture described in 20E 22- methyl ethers as operated.Remove acetonide group operation as follows：Crude product mixture is dissolved in Isosorbide-5-Nitrae-dioxane (1mL), 70% aqueous AcOH (10mL) is added and is flowed back 8 hours at 80 DEG C, close thermal source and allow mixture to continue to be stirred overnight.Reactant mixture H₂O(50mL；Use n-butyl alcohol presaturation) dilution, and wash (4 × 50mL with n-butyl alcohol；Use H₂O presaturations).The organic phase of mixing is evaporated under reduced pressure, residue C₁₈- HPLC (50%MeOH/H₂O) purify, it produces 4.5mg (13%) 20E 14- methyl ethers (R.t.=21min).Qualitative obtained with 400MHz NMR analyses (table 3a-3e) and CIMS (calculates [M+H] comprehensively⁺=495.3322. surveys [M+H]⁺=495.3317).

Prepare 20E 25- methyl ethers and 20E 22,25- dimethyl ether

Di-t-butyl -4- methyl-pvrimidines (88.8mg, 6eq) and Methyl triflate (47 μ L, 6eq) are added to 20E 2, the anhydrous CH of 3- acetonides (37.5mg, 72.1 μm of ol)₂Cl₂In solution (3mL), mixture is stirred under room temperature anhydrous condition.After 55 hours, Methyl triflate is removed under vacuo, and residue is with HCl (0.1M): and Isosorbide-5-Nitrae-dioxane 1: 1 (v/v) processing is neutralized and removes 2,3- acetonide groups.The purifying of required product coordinates equicohesive 60%MeOH/H using preparative C18-HPLC systems₂O is carried out, and it can collect 11.15mg (31%) 20E 25- methyl ethers (R.t.=20.1min) and 5.63mg (15%) 20E 22,25- dimethyl ethers (R.t.=42.0min).The qualitative use 300MHz NMR of two kinds of compounds analyze (table 3a-3e) and FAB-MS obtains (20E 25- methyl ethers：Calculate [M+H]⁺=495.6690；Survey [M+H]⁺495.4.20E 22,25- dimethyl ether：Calculate [M+H]⁺=509.6960；Survey [M+H]⁺=509.4).

Prepare 20E 22- ethylethers

Ag₂O (534mg, 40eq) and CH₃CH₂I (92 μ L, 20eq) is added in 20E 2, the anhydrous DMF solution (2mL) of 3- acetonides (30mg, 57.7 μm of ol), and reaction is stirred at room temperature in anhydrous conditions.After 28 hours, as described in 20E 22- methyl ethers, operation is reacted and removes 2,3- acetonide groups.It is assumed that the purifying of product uses semi-preparative C₁₈- HPLC coordinates equicohesive 70%MeOH/H₂O is carried out, and it is eluted in R.t.=12min, then coordinates equicohesive CH with semi-preparative silicagel column₂Cl₂/ isopropanol/H₂O (125/30/2, v/v/v), it is eluted in R.t.=19.6min, and produces 5.5mg (19%) 20E 22- ethylethers.Comprehensively qualitative use 400MHz NMR analysis (table 3a-3e) and

CIMS, which is obtained, (to be calculated [M+H]⁺=509.3478. surveys [M+H]⁺=509.3503).

Prepare 20E 22- n-propyl ethers

Ag₂O (208mg, 10eq) and CH₃(CH₂)₂I (187 μ L, 20eq) is added in 20E 2, the anhydrous DMF solution (2mL) of 3- acetonides (50mg, 96.1 μm of ol), and reacts the stirring under room temperature anhydrous condition.After 8 hours, CH is added again₃CH₂CH₂I(20eq).After 24 hours, as described in 20E22- methyl ethers, operation is reacted and removes 2,3- acetonide groups.It is assumed that the purifying of product uses semi-preparative C₁₈- HPLC coordinates equicohesive 70%MeOH/H₂O is carried out, and it is eluted in R.t.=18min, and produces 11.6mg (23%) 20E 22- n-propyl ethers, and qualitative use 400MHz NMR analyses (table 3a-3e) and CIMS, which are obtained, comprehensively (calculates [M+H]⁺=523.3635；Survey [M+H]⁺=523.3613).

Prepare 20E 22- n-butyl ethers

Ag₂O (649.7mg, 40eq) and CH₃(CH₂)₃I (239 μ L, 30eq) is added in 20E 2, the anhydrous DMF solution (3mL) of 3- acetonides (36.4mg, 70.1 μm of ol), and reacts the stirring under room temperature anhydrous condition.CH is added again after 8 hours₃CH₂CH₂I(20eq).After 45 hours, as described in 20E22- methyl ethers, operation is reacted and removes 2,3- acetonide groups.Purify the product preparative C assumed₁₈- HPLC, which coordinates, uses equicohesive 75%MeOH/H₂O is carried out, and it is eluted in R.t.=33min, and produces 11.1mg (30%) 20E 22- n-butyl ethers.Qualitative use 300MHz NMR analyses (table 3a-3e) and FAB-MS, which are obtained, comprehensively (calculates [M+H]⁺=537.7500, survey [M+H]⁺=537.7).

Prepare 20E 22- (28R, S) -2 '-ethyl epoxy ethyl ether

Ag₂O (790.0mg, 40eq) and CH₃CH₂COCH₂Br (391 μ L, 45eq) is added in 20E2, the anhydrous DMF solution (4mL) of 3- acetonides (44.3mg, 85.2 μm of ol), and reacts the stirring under room temperature anhydrous condition.After 72 hours, as described in 20E 22- methyl ethers, operation is reacted and removes 2,3- acetonide groups.Purify the C of the compound preparative assumed₁₈- HPLC is carried out, first by equicohesive 75%MeOH/H₂O systems, it is eluted in R.t.=21min, and then uses equicohesive 70%MeOH/H₂O systems, it is eluted in R.t.=30min, and produces 5.0mg (11%) 20E22- (28R, S) -2 '-ethyl epoxy ethyl ether.Qualitative use 300MHz NMR analyses (table 3a-3e) and FAB-MS, which are obtained, comprehensively (calculates [M+H]⁺=571.7330；Survey [M+H]⁺=551.3).

Prepare 20E 22- allyl ethers

Ag₂O (137.7mg, 10eq) and CH₂=CHCH₂Br (75 μ L, 15eq) is added in 20E 2, the anhydrous DMF solution (2mL) of 3- acetonides (30.9mg, 59.4 μm of ol), and is reacted and stirred under room temperature anhydrous condition, and with TLC (CHCl₃/MeOH；10: 1, v/v；R_{F20E 2,3- acetonide}=0.16；R_{The pi-allyl 20E 2 of f 22,3- acetonides}=0.33) monitor.After 26 hours, as described in 20E 22- methyl ethers, operation is reacted and removes 2,3- acetonide groups.The product that purifying assumes uses preparative C₁₈- HPLC coordinates equicohesive 70%MeOH/H₂O systems are carried out, and it is eluted in R.t.=26min, and produces 11.6mg (38%) 20E 22- allyl ethers.Qualitative use 300MHz NMR analyses (table 3a-3e) and FAB-MS, which are obtained, comprehensively (calculates [M+H]⁺=521.7070, survey [M+H]⁺=521.4).

Prepare 20E 22- benzylic ethers

Ag₂O (139.5mg, 10eq) and C₆H₅CH₂Br (107 μ L, 15eq) is added in 20E 2, the anhydrous DMF solution (2mL) of 3- acetonides (31.3mg, 60.2 μm of ol), and is reacted and stirred under room temperature anhydrous condition, and with TLC (CHCl₃/MeOH；10: 1, v/v；R_f22- benzyls 20E 2,3- acetonides=0.36) monitor.After 72 hours, as described in 20E 22- methyl ethers, operation is reacted and removes 2,3- acetonide groups.Purify the product preparative C assumed₁₈- HPLC system coordinates equicohesive 70%MeOH/H₂O systems are carried out, and it is eluted in R.t.=48min, and produces 3.0mg (9%) 20E22- benzylic ethers.Qualitative use 400MHz NMR analyses (table 3a-3e) and FAB-MS, which are obtained, comprehensively (calculates [M+H]⁺=571.7670；Survey [M+H]⁺=571.2).

Prepare 20E 2,22- dimethyl ethers and 20E 3,22- dimethyl ether

Ag₂O (538mg, 10eq) and CH₃I (210 μ L, 15eq) is added in 20E (108mg, 225 μm of ol) anhydrous DMF solution (3mL), and reaction is stirred under room temperature anhydrous condition.After 1.5 hours, 10eq Ag is added₂O and 15eq CH₃I, after 5h, as described in the methyl ethers of 20E 22, operates mixture.The product that purifying assumes uses semi-preparative C₁₈- HPLC coordinates equicohesive 60%MeOH/H₂O is carried out, wherein 20E 3, and 22- dimethyl ethers eluted (28.4mg, 25%) after 21 minutes and 20E 2,22- dimethyl ether eluted (45.8mg, 40%) after 24 minutes.Qualitative use 400MHz NMR analyses (table 3a-3e) and CIMS obtain (20E 2,22- dimethyl ether comprehensively：Calculate [M+H]⁺509.3478. [M+H] is surveyed⁺=509.3481.20E 3,22- dimethyl ether：Calculate [M+H]⁺=509.3478. surveys [M+H]⁺=509.3486).

Prepare 20E 14,22- dimethyl ethers

Ag₂O (84.7mg, 10eq) and CH₃I (48 μ L, 20eq) is added in 20E 2, the anhydrous DMF solution (1.5mL) of 3- acetonides (19.0mg, 36.5 μm of ol), and reaction is stirred under room temperature anhydrous condition.After reaction 21 hours, Ag is added with 10 hours intervals again₂O (3 × 10eq) and CH₃I(3×20eq).After 51 hours, as described in 20E 22- methyl ethers, operation is reacted and removes 2,3- acetonide groups.Purifying uses semi-preparative C first₁₈- HPLC coordinates equal strength 60%MeOH/H₂O is carried out, wherein have collected 1.9mg main peak R.t.=18min, then coordinates equal strength CH with semi-preparative silicagel column₂Cl₂/ isopropanol/H₂O (160: 30: 1.5, v/v/v), wherein 20E 14,22- dimethyl ethers eluted at 16.3 minutes and produce 1.0mg (6%).Qualitative use 400MHz NMR analyses (table 3a-3e) and CIMS, which are obtained, comprehensively (calculates [M+H]⁺=509.3478. surveys [M+H]⁺=509.3441).

Prepare the tetramethyl ethers of 20E 2,3,14,22-

Ag₂O (1.745g, 23eq) and CH₃I (1.175mL, 60eq) is added in 20E (155mg, 324 μm of ol) anhydrous DMF solution (4.0mL), and reacts the stirring under room temperature anhydrous condition.After 12 hours, 19eq Ag is added again₂O and 60eq CH₃I, 60eqCH is added after then reacting 20 hours₃I.Altogether after 36 hours, as described in the methyl ethers of 20E 22, operation reaction.Purifying uses semi-preparative C₁₈- HPLC coordinates equicohesive 70%MeOH/H₂O is carried out, and wherein 20E 2,3,14,22- tetramethyl ethers eluted after 19 minutes and produce 51mg (30%).Qualitative use 400MHz NMR (table 3a-3e) and CIMS (calculate [M+H]⁺=537.3791. surveys [M+H]⁺=537.3823).One nOe experimental verification C-14 spatial chemistry as (irradiated in H-9 in 20E and make it that 14-OMe signals improve 2.2%).

Prepare PoA 22- methyl ethers and PoA 14,22- dimethyl ether

Ag₂O (960.0mg, 40eq) and CH₃I (129 μ L, 20eq) is added in PoA 2, the anhydrous DMF solution (3.5mL) of 3- acetonides (52.2mg, 135.5 μm of ol), and reacts the stirring under room temperature anhydrous condition.After 23 hours, as described in 20E 22- methyl ethers, operation is reacted and removes 2,3- acetonides.The product that purifying assumes uses sxemiquantitative C₁₈- HPLC coordinates equicohesive 65%MeOH/H₂O acts on 45min, can collect 3.0mg (6%) PoA 22- methyl ethers (R.t.=42min), then repeatedly injects 5mL MeOH, can elute double methyl compounds, then it use preparative C₁₈- HPLC coordinates equicohesive 75%MeOH/H₂O (3.8mg, 8%) is purified.Qualitative use 300MHz NMR analyses (table 3a-3e) and CIMS obtain (PoA 22- methyl ethers comprehensively：Calculate [M+H]⁺=479.3373；Survey [M+H]⁺=479.3369.PoA 14,22- dimethyl ether：Calculate [M+H]⁺493.3529；Survey [M+H]⁺=493.3526).

Prepare Dacryhainansteronc 22- methyl ethers

Dacryhainansteronc 22- methyl ethers are as PoA 2,3- acetonides (61.0mg, 121.0 μm of ol) and Ag₂O (278.0mg, 10eq) and CH₃I (121 μ L, 15eq) methylation reaction accessory substances of 46 hours in dry DMF (1.7mL) are obtained.Dacryhainansteronc sample conjugated system (λ_{It is maximum}=299nm) coordinate DAD monitorings to be detected in λ=300 nanometer using HPLC.Product purification uses preparative C₁₈- HPLC coordinates equicohesive 75%MeOH/H₂O (R.t.=24.7min), then using semi-preparative C₁₈- HPLC coordinates equicohesive 65%MeOH/H₂O (R.t.=26.9min), it produces 1.7mg Dacryhainansteronc 22- methyl ethers (3%).Qualitative use 300MHz NMR analyses (table 3a-3e) and CIMS obtain (Dacryhainansteronc 22- methyl ethers comprehensively：Calculate [M+H]⁺=477.3216；Survey [M+H]⁺=477.3224).

Prepare PoA 2- methyl ethers, PoA 14- methyl ethers, PoA 2,22- dimethyl ethers and PoA 3,22- diformazan Base ether

Ag₂O (590.0mg, 10eq) and CH₃I (238 μ L, 15eq) is added in PoA (118.1mg, 254.6 μm of ol) anhydrous DMF solution (3.3mL), and reacts the stirring under room temperature anhydrous condition.Terminating reaction is to obtain PoA 2 after 18 hours, 22- methyl ethers, or terminating reaction obtains every other product after 46h.In all cases, reaction is operated as described in 20E 22- methyl ethers.The product that purifying assumes uses preparative C₁₈- HPLC coordinates equicohesive 75%MeOH/H₂O is carried out, 6%PoA 2- methyl ethers (R.t.=20.2min), 2%PoA 14- methyl ethers (R.t.=24.7min), 16.0%PoA 2 can be collected, 22- methyl ethers (R.t.=39.7min) and 7%PoA 3,22- methyl ether (R.t.=32.9min).Qualitative use 300MHz NMR analyses (table 3a-3e) and CIMS obtain (PoA 2- methyl ethers comprehensively：Calculate [M+H]⁺=479.3373；Survey [M+H]⁺=479.3388.PoA 14- methyl ethers：Calculate [M+H]⁺=479.3373；Survey [M+H]⁺=479.3363.PoA 3,22- dimethyl ether：Calculate [M+H]⁺=493.3529；Survey [M+H]⁺=493.3528.PoA 2,22- dimethyl ether：Calculate [M+H]⁺=493.3529；Survey [M+H]⁺=493.3525).

During the HPLC retention times of 20E various ether derivants are shown in tables 1 and 2 in different HPLC solvent systems.NMR data from every kind of synthesis compound is summarised in table 3a-3e.

RP- the and NP-HPLC retention times of table 1.20E alkyl ether derivatives^a

^aRetention time is represented with minute

Method A：C₁₈- RP-HPLC (150 × 4.6mm, 5mm granular size, gradient are from 30% to 100% methanol/water, flow velocity=1mL/min, λ=242nm in 25 minutes)

Method B：C₆- RP-HPLC (150 × 4.6mm, 5mm granular size, gradient are from 30% to 100% methanol/water, flow velocity=1mL/min, λ=242nm in 25 minutes)

Method C：Glycol NP-HPLC (150 × 4.6mm, 5mm granular size, gradient are from 2% to 10% ethanol/methylene, flow velocity=1mL/min, λ=242nm in 20 minutes)

Method D：Glycol NP-HPLC (150 × 4.6mm, 5mm granular size, gradient are from 4% to 10% ethanol/methylene, flow velocity=1mL/min, λ=242nm in 20 minutes)

RP- the and NP-HPLC retention times of table 2.POA alkyl ether derivatives^A

^aRetention time is represented with min

Method A：C₁₈- RP-HPLC (150 × 4.6mm, 5mm granular size, gradient are from 0% to 100% methanol/water, flow velocity=1mL/min, λ=242nm and 300nm in 25 minutes)

Method B：C₆- RP-HPLC (150 × 4.6mm, 5mm granular size, gradient are from 30% to 100% methanol/water, flow velocity=1mL/min, λ=242nm and 300nm in 25 minutes)

Method C：Apex II diol NP-HPLC (150 × 4.6mm, 5mm granular size, the dichloromethane solution of the methanol of equal strength 2%, flow velocity=1mL/min, λ=242nm and 300nm)

The NMR data of table 3c.20E 22- alkyl derivatives

Sample is dissolved in methanol-d₄In, chemical shift is represented with million/(ppm)

u.s.s.：Less than solvents signals

^a：¹H-NMR is collected in 400MHz,¹³C-NMR collects in 100MHz

^b：¹H-NMR is collected in 300MHz,¹³C-NMR is collected in 75MHz

^*：For comparing (www.ecdybase.org) with 20E literature values

BII biological tests

All synthesis and purifying compound is in B_IIDetected in biological test, to assess their affinity to sterol acceptor of casting off a skin.The test of steroids response external biological is using fruit bat B_IICell line.The known test is not metabolized and transported substantially indefinite.It is that the cell line, which is expressed, casts off a skin sterol receptor complex and give characteristic response to sterol of casting off a skin, and is detected with nephelometer based on l (2) mbn tumprigenicity blood cell lines from fruit bat.Under normal circumstances, cell carries out mitosis, forms cellule.After being contacted with steroid receptor agonists, cell becomes big and carries out phagocytosis, shows as cell intensive agglomerating；Then absorbance is reduced.Antagonist prevents this reaction, causes cell density to increase；Relative to the control of 20E processing, absorbance will increase.In order to carry out this biological test, testing compound is added in the hole of 96 hole microwell plates (NalgeNunc companies, Hareford, Britain), with several from 10^-3M to 10^-10M concentration adds 20 μ L aliquots, and concentration is 5 × 10^-8M 20 μ L 20E aliquots are added in hole, test antagonism vigor.Plate is cultivated 6-7 days at 25 DEG C.Then quantitatively detected with ELIASA (Anthos htll, this experiment scientific ＆ technical corporation of Antu, Salzburg, Austrian (Anthos htll, Anthos Labtec, Salzburg, Austria)), wherein the mensuration absorbance at 405nm.Test result is shown in Table 4.

Table 4.B_IIBiological test result

Prepare expression casette

Present embodiment describes the structure of expression casette, the box is used for the H group nuclear receptor polynucleotides and polypeptide of the inducible gene expression system based on nuclear receptor comprising one.Applicant constructs a kind of based on Spruce budworm ((choristoneura fumigerana) ECR (CFECR) expression casette.The chimera of ligand binding domains of the reporter construct of the preparation comprising ECR or people RXR-JMUSP or mouse RXR；And a GAL4DNA binding structural domain (DBD) or a VP16 transactivation domain (AD).Reporter construct includes reporter gene luciferase and is operatively connected on the promoter construction of synthesis, and the construction includes the GAL4 response elements combined with GAL4DBD.

3.1-GAL4CfEcR-DEF/VP16-βRXREF-LmUSPEF：From Spruce budworm (choristoneura fumigerana) EcR (" CfEcR-DEF "；SEQ ID NO：1) wild type D, E and F domain, is fused to a GAL4DNA binding structural domain (" Gal4DNABD " or " Gal4DBD "；SEQ ID NO：2) on, and a CMV promoter (SEQ ID NO are placed in：3) under control.People RXR EF domains (" HsRXR β-EF "；SEQ ID NO：4 1-465 nucleotides) 1-8 spirals and migratory locusts super valve albumen EF domains (" LmUSP-EF "；SEQ ID NO：5 403-630 nucleotides) 9-12 spirals be fused to the transactivation domain (" VP16AD " from VP16；SEQ ID NO：6) on, and a SV40e promoter (SEQ ID NO are placed in：7) under control.Five consistent GAL4 response elements binding sites (" 5XGAL4RE "；Including 5 copy include SEQ ID NO：8 GAL4RE) it is fused to TATA minimal promoters (the SEQ ID NO of a synthesis：9) on, and luciferase reporter gene (SEQID NO are placed in：10) upstream.

The CfEcR-DEF/VP16- β RXREF-LmUSPEF of 3.2-GAL4/ mutation：The construction with the above-mentioned identical method of switch 3.1 to prepare, except the CfEcR-DEF of wild type is replaced with the CfEcR-DEF of a mutation, and the CfEcR-DEF of the mutation includes the ligand binding domains of the substitution carried selected from table 5 a mutation.

3.3-GAL4/AaEcR-DEF/VP16-βRXREF-LmUSPEF：The construction with the above-mentioned identical method of switch 3.1 to prepare, except by the CfEcR-DEF of wild type mosquito (Aedes Aegypti) EcR (" AaECR-DEF "；SEQ ID NO：11) wild type DEF domains are replaced.

3.4-GAL4/AmaEcR-DEF/VP16-βRXREF-LmUSPEF：The construction with the above-mentioned identical method of switch 3.1 to prepare, except by the CfEcR-DEF of wild type hard tick (lone star tick) EcR (" AmaEcR-DEF "；SEQ ID NO：12) wild type DEF domains are replaced.

3.5-GAL4/BaEcR-DEF/VP16-βRXREF-LmUSPEF：The construction with the above-mentioned identical method of switch 3.1 to prepare, except by the CfEcR-DEF of wild type aleyrodid (Bemisia argentifolii) EcR (" BaEcR-DEF "；SEQ ID NO：13) wild type DEF domains are replaced.

3.6-GAL4/DmEcR-DEF/VP16-βRXREF-LmUSPEF：The construction with the above-mentioned identical method of switch 3.1 to prepare, except by the CfEcR-DEF of wild type fruit bat (Drosophila melanogaster) EcR (" DmEcR-DEF "；SEQ ID NO：14) wild type DEF domains are replaced.

3.7-GAL4/MsEcR-CDEF/VP16-βRXREF-LmUSPEF：The construction with the above-mentioned identical method of switch 3.1 to prepare, except by the CfEcR-DEF of wild type maduca sexta (Manducasexta) EcR (" MsEcR-DEF "；SEQ ID NO：15) wild type DEF domains are replaced.

3.8-GAL4/NcEcR-DEF/VP16-βRXREF：The construction with the above-mentioned identical method of switch 3.1 to prepare, except by the CfEcR-DEF of wild type leafhopper (rice green leafhopper) EcR (" NcEcR-DEF "；SEQID NO：16) wild type DEF domains are replaced, and RXREF-LmUSPEF mouse RXR (SEQID NO：18) replace.

3.9-GAL4/TmEcR-DEF/VP16-βRXREF：The construction with the above-mentioned identical method of switch 3.1 to prepare, except by the CfEcR-DEF of wild type yellow meal worm (Tenebrio molitor) EcR (" TmEcR-DEF "；SEQ ID NO：17) wild type DEF domains are replaced, and RXREF-LmUSPEF mouse RXR (SEQ ID NO：18) replace.

The substitution of the ligand binding domains (LBD) of the ecdysterone acceptor (" CfEcR ") of the choristoneura fumigerana of table 5

Mutation

The residue important to ligand binding is predicted as based on molecular simulation analysis in EcR ligand bindings, EcR ligand binding domains it is mutated in the EcR from different type organism to change.Table 5 shows that the residue in CfEcR (Lepidoptera EcR) ligand binding domains is mutated, and detects its change combined to steroids and on-steroidal.

Each amino acid substitution mutation listed in table 5 is that the rite-directed mutagenesis mediated by RCR is built in EcRcDNA.CfEcR amino acid V96 is mutated into threonine, and CfEcR amino acid V107 is mutated into isoleucine, and CfEcR amino acid N 119 is mutated into phenylalanine and CfEcR amino acid Y127 is mutated into glutamic acid.CfEcR point mutation can also be manufactured：One includes V96T and N119F substitutions (V96T+N119F), and second includes V107I and Y127E substitutions (V107I+Y127E) [REH3].

PCR rite-directed mutagenesises are carried out using Quikchange site-directed mutagenesis kits (Si Tute genome companies (Stratagene, La Jolla, CA)), and the reaction condition and loop parameter used is as follows.PCR rite-directed mutagenesises use 1x reaction buffers (being provided by manufacturer), 50ng double-stranded DNA templates, 125ng forward primers (FP), the dNTP mixtures (being provided by manufacturer) of 125ng reverse complementals primer (RCP) and 1 μ L, end reaction volume is 50 μ L.Forward primer and reverse complemental primer for producing each EcR mutant are shown in Table 6.Loop parameter used includes, and 95 DEG C of a circulation is denatured 30 seconds, and then 95 DEG C of 16 circulations are denatured anneals 1 minute and 68 DEG C extension minute for 30 seconds, 55 DEG C.

Table 6 is used for the PCR primer for building substitution mutation CfEcR ligand binding domains

Mutant	Primer (SEQ ID NO：)	Primer nucleotide sequences (5 ' to 3 ')
			N119n	Random FP (SEQ ID NO：20)	gcgtacactcgcgacnnntaccgcaaggctggcatgg
N119n	Random RCP (SEQ ID NO：21)	ccatgccagccttgcggtannngtcgcgagtgtacgc
			V96T	FP(SEQ ID NO：22)	ggtaatgatgctccgaaccgcgcgacgatacg
V96T	RCP(SEQ ID NO：23)	cgtatcgtcgcgcggttcggagcatcattacc
			V107I	FP(SEQ ID NO：24)	gcggcctcagacagtattctgttcgcgaac
V107I	RP(SEQ ID NO：25)	gttcgcgaacagaatactgtctgaggccgc
			Y127E	FP(SEQ ID NO：26)	caaggctggcatggccgaggtcatcgagg
Y127E	RP(SEQ ID NO：27)	cctcgatgacctcggccatgccagccttg

Then, as described in above-mentioned embodiment 3.2, the PCR nucleic acid products of each gained encoding mutant EcR ligand binding domains are fused on a GAL4DNA binding structural domain.Then by the way that they and VP16- heterodimers companion are transfected into NIH3T3 cells together in the presence of the various parts of the present invention, test GAL4/ is mutated the vigor of EcR acceptor constructions.

Biology is tested

In order to determine whether the present invention any compound can as mammal trans-activation test in reporter gene vigor inducible factor, in pFRLUC reporter genes and as described in example 3 above the NIH3T3 cells of expression casette 3.1 to 3.9 has been transfected, these compounds are tested.The cell of transfection grows in the presence of the compound of 0.01-33 μM of concentration.Add after part 48 hours, harvesting and tested with Dual-Luciferase test kit (Pu Luomeige companies, Promega).Show total relative light unit (RLU).Cell culture and maintenance method using standard.

Non-steroidal ligand 20- hydroxyls ecdysterone (20E) and ponasterone A are purchased from sigma chemical company (Sigma) and hero company (Invitrogen).All parts are dissolved in DMSO.

DNA is transferred in NIH 3 T 3 cells in vitro (ATCC) as described below.Employ cell culture and the maintenance method of standard.Harvesting and with every 2500 cells in hole, 50 μ L contain 10% hyclone (FBS) growth medium access 96 orifice plates in.After 24 hours, contain dimethyl sulfoxide (DMSO with 35 μ L；Control) or the serum free growth medium of DMSO solution from the part of 0.01-33 μM of 8 dosage handle cell.Then Superfect is used^TM(Kai Jie companies, Qiagen) transfection reagent transfectional cell.For each hole, 0.625 μ L Superfect^TMMixed with 14.2 μ L serum free growth mediums.0.16 μ g reporter constructs and the every kind of acceptor constructions of 0.04 μ g are added into transfection reagent mixtures.The composition of transfection mixture is mixed with vortex oscillator, then places 30min in room temperature.After incubation terminates, 15 μ L transfection mixtures are added into cell.Cell maintains 37 DEG C and 5%CO₂And 5% 48 hours under conditions of serum.

The Bright-Glo that reporter gene test uses Pu Luomeige (promega) company in 48 hours after treatment^TMLuciferase test system detects luciferin enzyme activity according to the explanation of manufacturer.Relative maximum fold induction (Rel Max FI) is defined as the maximum fold induction for being measured body observed in any concentration, relative to the ponasterone A (PoA) observed in any concentration and the maximum fold induction of 20- hydroxyls ecdysterone (20E).EC₅₀Value is calculated with three parameter logistic models from dose response data.Test result is shown in table 7.

Embodiment 1

Disclose the steroids regulatory factor of semi-synthetic gene switching.It is representational to cast off a skin sterol 20- hydroxyls ecdysterone (20E) and ponasterone A (PoA) is the 3- in 2-, 14-, 22- and 25- sites monomethylation and methylate more, or in 22 site monoalkylations.Semi-synthetic steroids is in natural insects system (fruit bat B_IICell) and mammlian system in tested in engineered gene switching system, using Drosophila melanogaster, choristoneura fumigerana and Aedes Aegypti EcR and/or its variant.The 20E and PoA methylated in 22 sites, maintain or improves gene switching effect.The SAR of alkylation steroids shows that 22-OH is a hydrogen bond receptor, and 25-OH is probably a hydrogen bond donor, and 2-OH and 3-OH are donor and/or acceptor each other and with EcR.Generally, the ADME properties calculated with membrane interaction (MI)-QSAR methods show desired trend, and solubility is lower, and permeability is higher, and preferably penetrate blood-brain barrier and the not excessively combination of regulation and control logP or plasma protein.Alkylation shows the steroid activity factor of the improvement of the gene switching technology for gene therapy.

Ligand inducible gene expression system, such as system based on EcR, are highly suitable for gene therapy application.Because the expression of albumen can be controlled, gene switching is incorporated into gene therapy approach being capable of more effectively treating cancer, angiocardiopathy, diabetes, nerve degenerative diseases, motor neuron disease, muscular dystrophy, cystic fibrosis, neuropathic pain, rheumatic arthritis and universal regenerative medicine.In addition, gene switching can be used for diagnosis, the other application in bio-pharmaceuticals, and field, such as test based on cell and animal model are used to develop drug test, and production biopharmaceuticals and biomaterial.The gene switching of insect molting sterol regulation and control is difficult to be regulated and controled by people's endogenous steroid, and shows low-down basic transgene expression, and inductivity is high and dose response scope is wide.

Individual other and several steroids hydroxyls are methylated or are alkylated.Therefore, 23 new semi-synthetic steroids are synthesized, purified and structure distribution.Select the site of alkylation so that the interaction with EcR is maximized.Steroids in cytogene switching system obtained by test.Other favorable properties include that membrane permeability and the resistance to metabolism may be improved.The MI-QSAR ADME of new steroid are calculated and are compared with their non-alkylating homologue.The CoMFA/CoMSIA simulations of these steroids are studied with multidimensional QSAR, with reference to about in natural fruit bat B _II150 previously-known steroids are tested in cell system.New semi-synthetic steroids, which can be used as gene switching activity factor, is used for clinical gene therapy.

Synthesis --- material and method.PoA is provided by the Pi Aier and Ren é Lafont of Mary Curie university (Universit é Pierre etMarie Curie).20- hydroxyls ecdysterone (20E) be the Russian Academy Of Sciences biological study by Russian Se Ketefu karrs (Syktyvkar, Russia) doctor V.Volodin provide.Determined for solubility and logD, PoA is purchased from Axxora/Alexis companies, and 20E and meter Le sterones A is obtained from Sigma-Aldrich Co., Ltd (Sigma-Aldrich).Other reagents and solvent, which are purchased from, flies generation that scientific ＆ technical corporation (Fisher Scientific) and Sigma-Aldrich；Britain's Gus's Scientific Instruments Corporation (Goss Scientific Instruments Ltd) (GreatBaddow, U.K.) is purchased from for the deuterated solvents that NMR is analyzed.Anhydrous propanone and CH₂Cl₂Using preceding distillation.Water for HPLC is deionized, and purity reaches 17ohms.Every other HPLC solvents are using preceding degasification, and 0.45 μm (being used for aqueous solution) or 0.5 μm of (being used for organic solution) Waters Millipore filter are filtered through by pumping.The realization of anhydrous response condition is to dry Schlenk reaction tube and introducing nitrogen or argon atmosphere before reagent is imported by flame under vacuo.Liquid is transmitted using sleeve pipe.Before use, steroids freeze-drying.Silver oxide is set to react lucifuge by using aluminium film parcel.

Reaction is monitored with the systems of HPLC combinations Glison 170 (Anachem Limited, Luton, U.K.) diode array detector (DAD), using Sphereclone ODS2 post (5 μm, 150 × 4.60mm；Phenomenex, Macclesfield, U.K.), receive linear gradient from 30% to 100% methanol aqueous solution more than 25 minutes, followed by the methanol of equal strength 100% of 10 minutes, flow velocity was 1mL/min.Chromatography is monitored in 242nm and 300nm wavelength (λ).Isometric reactant mixture is taken out at interval at a fixed time, and sample is quenched with methanol, is centrifuged and with Minisart 0.20mm filter (Sai Duolisi companies, Ai Pusuomu, Britain (Sartorius, Epsom, U.K.) filtering supernatant.Be concentrated under reduced pressure filter liquor, with 30% methanol: water (v/v) is configured to the minimum volume needed for dissolving, and injects.

Independent steroids ether is implemented by developing suitable HPLC system in separation crude product mixture, and it is related to one or more following methods.(A) semi-preparative C₁₈-HPLC(PhenomenexSphereclone ODS2；250 × 10mm, 5 μm) flow velocity 2mL/min；(B) preparative C₁₈-HPLC(Phenomenex Sphereclone ODS2；250 × 21.20mm, 5 μm of flow velocity=5mL/min)；(C₁/C₂) semi-preparative silicagel column (Kinesis Zorbax Sil；250 × 9.4mm, 5 μm, flow velocity=2mL/min), use equal strength CH₂Cl₂∶2-PrOH∶H₂O 160∶30∶1.5(C₁) or 125: 30: 2.0 (C₂), v/v/v elutions.

The purity of compound is HPLC checkings, uses two kinds of different reversed-phase columns (PhenomenexSphereclone C₁₈And C₆, 5 μm, 150 × 4.60mm) and a normal phase column (Kinesis-GRACEApex II Diol, 5 μm, 150 × 4.60mm), and for except 22 (λ_{It is maximum}=299nm) beyond all compounds be used in λ=242nm Zong Feng regions % represent, to compound 22 use λ=300nm.

Product is quantitatively to use Shimadzu UV-2401PC (Shimadzu Corporations, Mil pauses Keynes, Britain (Shimadzu GB, Milton Keynes, U.K.)) carry out ultraviolet spectrophotometry contain 14 Alpha-hydroxy -7- alkene -6- ketone half molecules (λ_{It is maximum}=242nm, molar extinction coefficient [ε]=12,400Lmol^-1m^-1) or 14- hydroxyls -7,9 (11)-diene -6- ketone half molecules (λ_{It is maximum}=299nm, ε=14,190Lmol^-1cm^-1) compound.Concentration is calculated according to bright Bobi's ear equation (Lambert-Beer equation).

One-dimensional (¹H and¹³C) and two dimension (¹H-¹H COSY,¹H-¹H NOESY,¹H-¹³C HMQC and¹H-¹³C HMBC) NMR spectrum record on the Bruker ACF-300 frequency spectrographs or BrukerAVANCE DRX-400 frequency spectrographs of automation.Sample is dissolved in methanol-d₄In, it is used as internal reference comprising tetramethylsilane (TMS).¹³C frequency spectrums are corrected with the M signal of 49.00ppm methanol heptet.¹H and¹³C chemical shift (δ) is represented with million/(ppm).Width (w when coupling constant (J) and a half height_1/2) value hertz (Hz) expression.

High resolution mass spec is carried out with chemi-ionization pattern (CIMS) or cation fast atom bombardment pattern (FABMS).Recorded with the Micromass GCT mass spectrographs equipped with direct probe or the Jeol MS700 mass spectrographs equipped with direct probe, all solvent is used as reacting gas and methanol with methane in the case of two kinds.Source temperature is 200 DEG C and probe temperature is 500-650 DEG C.FABMS is also recorded on the mass spectrographs of Jeol 700, using xenon as reacting gas, and source temperature is 30 DEG C and is used as matrix using " wonderful recipe " (4: 1 mixtures of the thio-L- Soviet Union's butanol of Isosorbide-5-Nitrae-two and Isosorbide-5-Nitrae-dithioerythritol).

Synthesize the steroids that O- alkyl ether functional groups are carried in 2-OH, 3-OH, 14-OH and/or 22-OH.Before etherificate, by being converted into corresponding 20.22- phenylboronates, 2,3- acetonides or 2,3,20,22- bis- acetonide analogs (Fig. 1), optionally protection originates 2, the 3- and/or 20,22- glycol group on ecdysterone.The step of anabolic steroids ether 1 and 2, follows exemplary embodiment.

Synthesize 20- hydroxyls ecdysterone 2- methyl ethers and 20- hydroxyl ecdysterone 3- methyl ethers.Ag₂O (116.0mg, 10eq) is added to the 20E 20 of fresh configuration, 22- phenylboronates (25a；30mg, 53 μm of ol) DMF solution (2mL) in, under room temperature anhydrous condition stir.Add CH in four times during the course of the reaction₃I (258 μ L, 44.7eq), and add Ag again after 4 hours₂O(10eq).Monitored and reacted with HPLC-DAD.Ethyl acetate (25 milliliters) and mixture Celite (BDH Chemical Co., Ltd.s are added after 7.5 hours, pul, Britain) pad be filtered through porous 4 sintered glass filter tunnel (Weiss-Gallenkamp companies, Britain) filtering.Then ethyl acetate (150mL) washing filter and vacuum evaporating solvent are added.Crude reaction product uses Sep-

Vac 35cc C₁₈- 10g extraction columns (in Waters companies, Esther, Britain) SPE carries out prepurification.Then phenylboronic acid group is removed, by using THF and H₂O₂9: 1 (v/v) mixtures (100 times of volumes are neutralized with NaOH 0.1N in advance) lysate, and stirred 2.5 hours under room temperature and neutral pH, be then diluted with water, evaporate THF and SPE.Crude reaction product purifying uses semi-preparative C₁₈- HPLC (PhenomenexSphereclone ODS2,250 × 10mm, 5 μm, flow velocity=2mL/min, in 242nm) coordinates equicohesive 1: 1CH₃OH/H₂O, wherein eluting 2 (6mg, 25% after 20 minutes；Purity ＞ 99%) and 1 (13mg, 50% of elution after 23 minutes；Purity ＞ 99%).

Synthesize the steroids that O- alkyl ether functional groups are carried in 25-OH：The methyl ether of 20- hydroxyls ecdysterone 25 and 22,25- dimethyl ether.DTBMP (88.8mg, 6eq) and Methyl triflate (47 μ L, 6eq) are added to 20E 2,3- acetonides (25b；37.5mg, 72.1 μm of ol) anhydrous CH₂Cl₂In solution (3mL).Mixture is stirred under room temperature anhydrous condition.After 55 hours, Methyl triflate is removed under vacuum, and handle residue with 1: 1 (v/v) mixture of 0.1M HCl and Isosorbide-5-Nitrae-dioxane.Purify the C that the steroids that methylates uses preparative₁₈- HPLC (Phenomenex SpherecloneODS2,250 × 21.20mm, 5 μm, flow velocity=5mL/min), uses equicohesive 60%CH₃OH/H₂O, yield：11.15mg (31%；Purity ＞ 99%) 10 and 5.63mg (15%；Purity ＞ 99%) 14.

Gene switching test-fruit bat B_IICellular morphology.Using fruit bat B_IICell biological is tested to test the vigor of EcR parts.Test is carried out with four multiple holes.Briefly, the liquid storage (10 of every kind of test compound in methyl alcohol is prepared^-3M to 10^-10M).The aliquot (20 μ L) of each dilution is transferred in the hole of microwell plate and evaporates solvent.About 2 × 10⁵The cell suspension (200 μ L) of cells/ml culture medium is added in each hole, and the plate being capped is cultivated 7 days for 25 DEG C under moist environment.Cell response is detected as the function of steroid concentrations in 405nm with turbidity agent.

Cytogene switch testing-engineering EcR：USP/RXR systems.Cytogene switch testing is carried out by the way that following construction is transfected into MEC (NIH3T3).Wild type D, E and F domain with E274V/V390I/Y410E choristoneura fumigerana EcR, (c) Aedes Aegypti EcR (AaEcR-DEF) being mutated and (d) Drosophila melanogaster EcR (DmEcR-DEF) in (a) choristoneura fumigerana EcR (CfEcR-DEF), (b) E domains is fused on GAL4-DBD and is placed under the control of CMV promoter.Chimeric RXR from people RXR and migratory locusts RXR is fused on VP16-AD and is placed under the control of SV40e promoters.Induction type luciferase reporter plasmid pFRLuc, (Si Tute gene cloning systems, Zuo La, California, the U.S. (StratageneCloning Systems, La Jolla, CA, USA)) minimal promoter comprising 5 GAL4 response elements copied and a synthesis.VgEcR/RXR gene switching systems, employ a heterozygosis EcR, the DBD of three residue mutations with a VP16 activation structures domain and an asymmetric EcR of identification and glucocorticoid receptor response element, purchased from hero company (this shellfish of karr, California, the U.S.), and apply in a similar way, by the way that the carrier wink with luciferase reporter gene is turned into NIH3T3 cells.

NIH3T3 cells are in 37 DEG C and 5%CO₂Under in the DMEM culture mediums for the addition of 10% cow's serum cultivate, all purchased from Min Dake (Mediatech) company in Virginia Manassas city.Cell is layered in 96 orifice plates with the density of 2500 cells/wells, per the μ L growth mediums of hole 50.Next day cell contains dimethyl sulfoxide (DMSO with 35 μ L first；Control) or part DMSO solution serum free growth medium processing.Then transfected per hole cell with the 15 μ L serum free mediums containing 0.04 μ gEcR constructions, 0.04 μ g RXR constructions and 0.16 μ g luciferase reporter constructs, use Superfect^TMTransfection reagent (Kai Jie companies, Qiagen, Valencia, California, the U.S.) is carried out according to the explanation of manufacturer.In 0.01-33 μM of 8 dosage test ligands, and it is all 0.33% to compare and handle the final concentration of DMSO in hole.After processing and transfection are cultivated 48 hours, Bright-Glo is used^TMLuciferase test system (Pu Luomeige companies, Madison, Wisconsin State, the U.S.) illustrates the luciferin enzyme activity of test cell according to manufacturer.

3D-QSAR training sets and test set.With cast off a skin a sterol library and related B_IIEnergy value produces or verified a 3D-QSAR model.Contain 15 kinds of O- alkylation steroids (1-7,9-15and 18) in analysis, and other compounds be separated from plant, purchase or other researchers good intention provide.The purity requirement of all compounds tested for vigor is set as at least 97%.The steroids ether purity of test is at least 98%.Its accuracy is all checked for the structure and activity data in QSAR libraries.

20 steroids branch away one independent test set of generation, the external certificate for model from 3D-QSAR training sets.The selection of test set is carried out using four-dimension QSAR-MS methods, and it calculates chemical similarity score according to four-dimensional fingerprint Molecular similarity matrix.

Molecular simulation and 3D-QSAR analyses.Molecular simulation, comparative molecular field analysis comparative molecular field analysis (CoMFA) and is compared molecular similarity analysis method by index (CoMSIA) and is carried out using SYBYL 7.0.The crystal structure (PDB codings=1R1K) that PoA is attached to the report on tobacco budworm (Hv) EcR is used as molecular template, for selecting QSAR Molecule Sets by conformation.The molecule independence double exposure of any conformation resolution is needed to be formed to HvEcR on the PoA of compound, and the substituent inquired about in steroid skeleton, carry out manual adjustment and make it that the three-dimensional receiving degree of ligand binding pocket is maximized.The compound threedimensional model of gained causes energy minimization using the standard Tripos field of forces and Gasteiger-H ü ckel electric charges, and 17- carbons sterol cores are in line and SYBYL coordinate centers of a lattice are placed on.SYBYL is calculated by MOPAC interfaces using semiempirical MNDO methods (ESP matchings), carrys out distribution portion atomic charge.

For CoMFA, Tripos standard stereos and electrostatic field and the three-dimensional field of indicator, electrostatic field and hydrogen bond are calculated；For CoMSIA, the index of similarity of solid, electrostatic, hydrophobic, hydrogen bond donor and hydrogen bond receptor is obtained, using SYBYL default parameters,

The grid and sp at interval³C⁺¹Probe.Using offset minimum binary (PLS) or sample-analyze and stay (LOO) cross validation apart from offset minimum binary (SAMPLS), CoMFA/CoMSIA field descriptors and the B of compound are found_IIRelation between vigor.0.5 kcal/mol of minimum sigma value (column filter) is used to improve signal to noise ratio.The statistical significance of gained model LOO cross validation coefficients q², and prediction standard difference S_PRESSCome to judge jointly.Final mask is that traditional PLS analyses of non-cross validation are produced, PLS analysis from removing from initial steroids pond after 7 compounds (training set=140 compound) afterwards using the best composition quantity of correspondence LOO cross validation analyses.Model verifies the B for being related to test set_IIVigor predicted value and it is compared with the value observed.

ADME properties.Octane-water partition coefficient (MlogP) of steroids O- alkyl ether analogs is to zoom in and out to determine by the MlogP values of the non-ethers sterol to above calculating.By membrane interaction QSAR (MI-QSAR) model of foundation, to determine Caco-2 cell-penetratings coefficient and blood brain barrier distribution coefficient.MI-QSAR analyses include, in the descriptor pond for developing QSAR models, clearly from the property and feature for simulating every kind of dissolved matter (small molecular organic compounds) transhipment, the dissolved matter includes the training set through the model membrane structure being made up of phosphatide, is in this example dimyristoyl phosphatidyl choline (DMPC) molecule.Analyzed using 3D-FEFF-QSAR, assess the combination of steroids and human serum albumins (HSA).This method calculates the free energy Δ G that steroidal ligands are attached on HSA, and scoring functions are used as using proportional QSAR models.Ka values are obtained from Δ G=RT ln (Ka).Ka=(1/Kb), wherein Kb are binding affinity of the molecule to HSA, it is assumed that with reference to HSA generations are specific to, form binary complex, and there is excessive HSA ([HSA]=0.6mM) compared with ligand concentration.The water-soluble of steroids O- alkylated analogs is determined with AMSOL methods and software.

Physico-chemical tests LogD is detected by adsorption system company (Absorption Systems, Inc).In 1.5mL shaking flask systems, ponasterone A and 20E are 100 μM in isometric pH7.4 buffer solutions and water saturation octane, and multiple holes are detected, standard items are used as using testosterone.Then each shaking flask placed 1 hour at room temperature in shaken at room temperature 60 minutes.The organic layer and water layer being serially diluted are prepared, and coordinates minimum 4 point calibration curve to determine the test compound concentration of each dilution factor with common LC/MS/MS methods.Water solubility is detected by Robertson-Microlit companies.The saturated aqueous solution sample of the happy sterone A of PoA, 20E, rice and diacyl hydrazide is dissolved in HPLC grades of water, stirs 1 at 25 DEG C, 5 and 10 days, is then filtered to obtain the solution of clarification with 0.45 μm of filter.For every kind of material, respectively in 249,248,239nm and 219nm detection ultraviolet absorptivities, it is diluted if desired.Absorbance and reference standards are in the absorbance of identical absorbance maximum, the 1-2% solution of identical steroids in methanol, because solvent effect allows the maximum displacement for having until 10nM.

Synthesize 23 steroids O- alkyl ethers (Fig. 2), include content most abundant insect moulting hormones 20E (25) derivative；The derivative of maximally effective natural one of sterol PoA (26) of casting off a skin；With a kind of derivative of the activator Dacryhainansteronc (27) of the moderate strength with distinguished core texture.20E derivative is 5 kinds of monomethyl ether (1-4 in 2-, 3-, 14-, 22- or 25-OH site, 10), 4 kinds of dimethyl ethers (11-14) in one of 22-OH and 2-, 3-, 14- and 25-OH site, and a kind of tetramethyl ether (15).PoA derivatives are included in 2-, single oxygen methyl ether (16-18) in 14- or 22-OH sites, and 3 with a bis ether functional group kinds of analogs (19-21).In addition to methyl ether, it is prepared for several 20E22-O- ethers analogs, including with until four carbochains O- alkyls (5,6 and 8), and pi-allyl (7), benzyl (8) and 2 '-ethyl epoxy ethyl (23) ether group analog.It can be obtained in the importing methyl of indivedual hydroxyl group sites selectivity by the protection/deprotection strategy shown in Fig. 1, it is related to 2,3- is cis- and/or 20,22- glycol group are converted into acetonide or phenylboric acid salt groups.Can be by the one-pot reaction method since unprotected sterol of casting off a skin come while the analog (16,17,19,20) for preparing monomethylation or methylating more.This method is advantageous in reaction times, but needs carefully to carry out the reaction monitoring of HPLC- drivings, and to cause to methylate higher to the ratio of monomethylation analog more.It is being related to Ag₂O and CH₃In I methylation reaction, the reactivity order for sterol hydroxyl of casting off a skin is 22-OH ＞ 2-OH ＞ 3-OH ＞ ＞ 14-OH.When with Ag₂O/CH₃20E when methylating of the 3rd cis-position 25-OH is not observed in I, by improving the amount of reaction temperature (until 60 DEG C) or reagent, 14-OH can be converted into CH₃O- groups.However, Ag₂O excess significantly or extend contact time, product degradation can be caused, such as dehydration and/or chromophore change.As an appropriate example, at room temperature, extend PoA and Ag₂O/CH₃After I time of contact (46 hours), it was observed that foring with the chromophore (7,9 (11)-diene -6- ketone groups), the PoA derivatives that methylate of DaH 22- methyl ethers (22) changed.The reaction mechanism of hypothesis can relate to by Ag₂O removes one of two 11-H atoms, and then conjugated double bond is to migration.Finding suitable for the replacement O- methylation methods of the chemosensitivity molecule such as sterol of such as casting off a skin, we have found that 6 equivalents, under every kind of 25 DEG C and anhydrous condition in trifluoromethayl sulfonic acid methyl esters and DTBMP, it is steady and selectively promote 20E 2, the 25-OH of 3- acetonides (25b) methylates, and reactivity order is 25-OH ＞ 22-OH ＞ ＞ 14-OH.This method represents a kind of method methylated for the O- of polyhydroxylated steroids newly developed.In our all experiments, 20-OH sites are still difficult to be methylated.

NMR. prepare O- alkyl and cast off a skin sterol 1-23 relative to its parent compound (20E, PoA or DaH)¹H and¹³C spectrum are distributed, and¹H-¹H COSY,¹H-¹³C HMQC and¹H-¹³Detection J is of coupled connections in C HMBC spectrums.In 2-, the second ether substituent in 3- and/or 22- sites¹H signal shows a characteristic High-Field displacement in about 0.4ppm, and with¹³C signal is related, described¹³C signal casts off a skin sterol in about 10ppm generation low field displacements relative to parent.With 14 α-OCH₃The steroids of group is easily from theirs¹Recognized on H-NMR collection of illustrative plates, wherein 9 α-H signal shows about 0.3ppm High-Field displacement (δ_H=2.76-2.78ppm), and they¹³C-NMR collection of illustrative plates, wherein 14-C signals show about 6ppm low field displacement (δ_C=90.95-90.98ppm).α-spatial chemistry of 14- methoxyl groups is confirmed by the irradiation of 9 α-H signal in NOESY experiments, causes 14-OCH₃Signal enhancing 3% (2.97ppm) and 2 α -13% (3.53-3.81ppm) of H signal enhancing.20E 25- methyl ether analogs show an about 5ppm of the 25-C signals (76.16ppm) relative to 20E low field displacement, an about 4ppm of 26-C and 27-C signals (25.52and 25.27ppm) High-Field displacement.In sterol methyl ether analog of casting off a skin¹In H-NMR collection of illustrative plates, from 2 β-OCH₃, 3 β-OCH₃, 14 α-OCH₃, 22-OCH₃And 25-OCH₃Unimodal respectively appear in 3.39,3.40,2.97,3.50 and 3.19ppm.In 20E 22- ethylethers, propyl ether and butyl ether analog¹H-NMR collection of illustrative plates, two protons being connected on the α carbon of 22-OR bases show as diastereo-isomerism signal, δ_HFrom 3.51 to 3.75ppm.23¹In H-NMR collection of illustrative plates, corresponding to 63.54ppm's¹³C signal, two of 3.49ppm and 3.39ppm it is bimodal (²J=12Hz) it is assigned to the paired epoxy ethyl proton of 22- ethyl epoxy ethyls；The 4th of 23 O-C-O groups¹³C signal falls in 110.25ppm.

Fruit bat B_IICell tests (Fig. 3).Drosophila melanogaster B_IICell naturally expresses natural EcR-USP compounds and specificity and quantitative reaction is made to EcR activators and antagonist.O- alkyl steroids 1-23 is in B_IIAgonist efficacies are shown in biological test, concentration range is from 100 μM to 1nM, depending on the quantity of ether substituent and position in molecule.Especially, 20E 2-, 3-, 14- and 25- hydroxyl methylates so that effect is reduced, but 20E 22- methyl ethers (4) remain 20E effect.22- ethylethers analog (5) is more lower slightly than the effect of methyl, and as propyl group, pi-allyl and butyl etc. (6,7,8) alkyl group is bigger, activity difference rises.However, 22-O- benzyl substituents (9) will not be such that 20E effect declines a lot.O- alkylations of the PoA in any site reduces it in B_IIEffect in biological test.

It is engineered EcR/RXR：USP gene switchings.The ability that O- alkyl steroids drives gene expression is detected in the mouse cell lines for the component for having turned inducible type systems in wink.It is main to use two kinds of gene switchings：One Spruce budworm (Cf) EcR (wt-CfEcR-DEF) and another E274V/V390I/Y410E mutant (- CfEcR-DEF of mutation) based on this receptor based on wild type.Coordinate some steroids, the experiment similar with fruit bat (Dm) EcR progress of the yellow fever mosquito (Aa) to identical gene switching pattern.People RXR β and insect USP from migratory locusts are fused on VP16-AD, and the chaperone as EcR.

Assess the effect (EC of steroids₅₀) and effect.The latter, RMFI is calculated as the maximum fold induction in its optimal test concentrations under the conditions of same test relative to on-steroidal diacyl hydrazide EcR activators (30), the maximum fold induction of test ligand.Test and with reference to part fold induction be defined as part induction gene expression and DMSO control induction gene expression multiplying power.

In wild type-CfEcR gene switchings, PoA (26) shows highest induction vigor (EC in surveyed steroids₅₀=0.19 μM, RMFI=~0.18), and the happy sterone A of rice and relatively low (the respectively EC of carinula element B effect₅₀=7.4 μM and~12) and 20E is inactive (EC ₅₀33 μM of ＞).After any site O- alkylations, PoA effect declines, although PoA 22- methyl ethers (18) and Dacryhainansteronc 22- methyl ethers (22) are provided than PoA (RMFI=~0.2) higher fold induction (respectively RMFI=~0.6 and~0.3) in itself.One special 20E O- alkylated analogs, 20E 22- ethylethers (5) reach the 77% of maximum fold induction in about 5 μM of concentration induced reporter genes.

In the CfEcR gene switchings that E274V/V390I/Y410E is mutated, PoA and PoA 22- methyl ethers are the steroids (Fig. 4) put up the best performance：PoA EC₅₀It is worth for 0.1 μM, the EC of PoA 22- methyl ethers₅₀0.7 μM of value, and RMFI values are respectively 0.52 and 0.58.In this switch, the happy sterone A of rice is relatively weak, EC₅₀For 1 μM；And carinula element B is~7 μM.20E is a very weak activator (EC₅₀=20 μM).But after 22- ethylizations, 20E effect is significantly improved, EC₅₀(5 be 0.76 μM；20E be~20 μM) and RMFI (5 be 1.1；20E is 0.12) to improve.Although degree is relatively low, 20E 22- n-propyls (6), 22- butyl (8), 22- benzyls (9) and 25- methyl (10) ether also improve the performance of their parent compounds, and the vigor of 20E 22- allyl ethers (7) is identical with 20E.Therefore, in the CfEcR gene switchings of wild type and E274V/V390I/Y410E mutant forms, PoA 22- methyl ethers are most strong O- alkyl ethers and 20E 22- ethylethers are to be number two.

Some O- alkylation steroids is tested also in the gene switching of same common version, and in addition to the E274V/V390I/Y410E CfEcR being mutated and VgEcR/RXR, wild type AaEcR or wild type DmEcR instead of CfEcR.In the test based on AaEcR- and DmEcR-, the effect sterone A more happy than rice of PoA 22- methyl ethers strong and more stronger than PoA (is respectively EC₅₀=0.38nM and 66nM).For effect, AaEcR systems are all more more sensitive to the standard items PoA (1.1nM) and the happy sterone A (9nM) of rice of PoA 22- methyl ethers and test than CfEcR, but sensitivity is relatively low for effect (for example, PoA：In 1 μM of FI=166 [AaEcR] in 1 μM~900 [CfEcR]).This species diversity is largely that, simply due to AaEcR systems are higher (FI=7.6 [AaEcR] is to 0.7 [CfEcR]) in the background level of "Off" state, rather than the definitely expression of reporter gene is relatively low (RLUs=~1046 [AaEcR] is to 540 [CfEcR]).Relative to AaEcR switches, DmECR switches are more closely similar to CfEcR switches for background transcription, and response is lower in effect.In 3T3 cells, the VgEcR/RXR switch forms above developed are induced by PoA and meter Le sterones A, respectively EC₅₀=0.641 and 0..851 μM, and the EC induced by PoA 22- methyl ethers₅₀=0.553 μM.In comparing, the gene switching based on AaEcR- and DmEcR just produces response in low (AaEcR) and medium (DmEcR) nanomolar concentration to these parts, shows that effect is significantly improved.

Final 3D-QSAR models.The different molecular fields combination of selection, including the three-dimensional fields of CoMFA and electrostatic field, CoMSIA H- key donors, H- keys acceptor and hydrophobic field, and polar surface area (PSA), are casted off a skin sterol library with best representative.The statistics of the 3D-QSAR models of gained is summarized in fig .15.

Steroids and EcR gene switchings in gene therapy.EcR gene switchings are verified to be used in cell and tissue culture, and animal model.Effect highest part is main to be represented by two kinds of chemical types：The steroids of the diacyl hydrazide of synthesis and natural typically plant origin.Representative in two groups has all been used successfully in the EcR gene switchings in scale-model investigation.From the point of view of bioavailability angle; diacyl hydrazide has II type ADME characters (solubility is low, and logP is high, and permeability is high) and the site not almost being metabolized easily; and sterol solubility of casting off a skin is higher, logP is relatively low and has many hydroxyls for being easily metabolized or being coupled.

The O- alkyl for having synthesized 23 kinds of 20E, PoA and DaH is casted off a skin sterol analog.Obtain 20E and PoA all monomethyl ethers, except (a) PoA 3- methyl ethers, can only be methylated with 22- together with obtain, and (b) 20- methyl ethers, because verified 20- hydroxyls do not have reactivity.Common synthesis is depended on respectively to 2,3- and 20, the perfect ketal and borate glycerol protection strategy of 22- glycol groups.Synthesize 20E 22- methyl ethers (4) and 22- ethylethers (5) and separate 20E 25- methyl ether (polypody sterones, 10 from fern iron fan princess Polypodium aureum L.) had been described before this research, but gene switching test is not used it in past research.

Cytogene switch testing has used two kinds of gene switching patterns to test ether 1-23 gene switching effect, and simply have studied with several parts the 3rd pattern.First is natural fruit bat B_IICell line.B_IICell line derives from the haemocyte of tumprigenicity haemocyte mutant (l [2] mbn).B_IISignal of the steroids as an induced phagocytosis is added in cell, and cell develops into the larger cell mass with clear area from cellule layer.This response can be quantified with turbidity.

Second of gene switching pattern is the heterodimer pair of engineering.It employs EcR ligand binding domains and is connected on bacterium GAL-4DNA binding structural domains, once it contact part, and locust-people RXR that the heterozygosis in the activation structure domain of virus VP 16 is connected to one is combined.This compound is subsequently incorporated on the GAL-4 response elements of luciferase reporter gene upstream, and the expression of luciferase reporter gene provides a fluorescence reading.Whole switching system is the transient expression in mouse 3T3 cells.The EcR-LBD variants for having used this to switch, wherein LBD sequences derive from choristoneura fumigerana (Spruce budworm, CfEcR), Aedes Aegypti (mosquito, AaEcR) and Drosophila melanogaster (fruit bat, DmEcR) (Fig. 8).In addition, the discovery of testing over can improve the CfEcR mutation variants (E274V/V390I/Y410E) of entirety EcR part sensitivity.In each case, all other composition of test system is consistent, except testing several steroids in different 3T3cells clone.

The 3rd gene switching pattern for several compounds is the VgEcR/RXR systems from DmEcR in the past for mouse In vivo study.

The QSAR of steroids is quantified --- and 22-O- alkyl sterol of casting off a skin retains or improved the induction vigor of their parent compounds.According to whether there is one or more methyl caps to anchor point, steroids is matched, and calculate fruit bat B_IIEffect difference (Fig. 6) in test.With the relation between 2-, 3-, 14-, the single ether substitution in 22- and 25- sites 20E and PoA ether derivants (1-10,16-18,22-23) can immediately arrive at effect difference and specific OH-group group caps.On an average, methylating for each hydroxyl group sites causes effect to reduce, according to following EC₅₀The suppression order of log units sorts：14-OH (2.12), 2-OH (1.67), 25-OH (1.09), 3-OH (1.06) and 22-OH (0.35).It may be evident, however, that the 22- for having 5 in 9 steroids methylates, including 20E (4 ,-logEC in itself₅₀=8.20) so that effect is moderately improved.Multiple methylate usually enhances its effect.

The gene switching system of engineering all shows some difference responses in effect and SAR details.In the steroids tested on wild type CfEcR, only 20E 22- ethyoxyls ether 5 shows effect and significantly improves (EC than 20E₅₀=485 μM, RMFI=0.77), 20E is a substantially inactive steroids in this test.In the CfEcR gene switchings test that E274V/V390I/Y410E is mutated, 5 constitute a sizable improvement (EC again₅₀=0.76 μM, RMFI=1.10) relative to parent 20E (EC₅₀=~20 μM, RMFI=0.12).Other 22- ethers, such as n-propyl ether and benzylic ether will also result in improvement.Unexpectedly, the happy sterone A of rice and carinula element B all in the gene switching of CfEcR patterns than in B_IIIt is weaker in test.

For wild type CfEcR, once hydroxymethylation, PoA just loses effect and effect.But for CfEcR E274V/V390I/Y410E mutant, efficient PoA (EC₅₀=0.10 μM, RMFI=0.52) loss of effectiveness it is much smaller, and also in fact obtain after 22- methylates effect (18, EC₅₀=0.70 μM, RMFI=0.58), so as to obtain required effect, metabolism and Penetration Signature.AaEcR and DmEcR in identical two-hybrid system of this trend in mouse 3T3 cells have continued.Coordinate AaEcR, in (the EC of 1.10nM 18₅₀=0.38nM) it is higher than PoA effect；Coordinate DmECR, it is equivalent in~66nM.However, in the VgEcR/RXR systems based on fruit bat, the 18 higher (EC of equal with PoA and meter Le sterone A effect or possible effect₅₀=533nM/RMFI=1.5 is to being respectively EC₅₀=641nM/RMFI=1.5 and EC₅₀=851nM/RMFI=1.3), so as to be considered to be the optimal ligand of the system.In brief, PoA can methylate in 22- sites, produce the structure for lacking a hydroxyl but remaining vigor.Further, since the physicochemical property of methoxylation structure should be more preferable, it may be more potential in itself than PoA in treatment use.We show that 22-O- alkyl (methyl, ethyl, propyl group) and 22-O- benzyl steroids remain or improved the induction vigor of their parent compounds.

ADME.Sterol ether of casting off a skin has a good ADME feature.For exemplary steroids ether and reference composite thing, the several ADME characters-water solubilitys of calculating, LogP (MlogP), blood brain barrier (BBB) are penetrated, Caco-2 cell permeabilities and human serum albumins (HSA) combine (Fig. 7).

Solubility.The value that the PoA and 20E of calculating are water-soluble with experiment is obtained is consistent (being respectively 0.18mg/mL and 6.7mg/mL).Generally, solubility is improved (the happy sterone A ＞ 20E ＞ PoA of such as rice) with hydroxyl quantity；Correspondingly, hydroxyl, which is capped, generally reduces solubility.Noticeable exception is 20E22- alkyl ethers.For example, the solubility outline of steroids 5 (20E 22-O- ethyoxyls ether) and 7 (20E 22-O- allyl ethers) is higher than their parent compounds with free 20,22- glycol.One explanation is, compared with 22- alkyl analogs, and the intramolecular hydrogen bond of 20E 20,22- glycol causes the reduction of hydrotropy intramolecular hydrogen bond, and it is only involved in the effect of 20-OH donors/22-OH acceptors, and is limited by more thermokinetics with solvent hydrogen bond.In a similar manner, 22-OH/25-OH intramolecular hydrogen bonds effect may also be significant.Methylated the intramolecular hydrogen bond in having upset 22-OH donors/25-OH receptor actings in 20E O-22, smaller to PoA than PoA22- methoxy-ether is suppressed to the water-soluble of 20E so as to result in 20E 22- methoxy-ethers, PoA lacks 25-OH, so such intramolecular hydrogen bond can not be formed.For diacyl hydrazide 30, to calculate and differ~3 orders of magnitude between water-soluble (3.6mg/mL) and observation water-soluble (6.2 μ g/mL).Experimentally, diacyl hydrazide is the material easily crystallized.Possible this solubility contradiction discloses the physical behavio(u)r that a MI-QSAR model does not illustrate.

Mlog P valuesAs water solubility, MlogP values are identical with alkylation trend.Equally, 22- alkylations are an exceptions；For the reason for trend identical intramolecular bond water-soluble with influence, the alkylation in this site can actually reduce MlogP.MlogP has over-evaluated experiment value：20E logD_Experiment=0.01 (logP_Calculate=1.25)；PoA logD_Experiment=1.95 (logP_Calculate=2.19).

Blood brain barrier separatesMolecule is the logarithm (logBB) of BBB partition coefficients through the measurement of BBB abilities, and it is equal to log (C_Brain/C_Blood), wherein C_BrainIt is concentration and C of the compound in brain_BloodIt is the concentration of compound in blood.Experimental data is separated according to the BBB delivered, log (BB) values ＞ 0.3 shows that compound is easily accessible in brain, and log (BB) values ＜ -1 shows that analysis is hardly entered in brain.Our ADME estimations show that moderately distribution enters in brain (- 0.89 ＜ log (BB) ＜ -0.35) 20E, PoA and meter Le sterone A.On the other hand, O- alkyl ethers sterol shows the ability raising through BBB, especially PoA 2- methyl ethers (16：Log (BB)=0.16) and PoA 22- methyl ethers (18：Log (BB)=0.23).For potential central nervous system (CNS) therapeutic agent, it is desirable to log (BB) be on the occasion of.Equally, calculating log (BB) value of 20E O- alkyl ethers analog is higher than 20E.

PermeabilityCaco-2 infiltration coefficients (the P of some steroids_Caco-2) determined using the Caco-2 Premeabilisation of cells QSAR models set up.As shown in Figure 7, from rice happy sterone A to 20E to PoA, P_Caco-2Value gradually increases, while molecule lipophilicity (MlogP values) increase and water-soluble reduction.With parent molecules PoA (19 × 10^-6Cel) to compare, PoA O- alkyl ether derivatives 16,18 and 20 show equal or higher P_Caco-2Value is (from 20 × 10^-6To 29 × 10^-6Cel)；With parent compound 20E (16.3 × 10^-6Cel) to compare, 20E O- alkyl ether derivatives 4,5,7,10 and 14 are also equivalent or are easier infiltration Caco-2 cells (14-24 × 10^-6Cel).These results show to cast off a skin oral bioavailability of oxygen-ether derivant of sterol is improved.

Detect the physics and chemistry and absorbent properties for sterol of casting off a skinA)Caco II testing permeabilities：The individual layer Caco-2 cells (n=2) converged,

Supported in hole 21-28 days, test steroids, pH 7.4 ± 0.2 are all added in top side and bottom side.At 120 minutes the permeability of top side-bottom side (A-B) and bottom side-top side (B-A) was determined from every side draw sample.Minimum four point calibrations curve is coordinated to detect the concentration of test compound using common LC/MS/MS methods.It is characterized as (Papp A → B) ＜ 1.0 × 10^-6It is low that the material of cel is considered as permeability.More than this value, then permeability is high.If flowing out ＞ 3.0 and (Papp B → A) ＞ 1.0X10^-6Cel, it is believed that material there occurs obvious outflow；B)Plasma protein binding test：Dialyse hole (n=2), each dialysis hole side carries pH 7.4 phosphate buffer solution, the opposite side in hole carries the other human plasma of Combination, adds test steroids.After 37 DEG C, about 24 hours, the blood plasma side and buffer solution side in each hole are sampled, and is analyzed with LC/MS/MS.These experiments are carried out by absorption system Co., Ltd (Absorption Systems, Inc), and the results are shown in Table 8.

Table 8

Plasma protein is combinedHSA binding affinities are drug discovery and the important pharmacokinetic property considered in exploitation.HSA combines the dissolving that allow for hydrophobic molecule in the circulatory system.Compound is to determine that compound is distributed to one of destination organization and his principal element of bioavilability with sero-abluminous bond strength.As shown in fig. 7, sterol of casting off a skin shows similar HSA binding affinities, from 2.1 × 10^-4To 3.8 × 10^-4(Ka values).It is 20E 22- ethylethers (5) that HSA, which combines minimum compound, in set, and it is also that MlogP values are minimum and water-soluble highest of calculating in the ether of set.It is PoA 3 that HSA, which combines most strong compound, 22- dimethyl ethers (20), and it is also MlogP values highest and to be in the calculating in the relatively low scope of water solubility of sterol of casting off a skin in the ether of set.Therefore, cast off a skin sterol HSA combine it is universal related between the hydrophobicity and water solubility of compound.

Metabolism and excretion.The half-life period that 20E is estimated in the mankind is 9 hours.Known metabolin includes dehydroxylation, the reduction of B- rings, C-3 epimerism and the product of 20,22- glycol cutting in mouse, rat and people.From the first principle, and above, alkylation caps the example for improving metabolic stability, and sterol of casting off a skin alkylation ether should be easier to restore from dehydroxylation, oxidation cutting and conjugation reaction than corresponding non-ether；O- must be carried out first takes off alkyl step.

It is to improve a kind of effective means that the physicochemical property of sterol of casting off a skin especially is metabolized that OH, which is capped,.A kind of overall balance can be realized by alkylation：In order to improve defective property (metabolism is unstable, remove), regulate and control excessive property (i.e. water-soluble and hydrophily).This need not sacrifice effect and be achieved that.

Semi-synthetic sterol of casting off a skin is as medicine.Steroids, including sterol of casting off a skin represent the gene switching part in addition to diacyl hydrazide, and it is another chemical type available for the switching system based on EcR.

Alkylation strategy disclosed by the invention has regulated and controled the ADME properties of influence bioavailability and medicine delivery parameter.22-O- alkylations represent a kind of modification.Such alkylation provides the gene therapy that modified form steroid activator is used to switch activation.By being methylated to sterol hydroxyl of specifically casting off a skin, we establish the physicochemical property of the pharmacology correlation of the sterol of casting off a skin of improvement, and maintain or improve the effect for selected EcR.

Hydroxyl, which is added, in 2,3,14,20 and 22 sites improves effect, and the hydroxylating in 25 sites reduces effect.However, the CfEcR and Atyiplex canescen sterone activation Bemisia argentifolii BaEcR of the activation E274V/V390I/Y410E mutation of some part/EcR compositions for peeling off, such as cyasterone, show the direction design that relative effectivenes invert and show orthogonal gene switching.Steroids-tail contact residues V411 and M502 is explained corresponding to two threonines in BaEcR in the CfEcR that effect reversion between both ligand/receptors pair can be mutated with E274V/V390I/Y410E.In general, Lepidoptera and non-Lepidoptera can mutually be made a distinction by CfEcR-V411 V to T/N/S change.Another effect reversion is also observed in E274V/V390I/Y410E mutant and carinula element B activation Aedes Aegypti (Aa) EcR for the CfEcR that cyasterone is acted on.

Embodiment 2

In a common double hybrid gene switching mode, we test the vigor that a set of 42 steroids represent 10 EcR of 9 kinds of arthropod species to one group；From B_IIThe data of test and VGECR/RXR gene switchings are illustrated in the text.Trend and the reversion of uncommon effect are also arranged in the table.Compare EcR sequences, section out the contact residues from existing crystal structure (LBD comes from Lepidoptera noctuid [Hv], Semiptera Bemisia tabaci [Bt] and beetle red flour beetle [Tc]), and marked substituent on part change and acceptor on effect correlation between residue pattern.SAR outliers disclose a part matched somebody with somebody in volumetric data set.Identification effect is inverted for building orthogonal gene switching.

We identify new receiving and rubbed steroids/EcR compositions of level and subnanomole level.We also illustrate the more extensive EcR garbled datas on several rare steroids.Assess the responsibility of the EcR sequences in double cross gene switching pattern, Basal activity and dynamic range.Two undesirable steroids/EcR orthogonalities have also been identified and assessed with regard to EcR LBD sequences.

Material and method

Separation, purifying and anabolic steroidsSemi-synthetic steroids 20E 2- methyl ethers；20E 3- methyl ethers, 20E 22- methyl ethers, 20E 2,22- dimethyl ethers, 20E 3,33- dimethyl ethers, 20E 2,3,14,22- tetramethyl ethers, 20- hydroxyl ecdysterone 22-O- pyrroles Lip river carboxylate, and the α propionic esters of Turkesterone -11, the α capronates of Turkesterone -11, the α decylates of Turkesterone -11 are from 20E or Turkesterone preparation.Remaining steroids is extracted from vegetable material, and except ponasterone A, it is also to be synthesized from 20- hydroxyls ecdysterone.The happy sterone A of rice is purchased from AG science Co., Ltd (AG Scientific Inc) (San Diego, California).Following compounds are provided by other researchers good intention：2- deoxidation ecdysterones, ecdysterone, 2- deoxidations -20- hydroxyls ecdysterone and cyasterone (Ren é Lafont professors)；Japanese yew sterone, carinula element B, ajugasterone C, (25S)-Inokosterone, (25R)-Inokosterone, makisterone A, podecdysone C, deer root sterone integrates sterone A (Juraj doctors Harmatha)；20- hydroxyls ecdysterone (Vladimir doctors Volodin), Turkesterone (Zyadilla Saatov professors) and Atyiplex canescen sterone (Apichart Suksamrarn professors).Reagent and solvent for synthesizing/purifying, which are purchased from, flies generation that scientific ＆ technical corporation (Fisher Scientific) and Sigma-Aldrich company (Sigma-Aldrich).Water for HPLC is deionized, and purity is 17W.

The purifying of independent steroids is carried out using HPLC, is directed to the one or more in following method：(a) semi-preparative C₁₈-HPLC(Phenomenex Sphereclone ODS2；250 × 10mm, 5 μm, flow velocity=2mL/min) and (b) preparative C₁₈-HPLC(Phenomenex Sphereclone ODS2；250 × 21.20mm, 5 μm, flow velocity=5mL/min), use suitable CH₃OH/H₂O mixtures equal strength is eluted；(c) semi-preparative silicagel column (Kinesis Zorbax Sil；250 × 9.4mm, 5 μm, flow velocity=2mL/min), use CH₂Cl₂∶2-PrOH∶H₂O 160: 30: 1.5 or 125: 30: 2.0 (v/v/v) equal strength is eluted.

All samples are purified at least 98% with RP-HPLC and/or NP (diol)-HPLC.In Gilson170 systems (Anachem Co., Ltds, Luton, Britain), the purity of compound is verified with HPLC combinations diode array detector, using two kinds of different reversed-phase columns (Phenomenex Sphereclone C₁₈And C₆, 5 μm, 150 × 4.60mm；Féraud door company, mark's Field, Britain (Phenomenex, Macclesfield, U.K.)), receive linear gradient from 30% to 100% methanol aqueous solution more than 25 minutes, followed by the methanol of equal strength 100% of 10 minutes, and a normal phase column (Kinesis-GRACE ApexII Diol, 5 μm, 150 × 4.60mm), receive linear gradient from 2% to 10%, or 4% to 10% CH₃OH CH₂Cl₂Solution, all uses flow velocity 1mL/min and wavelength (λ) is 242nm and 300nm.

Product is quantitatively to detect ultraviolet spectra to carry out using Shimadzu UV-2401Pc, determines and contains 14 Alpha-hydroxy -7- alkene -6- ketone half molecules (λ_{It is maximum}=242nm, molar extinction coefficient (ε)=12,400Lmol^-1cm^-1) or 14 Alpha-hydroxies -7,9 (11)-diene -6- ketone half molecules (λ_{It is maximum}=299nm, molar extinction coefficient (ε)=14,190Lmol^-1cm^-1).Concentration is calculated according to bright Bobi's ear equation (Lambert-Beer equation).

Cytogene switch testing-fruit bat B_IICellular morphology fruit bat B_IICell line biological test is used for the vigor for detecting potential EcR parts.Test is carried out with four multiple holes.Prepare the methanol liquid storage (10 of every kind of test compound^-3M to 10^-10M).The aliquot (20 μ L) of each dilution factor is transferred in the hole of microwell plate, and evaporates solvent.About 2 × 10 are added in hole⁵The μ L of cell suspension 200 of cells/ml culture medium, and be capped plank under moist environment 25 DEG C cultivate 7 days.Cell response is detected as the function of steroid concentrations in 405nm with turbidity agent.

Cytogene switch testing-engineering EcR：USP/RXR systems.Cytogene switch testing is carried out by the way that following construction is transfected into MEC (NIH3T3).D, E and F domain of EcR in table 9 is fused on GAL4-DBD and is placed under the control of CMV promoter.Primer and cloning process are as described above.Chimeric RXR from people RXR and migratory locusts RXR is fused on VP16-AD and is placed under the control of SV40e promoters.Induction type luciferase reporter plasmid pFRLuc, (Si Tute gene cloning systems, Zuo La, California, the U.S.) includes the GAL4 response elements and a minimal promoter synthesized of 5 copies.VgEcR/RXR gene switching systems, employ a heterozygosis EcR, the DBD of three residue mutations with a VP16 activation structures domain and an asymmetric EcR of identification and glucocorticoid receptor response element, purchased from hero company (this shellfish of karr, California, the U.S.), and applied in a similar way by turning NIH3T3 cells wink.

NIH3T3 cells (these NIH3T3 cells are from a clone group different from the NIH3T3 cells in embodiment 1) are in 37 DEG C and 5%CO₂Under in the DMEM culture mediums for the addition of 10% cow's serum cultivate, all purchased from Min Dake (Mediatech) company in Virginia Manassas city.Cell is layered in 96 orifice plates with the density of 2500 cells/wells, per the μ L growth mediums of hole 50.Next day cell contains dimethyl sulfoxide (DMSO with 35 μ L first；Control) or part DMSO solution serum free growth medium processing.Then transfected per hole cell with the 15 μ L serum free mediums containing 0.04 μ g EcR constructions, 0.04 μ g RXR constructions and 0.16 μ g luciferase reporter constructs, use Superfect^TMTransfection reagent (Kai Jie companies, Qiagen, Valencia, CA, USA) is carried out according to the explanation of manufacturer.In 0.01-33 μM of 8 dosage test ligands, and it is all 0.33% to compare and handle the final concentration of DMSO in hole.After processing and transfection are cultivated 48 hours, Bright-Glo is used^TMLuciferase test system (Pu Luomeige companies, Madison, Wisconsin State, the U.S.) illustrates the luciferin enzyme activity of test cell according to manufacturer

Protein sequence is obtained from Pubmed.When only nucleotide sequence (Ba and Nc), with EBITranseq programs (http://www.ebi.ac.uk/emboss/transeq/) translated.Sequence alignment and system occur to assess using ClustalW2 (available on the worldwide web at ebi.ac.uk/Tools/clustalw2/) obtain.In the presence of a kind of EcR variants are had more than, preliminary compare is carried out with ClustalW and is located to show that residue changes outside LBD.

Molecular simulation is carried out with SYBYL 7.1 and 7.3.Cyasterone/E274V/V390I/Y410E mutation - CfEcR//Atyiplex canescen sterone/BaEcR compare：HvEcR (the PDB for combining PoA are compared in Sybyl 7.1:1R1K) and combine PoA BtEcR (LBD is identical with BaEcR, PDB:Homology 1Z5X), according to the comparison of C- alpha atoms, provides weighting RMS distances=1.22.Identification exists

Residue in heavy atom radius.CfEcR V390 and Y410 sport I and E respectively.All other residue is not considered, with reference to the cyasterone on the CfEcR that E274V/V390I/Y410E is mutated, and combine the Atyiplex canescen sterone on BaEcR, each crystal structure is from PoA hand-trimmeds, alternatively there is side chain to minimize (the Tripos field of forces and Gasteiger-H ü ckel electric charges), but do not upset the ring structure of steroids, it is therefore intended that so that acceptor matching is maximized.For 24S- Atyiplex canescen sterones, BaEcR M301C-C-S-C torques move 180 °, to avoid the steric hindrance with the pyrrolylcarbonyl of Atyiplex canescen sterone, rational adjustment is in view of a) M301 towards H11 on H7 and outside point, b) this movement does not produce other conflicts, and c) in BYI06830:HvEcR crystal structures (PBD:1R20) it is found that the precedent of methionine displacement.For 24R- Atyiplex canescen sterones, BaEcR M301C-C-S-C torques move 10 °, to avoid the steric hindrance with the pyrrolylcarbonyl of Atyiplex canescen sterone.Equally, the torque of steroids C23-24 keys also adjusts 10 °, to reach more preferable pyrroles's ring position.In a word, contact residues or steroid side chain only need to seldom and trickle adjustment, in the response acceptor that cyasterone and Atyiplex canescen sterone are contained in them.Then the homogeneity and attitude of the corresponding binding pocket residues of AaEcR and BtEcR are compared.The CfEcR/ of cyasterone/E274V/V390I/Y410E mutation/carinula element B/AaEcR compares：Cyasterone uses as described above.In PoA:Carinula element B is got from PoA modifications in BtEcR compounds.The AaEcR residue related to the identification of orthogonal part is adopted to be recognized in the following method.Recognize PoA:In BtEcR crystal structures (PDB 1Z5X)

Binding pocket residue, and BtEcR sequences are compared with AaEcR.In these binding pocket residues, have 5 it is variant between two acceptors：Bt-H200/Aa-Q353, Bt-T287/Aa-N441, Bt-M389/Aa-Q545, Bt-T393/Aa-M549 and Bt-V404/Aa-L560.Because in this five each with E274V/V390I/Y410E be mutated CfEcR in they comparison counter pair it is identical, this five residues can be excluded and contributed to orthogonal.Identical and other similar residues of attitude are also excluded between the two acceptors.BYI06830/ Atyiplex canescen sterones are overlapping：Sequence analysis is carried out with reference to PoA (PDB 1R1K) and BYI06830 (PDB 1R20) HvEcR.PoA is replaced with the Atyiplex canescen sterones obtained as described above.Produce following threedimensional models (data are not shown)：A. double exposure combines cyasterone (the carbon atom cyan on VY-CfEcR (green), oxygen atom is red) and with reference to 24S- Atyiplex canescens sterone (the carbon atom yellow in BaEcR (orange), oxygen atom is red, nitrogen-atoms blueness, hydrogen atom white).(PDB is encoded the HvEcR crystal structures that VY-CfEcR residues are combined from PoA-：1R1K), except HvEcR-V395, it sports VY-CfEcR-I390, and HvEcR-Y415 its sport VY-CfEcR-E410.In part

Conformation in (heavy atom distance) between only one of which residue and two kinds of EcR is extremely important or homogeneity is variant.Blue label refers to VY-CfEcR residues and brown label refers to BaEcR residues.Image is the view of the β layers of the part to spiral H3 and H4 in prospect.The coloring of Atyiplex canescen sterone electrostatic potential surface is represented.Hydrogen bond between selected 24S- Atyiplex canescens sterone and BaEcR residues (T337, T426) is represented with red dotted line.Cyasterone is not engaged in similar H- keys interaction.B. double exposure combines the cyasterone (cyan) on VY-CfEcR (green) and combines the carinula element B (yellow) on AaEcR (orange).The coloring of carinula element B electrostatic potentials surface is represented.C. double exposure is similar to PoA:HvEcR crystal structures combine the 24-S- Atyiplex canescens sterone (yellow) on HvEcR and the diacyl hydrazide BYI06830 (cyan) as seen in HvEcR crystal structures.

As a result

The screening collection of 42 steroids has been listed in Fig. 9,10 and 11.Maximum steroids subset is in 2-, 3-, 5-, 11-, 14-, 20-, the hydroxylating state in 22- and 25- sites and methylating upper variant (Fig. 9) for 2-, 3-, 14-, and 22- site.The yield in the second subset of steroids includes selection side chain modification, including dilution, alkylation and chain-ring fusion (Figure 10).3rd and last subset comprising uncommon structure change steroids and a brassinosteroid (iso- high rape plain lactone) (Figure 11).

Gene switching system is that each of (Figure 12) is built from 10 difference EcR, and uses double cross form：GAL4-DBD is fused to EcR upstreams and VP16 activation structures domain and is fused to the upstream of a RXR-USP chimera, pM and pVP16 plasmids are respectively adopted and go to gene switching system wink in NIH 3 T 3 cells in vitro.Using luciferase as reporter gene, it is transferred to pFRLUC carriers.Dose response curve is obtained from 43 steroids collection.Obtain EC₅₀Be worth and be shown in Figure 13 (Lepidoptera) and Figure 14 (non-Lepidoptera) in.Second steroids gene switching EC₅₀Data set, the main data comprising the subset from six steroids ether but the data for also including several natural steroids in baseset, are also recorded in the identical gene switching system in 3T3cells.The test result of these data also including the use of VgEcR/RXR systems, is shown in Figure 15 and Figure 16

Effect is determined with three kinds of modes.First method is directly from photometer record relative light unit (RLU).Second method is ratios of the RLU to background RLU of test ligand concentration, i.e. fold induction (FI).The ratio for the maximum FI that the maximum FI of given part of the third method to be observed in any concentration is observed to diacyl hydrazide N- (2- ethyl -3- methoxy-benzyls)-N '-(3,5- xyloyl)-N '-tertiary butyl hydrazine.These values are input in Figure 13-16 as RMFI (relative maximum fold induction).As the index of the basal expression of each switching system, background RLU has been listed in last column of every table.

PoA/NcEcR combination shows EC₅₀=0.3nM (RMFI=1).In addition, PoA activated bs mEcR shows EC₅₀=0.11 μM, RMFI=0.98, diacyl hydrazide is with reference to FI=1776, background FI=3.And-the CfEcR of PoA activation E274V/V390I/Y410E mutation shows EC₅₀=0.11 μM, RMFI=0.52, diacyl hydrazide is with reference to FI=4393, background FI=2.However, 20E does not in fact show the response to CfEcR.

Being summarized in Figure 17 stacked line figure for steroids effect/acceptor response is provided, and it describes selected steroids to the-log (EC of the every kind of EcR types sorted by system₅₀).Cross means intersect the effect reversion shown between two ligand-receptors pair of cross-pair side.For example, the CfEcR and Atyiplex canescen sterone/BaEcR of cyasterone/E274V/V390I/Y410E mutation；And the CfEcR and carinula element B/AaEcR of cyasterone/E274V/V390I/Y410E mutation.The dose response curve of the two systems is shown in Figure 18 and Figure 19.CfEcR/BaEcR couples of-log (EC of E274V/V390I/Y410E mutation₅₀) p- log (EC₅₀) figure shows in fig. 20.

Collected screening collection represents structure and chemical differences, including hydroxylating quantity and the difference in site, the linear C of saturation₈Side chain, cis- A/B- rings connection and 7- alkene -6- ketone chromophories.Plant steroids Atyiplex canescen sterone carries and is connected to C₂₄Pyrroles's 2- carboxyls.This compound is for fruit bat B_IICell line has very high biologic viability (EC₅₀=5.3 × 10^-10M).In this biological test, the steroids of all tests all shows some vigor, EC₅₀Across about 6 orders of magnitude (Figure 14).

A series of 20E and PoA methyl ether are screened (Figure 15 and 16) for multiple acceptors.

PoA and 20E will compare Lepidoptera more effectively to non-Lepidoptera acceptor.Due to Y410E mutation, the CfEcR of Lepidoptera E274V/V390I/Y410E mutation also has the modified regions of a sterol tail of casting off a skin.This mutation and V390I mutation so that E274V/V390I/Y410E mutation-CfEcR prefers Lepidoptera EcR.

The happy sterone A of PoA, rice, stachysterone C and different stachysterone C are the active steroids (Figure 13 and 14) relative to surveyed EcR collection.It all carries hydrophobic tail.And cyasterone some selectivity be directed to Lepidoptera EcR, Atyiplex canescen sterone selectivity be directed to non-Lepidoptera.Similarly, the vigor of ajugasterone C higher in non-lepidopteran species except for BaEcR, the usual RMFI values of Atyiplex canescen sterone weaker (AaEcR and AmaEcR) or does not have.

Six semi-synthetic steroids ethers coordinate selected natural sterol of casting off a skin to be tested (Figure 15 and 16) in 3T3 fibroblasts are substituted.In general, can have following observation result：CfEcR and 20E 3- oxygen-methyl ether of E274V/V390I/Y410E mutation, remains or even obtains effect.Other ethers lose effect, such as MsEcR and 20E 3- methyl ethers, 20E 22- methyl ethers and 20E3,22- oxygen-dimethyl ether.

Steroids effect and effect can be suitable with diacyl hydrazide (N- (2- ethyl -3- methoxyphenyls)-N '-(3,5- xyloyl)-N '-tertiary butyl hydrazine) in the EcR of engineering.For example, to units nM AaEcR activator, PoA and diacyl hydrazide all effect are very high.However, PoA is maximally efficient to Nc, Aa and Ama EcR (0.3-2nM), and diacyl hydrazide to Lepidoptera acceptor (3-20nM) more effectively.Loose sterone is to the EcR of all tests less than μm ol grades effectively, but diacyl hydrazide is effective at μm ol grade to BaEcR (6uM).Except to AmaEcR, BaEcR, and TmEcR, diacyl hydrazide is more more effective than PoA.In the acceptor studied, according to overall fold induction and background, the CfEcR and other Lepidoptera EcR of E274V/V390I/Y410E mutation optimize the most as gene switching system, and AmaEcR and TmEc ratios less optimize.

Multiple ligand/acceptor interaction.E274V/V390I/Y410E mutation-CfEcR//BaEcR are to being appropriateness correlation (R²=0.6, Fig. 4).Corresponding to-log (EC₅₀) stacked line figure (Figure 17), and consider relative potency (RMFI), it is shown that the effect reversion between cyasterone (the CfEcR ＞ BaEcR of E274V/V390I/Y410E mutation) and Atyiplex canescen sterone (CfEcR of BaEcR ＞ E274V/V390I/Y410E mutation).Dose response curve (Figure 18) shows orthogonality

CfEcR//carinula element B/AaEcR dyads doing the trick reversion (Figure 17) of cyasterone/E274V/V390I/Y410E mutation.CfEcR//AaEcR pairs of E274V/V390I/Y410E mutation is also the related (R of appropriateness²=0.6).Detection dose response curve (Figure 19) shows its EC₅₀Interval is narrower than CfEcR//Atyiplex canescen sterone/BaEcR systems of cyasterone/E274V/V390I/Y410E mutation.

Gene switching application ligand inducible gene expression system is expressed available for characteristic in functional genome, drug development, biotherapeutic protein production, genetically modified plants and animal, system and synthetic biology, cell engineering and gene therapy.

At least two steroidal ligands have had shown that feasibility：PoA and meter Le sterones A.In non-natural, non-steroids, it has been demonstrated that the effect of acid amides ketone and tetrahydroquinoline chemical type.In diacyl hydrazide family part, some parts can activate the switch based on engineering EcR in the concentration of sub- nanomole level.Opposite, steroids is with free hydroxyl and is easily metabolized.The suitable effective components of more ADME can be made again by several in these hydroxyls.

Bio-pharmaceutical needs multi-breal switch.In cancer, while controlling the function of several deleterious genes critically important in disease suppression.In order to gear to actual circumstances, multi-breal switch must be strength and as simple as possible in the range of engineering parameter allows.In the switch based on EcR, it has been reported that steroids/diacyl hydrazide and the basic composition of the THQ/ diacyl hydrazide diploids (.PNAS such as Kumar 200299：14710-15；The .J Biol such as Kumar Chem 2004279：27211-18).Cyasterone disclosed by the invention/Atyiplex canescen sterone and the plain B system of cyasterone/carinula represent the orthogonal gene switching based on steroids.

The invention is not restricted in the scope of particular implementation of the present invention.In fact, in addition to of the present invention, according to description above and accompanying drawing, various modifications of the invention are obvious for those skilled in the art.These modifications should also be fallen within the scope of the appended claims.

Claims (31)

1. a kind of compound with following chemical formula：

In formula,

R¹、R²、R³And R⁴For：

A) H, (C₁-C₆) alkyl；(C₁-C₆) alkylhalide group；(C₁-C₆) cyanoalkyl；(C₁-C₆) hydroxyalkyl；(C_1-4) alkoxy (C₁-C₆) alkyl；(C₂-C₆) alkenyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；(C₂-C₆) alkynyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；C₃-C₅Cycloalkyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；Or

B) unsubstituted or substituted benzyl, wherein substituent stand alone as 1-5 H, halogen, nitro, cyano group, hydroxyl, (C₁-C₆) alkyl or (C₁-C₆) alkoxy；And

R⁵For H；OH；F；Cl；Or (C₁-C₆) alkoxy；

On condition that：

Work as R¹、R²、R³And R⁴For isopropyl, then R⁵It is not hydroxyl；

Work as R⁵For H, hydroxyl, methoxyl group or fluorine, then R¹、R²、R³And R⁴In at least one be H；

Work as R¹、R²、R³And R⁴Middle only one of which is methyl and R⁵During for H or hydroxyl, then remaining R¹、R²、R³And R⁴It is not H；

Work as R⁴And R¹、R²And R³In one all be methyl, then R⁵Neither it is H nor is hydroxyl；

Work as R¹、R²、R³And R⁴All it is methyl, then R⁵It is not hydroxyl；

Work as R¹、R²And R³All it is H and R⁵During for hydroxyl, then R⁴It is not ethyl, n-propyl, normal-butyl, pi-allyl or benzyl.

2. a kind of composition comprising one or more compounds as claimed in claim 1 and carrier.

3. a kind of recombination switches set compound, comprising：

At least one gene switching；And

At least one activating ligands,

Wherein described activating ligands are 20- hydroxyl ecdysterone -2- methyl ethers,20- hydroxyl ecdysterone -3- methyl ethers,20- hydroxyl ecdysterone -14- methyl ethers,20- hydroxyls ecdysterone -2,22- dimethyl ethers,20- hydroxyls ecdysterone -3,22- dimethyl ethers,20- hydroxyls ecdysterone -14,22- dimethyl ethers,20- hydroxyls ecdysterone -22,25- dimethyl ethers,20- hydroxyls ecdysterone -2,3,14,22- tetramethyl ethers,20- hydroxyl ecdysterone -22- n-propyl ethers,20- hydroxyl ecdysterone -22- n-butyl ethers,20- hydroxyl ecdysterone -22- allyl ethers,20- hydroxyl ecdysterone -22- benzylic ethers,20- hydroxyl ecdysterone -22- (28R,S) -2 '-ethyl epoxy ethyl ether,Ponasterone A's -2- methyl ethers,Ponasterone A's -14- methyl ethers,Ponasterone A's -22- methyl ethers,Ponasterone A -2,22- dimethyl ethers,Ponasterone A -3,22- dimethyl ethers,Ponasterone A -14,22- dimethyl ethers,Dacryhainansteronc -22- methyl ethers,25,The double dehydrogenation ponasterone As of 26-,(different stachysterone C (Δ 25 (26))),This reaches sterone (stachysterone D),Stachysterone C,22- deoxidation -20- hydroxyls ecdysterones (Japanese yew sterone),Ponasterone A,Bracket fungus sterone B,22- dehydrogenation -20- hydroxyl ecdysterones,Dimethyl furan base ecdysterone,(22R)-20-(2,2 '-dimethyl furan base) ecdysterone,22- deoxidation ecdysterones,25- deoxidation ecdysterones,22- dehydrogenation ecdysterones,Ecdysterone,22- tables-ecdysterone,24- methyl ecdysterone (20- deoxygenates makisterone A),Ecdysterone -22- succinates,25- deoxidation ecdysterone -22- β-D- glucopyranosides,Ecdysterone -22- myristates,The different ecdysterones of 22- dehydrogenations -20-,The different ecdysterones of 20-,The iso- 22- tables ecdysterones of 20-,2- deoxidation ecdysterones,This Lenno glucosides E (beta-glucosidases of 2- deoxidations ecdysterone 3；Cloth indigo plant glucosides A),2- deoxidation ecdysterone -22- acetic acid esters,2- deoxidations ecdysterone -3,22- diacetate esters,2- deoxidation ecdysterone -22- β-D- glucopyranosides,2- deoxidation ecdysterone -25- β-D- glucopyranosides,2- deoxidation -21- hydroxyl ecdysterones,The iso- ecdysterones of 3- tables -22-,3- dehydrogenation -2- deoxidations ecdysterones (silenosterone),3- dehydrogenation ecdysterones,3- dehydrogenation -2- deoxidation ecdysterone -22- acetic acid esters,Ecdysterone -6- carboxymethyl oximes,Ecdysterone -2,3- acetonides,14- table -20- hydroxyls ecdysterone -2,3- acetonides,20- hydroxyls ecdysterone -2,3- acetonides,20- hydroxyls ecdysterone -20,22- acetonides,14- table -20- hydroxyls ecdysterone -2,3,20,The acetonides of 22- bis-,The western sterone -20 of handkerchief,22- is to hydroxyl benzylidenei acetal,Loose sterone,(20R)-dihydro pine sterone,(20S) dihydro pine sterone,The red sulfohydrazides of loose sterone -20-,(20S)-dihydro pine sterone -2,3,20- tribenzoates,(20R)-dihydro pine sterone -2,3,20- tribenzoates,(20R) dihydro pine sterone -2,3- acetonides,(20S) dihydro pine sterone -2,3- acetonides,(5 α-H)-dihydro rubrosterone,2,14,22,- 5 α of deoxidation of 25- tetra--ecdysterone,5 α -one glycol,Bake sterol,2α,3α,22S,- 5 α of 25- tetrahydroxys-cholestane -6- ketone,(5 α-H) -2- deoxidation -21- hydroxyl ecdysterones,Chestnut sterone,24- Biao-chestnut sterone,Sterone A is integrated in (5 α-H) -2- deoxidations,Sterone A is integrated in (5 α-H) -22- deoxidations,(5 α-H) -20- hydroxyl ecdysterones,24,The dehydrogenation Dacryhainansteroncs of 25- bis-,25,The dehydrogenation Dacryhainansteroncs of 26- bis-,5- deoxidations aldosterone (Dacryhainansteronc),(14 α-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,25- hydroxyl Dacryhainansteroncs,Rubrosterone,(5 β-H)-dihydro rubrosterone,- 17 β of dihydro rubrosterone-acetic acid esters,This ground sterone,20- hydroxyls ecdysterone -2,3,22- triacetates,14- deoxidations (14 β-H) -20- hydroxyl ecdysterones,14- table -20- hydroxyl ecdysterones,9α,20- dihydroxy ecdysterones,Malaysia sterone,2- deoxidations carinula element,B-3- β-D- glucopyranosides,Ajugalactone,Its blue ketone B,2β,3β,6 α-the β of trihydroxy-5-cholestane,2β,3β,6 β-the β of trihydroxy-5-cholestane,14- dehydrogenations this reach sterone,Stachysterone B,2β,3β,9α,20R,22R,- 5 β of 25- hexahydroxys-cholesteric -7,14- diene -6- ketone,OK a karaoke club reaches sterone,(14 β-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,4- dehydrogenation -20- hydroxyl ecdysterones,14- methyl isophthalic acid 2- alkene-Si Da sterones,14- methyl isophthalic acid 2- alkene -15,20- dihydroxy ecdysterones,Sufficient sterone B,2β,3β,20R,Fluoro- 5 β of 22R- tetrahydroxys -25--cholesteric -8,14- diene -6- ketone (25- fluorine foot sterone B),Charon sterone,14- deoxidations -14,18- ring -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyl ecdysterones,9β,14 beta epoxide -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyl ecdysterones,2,3,20,The acetonides of 22- bis-,28- high rape plain lactones,Different high rape plain lactone,Non-steroidal ligands or compound as claimed in claim 1.

4. recombination switches set compound as claimed in claim 3, it is characterised in that the composition includes at least two gene switchings.

5. recombination switches set compound as claimed in claim 4, it is characterised in that one in the gene switching is activated by non-steroidal ligands.

6. recombination switches set compound as claimed in claim 5, it is characterised in that the non-steroidal ligands are selected from the group：Diacyl hydrazide, acid amides ketone and

Bisoxazoline.

7. recombination switches set compound as claimed in claim 4, it is characterised in that each gene switching is one or more nucleic acid codings as present on same vector polynucleotides.

8. recombination switches set compound as claimed in claim 4, it is characterised in that one heterodimeric receptor compound of each gene switching formation.

9. recombination switches set compound as claimed in claim 8, it is characterised in that the heterodimeric receptor compound of each gene switching has a common component.

10. recombination switches set compound as claimed in claim 9, it is characterised in that the common constituent is RXR ligand binding domains or RXR/USP inserted type ligand binding domains.

11. a kind of composition for including multiple separately operable recombination switches, it is characterised in that each separately operable recombination switch is included：

First restructuring box of one the first polynucleotides comprising the first polypeptide of coding, first polypeptide is included：

One DNA binding structural domain, identification is with expressing the response element that target gene is operatively connected for needing to be regulated and controled；

One ecdysterone receptor ligand binding domain, the ecdysterone receptor ligand binding domain of one mutation, the V390I/Y410E mutant of one choristoneura fumigerana ecdysterone receptor ligand binding domain, or a choristoneura fumigerana ecdysterone receptor ligand binding domain E274V/V390I/Y410E mutant；

One second restructuring box, comprising：

One response element for can be incorporated on the DNA binding structural domains；

One promoter for being activated by transactivation domain；And

One target gene；

Wherein, composition includes multiple parts, and wherein at least one part is：

20- hydroxyl ecdysterone -2- methyl ethers,20- hydroxyl ecdysterone -3- methyl ethers,20- hydroxyl ecdysterone -14- methyl ethers,20- hydroxyls ecdysterone -2,22- dimethyl ethers,20- hydroxyls ecdysterone -3,22- dimethyl ethers,20- hydroxyls ecdysterone -14,22- dimethyl ethers,20- hydroxyls ecdysterone -22,25- dimethyl ethers,20- hydroxyls ecdysterone -2,3,14,22- tetramethyl ethers,20- hydroxyl ecdysterone -22- n-propyl ethers,20- hydroxyl ecdysterone -22- n-butyl ethers,20- hydroxyl ecdysterone -22- allyl ethers,20- hydroxyl ecdysterone -22- benzylic ethers,20- hydroxyl ecdysterone -22- (28R,S) -2 '-ethyl epoxy ethyl ether,Ponasterone A's -2- methyl ethers,Ponasterone A's -14- methyl ethers,Ponasterone A's -22- methyl ethers,Ponasterone A -2,22- dimethyl ethers,Ponasterone A -3,22- dimethyl ethers,Ponasterone A -14,22- dimethyl ethers,Dacryhainansteronc -22- methyl ethers,25,The double dehydrogenation ponasterone As of 26-,(different stachysterone C (Δ 25 (26))),This reaches sterone (stachysterone D),Stachysterone C,22- deoxidation -20- hydroxyls ecdysterones (Japanese yew sterone),Ponasterone A,Bracket fungus sterone B,22- dehydrogenation -20- hydroxyl ecdysterones,Ponasterone A's -22- methyl ethers,20- hydroxyl ecdysterones,Pterosterone,(25R)-Inokosterone,(25S)-Inokosterone,The native China fir sterone of sharp leaf,25- fluorine ponasterone A,24 (28)-dehydrogenation makisterone A,24-epi-makisterone A,Makisterone A,20- hydroxyl ecdysterone -22- methyl ethers,20- hydroxyl ecdysterone -25- methyl ethers,Abutasterone,22,Bis--tables of 23--Pheheirospermum japonicum sterone,20,26- dihydroxy ecdysterone (sufficient sterone C),24- tables-abutasterone,Pheheirospermum japonicum sterone,29- cyasterones,Ajugasterone B,24 (28) [Z]-dehydrogenation amarasterone B,Amarasterone A,Ajugasterone C,Deer root sterone C,20- hydroxyls ecdysterone -22,25- dimethyl ethers,20- hydroxyl ecdysterone -22- ethylethers,Deer root sterone,24 (25)-dehydrogenation precyaterone,Loose Rhapontisterone,Cyasterone,20- hydroxyl ecdysterone -22- allyl ethers,24 (28) [Z]-dehydrogenation -29- hydroxyl podecdysone Cs,20- hydroxyl ecdysterone -22- acetic acid esters,Wei Teke sterones E (20- hydroxyl ecdysterone -25- acetic acid esters),20- hydroxyl ecdysterone -22- n-propyl ethers,24- hydroxyl cyasterones,20- hydroxyl ecdysterone -22- n-butyl ethers,The native China fir sterone A 22- hemisuccinic acid esters of sharp leaf,22- acetoacetyl -20- hydroxyl ecdysterones,20- hydroxyl ecdysterone -22- benzylic ethers,Atyiplex canescen sterone,20- hydroxyl ecdysterone -22- hemisuccinic acid esters,Inokosterone -26- hemisuccinic acid esters,20- hydroxyl ecdysterone -22- benzoin esters,20- hydroxyl ecdysterone -22- β-D- glucopyranosides,20- hydroxyl ecdysterone -25- β-D- glucopyranosides,This Lenno glucosides A (alpha-galactoside of 20- hydroxyls ecdysterone -22),The β of 3- deoxidations -1,20- dihydroxy ecdysterone (sterone A is integrated in 3- deoxidations),Sterone A is integrated in 2- deoxidations,1- tables-integration sterone A,Integrate sterone A,This Lenno glucosides C (integrates the alpha-galactosides of sterone A 22),2,22- double deoxidation -20- hydroxyl ecdysterones,2- deoxidation -20- hydroxyl ecdysterones,2- deoxidation -20- hydroxyl ecdysterone -3- acetic acid esters,2- deoxidations -20,26- dihydroxy ecdysterones,2- deoxidation -20- hydroxyl ecdysterone -22- acetic acid esters,2- deoxidation -20- hydroxyls ecdysterone -3,22- diacetate esters,2- deoxidation -20- hydroxyl ecdysterone -22- benzoin esters,The native China fir sterone A 2- hemisuccinic acid esters of sharp leaf,20- hydroxyl ecdysterone -2- methyl ethers,20- hydroxyl ecdysterone -2- acetic acid esters,20- hydroxyl ecdysterone -2- hemisuccinic acid esters,20- hydroxyl ecdysterone -2- β D- glucopyranosides,2- pellet sulphonyl -20- hydroxyl ecdysterones,20- hydroxyls ecdysterone -2,22- dimethyl ethers,Native β-D- xylopyranoses the glucosides (Bai Manghua glucosides B) of China fir sterone A 3 of sharp leaf,20- hydroxyl ecdysterone -3- methyl ethers,20- hydroxyl ecdysterone -3- acetic acid esters,β-D- xylopyranoses the glucosides (Bai Manghua glucosides A) of 20- hydroxyls ecdysterone -3,20- hydroxyl ecdysterone -3- β-D- glucopyranosides,This Lenno glucosides D (alpha-galactoside of 20- hydroxyls ecdysterone -3),β-D- glucopyranoses the acyl of 20- hydroxyls ecdysterone 3-[1-3]-β-D- xylopyranoses glucosides (Bai Manghua glucosides C),20- hydroxyls ecdysterone -3,22- dimethyl ethers,Cyasterone -3- acetic acid esters,2- dehydrogenation -3- table -20- hydroxyl ecdysterones,3- table -20- hydroxyls ecdysterones (Serratula centauroides sterone),Deer root sterone D,3- dehydrogenation -20- hydroxyl ecdysterones,5 beta-hydroxies -25,The native China fir sterone A of the dehydrogenations of 26- bis- point leaf,5 beta-hydroxy stachysterone C,25- deoxidations carinula element B,Carinula element B,25- fluorine carinula element B,5 beta-hydroxy abutasterones,26- hydroxyls carinula element B,29- promise hydroxyl cyasterones,Hydroxyl cyasterone,6 beta-hydroxy -20- hydroxyl ecdysterones,6 alpha-hydroxy-2 0- hydroxyl ecdysterones,20- hydroxyl ecdysterone -6- oximes,The native China fir sterone A 6- carboxymethyl oximes of sharp leaf,20- hydroxyl ecdysterone -6- carboxymethyl oximes,Ajugasterone C,Deer root sterone B,The happy sterone A of rice,Magnificent fried dough twist sterone B,Magnificent fried dough twist sterone A,Turkesterone -2- acetic acid esters,Slope Buddhist nun's sterone (Rhapontisterone),Turkesterone,Magnificent fried dough twist sterone C,25- hydroxyls China fried dough twist sterone B,25- hydroxyls China fried dough twist sterone A,The western sterone of handkerchief,Turkesterone -2,22- diacetate esters,Turkesterone -22- acetic acid esters,The α of Turkesterone-11-acetic acid esters,Turkesterone -2,11 α-diacetate esters,The MCPP-propionic acid) ester of Turkesterone -11,The iophenoxic acid ester of Turkesterone -11,The α of Turkesterone-11-capronate,The α of Turkesterone-11-decylate,The α of Turkesterone-11-laurate,The α of Turkesterone-11-myristate,The α of Turkesterone-11-Arachidate,The beta-hydroxy promise hydroxyl cyasterone of 22- dehydrogenations -12,The beta-hydroxy cyasterone of 22- dehydrogenations -12,The beta-hydroxy hydroxyl cyasterone of 22- dehydrogenations -12,14- deoxidations (14 α-H) -20- hydroxyl ecdysterones,20- hydroxyl ecdysterone -14- methyl ethers,14 α-perhydroxyl radical -20- hydroxyl ecdysterones,20- hydroxyls ecdysterone 14,22- dimethyl ethers,20- hydroxyls ecdysterone -2,3,14,22- tetramethyl ethers,(20S) -22- deoxidations -20,21- dihydroxy ecdysterones,22,25- double deoxidation ecdysterones,(22S)-20-(2,2 '-bis- methylfuran bases) ecdysterone,(22R)-20-(2,2 '-bis- methylfuran bases) ecdysterone,22- deoxidation ecdysterones,25- deoxidation ecdysterones,22- deoxidation ecdysterones,Ecdysterone,22- tables-ecdysterone,24- methyl ecdysterone (20- deoxidations makisterone A),Ecdysterone -22- hemisuccinic acid esters,25- deoxidation ecdysterone -22- β-D- glucopyranosides,Ecdysterone -22- myristates,The iso- ecdysterones of 22- dehydrogenations -20-,The iso- ecdysterones of 20-,The iso- 22- tables-ecdysterones of 20-,2- deoxidation ecdysterones,This Lenno glucosides E (beta-glucosidases of 2- deoxidations ecdysterone 3；Cloth indigo plant glucosides A),2- deoxidation ecdysterone -22- acetic acid esters,2- deoxidations ecdysterone -3,22- diacetate esters,2- deoxidation ecdysterone -22- β-D- glucopyranosides,2- deoxidation ecdysterone 25- β-D- glucopyranosides,2- deoxidation -21- hydroxyl ecdysterones,The iso- ecdysterones of 3- tables -22-,3- dehydrogenation -2- deoxidations ecdysterones (silenosterone),3- dehydrogenation ecdysterones,3- dehydrogenation -2- deoxidation ecdysterone -22- acetic acid esters,Ecdysterone -6- carboxymethyl oximes,Ecdysterone -2,3- acetonides,14- table -20- hydroxyls ecdysterone -2,3- acetonides,20- hydroxyls ecdysterone -2,3- acetonides,20- hydroxyls ecdysterone -20,22- acetonides,14- table -20- hydroxyls ecdysterone -2,3,20,The acetonides of 22- bis-,The western sterone -20 of handkerchief,22-p- phenol methylene acetals,Poststerone,(20R)-dihydro poststerone,(20S) dihydro poststerone,Poststerone -20- pellet sulfohydrazides,(20S)-dihydro poststerone -2,3,The benzoates of 20- tri-,(20R)-dihydro poststerone -2,3,The benzoates of 20- tri-,(20R) dihydro poststerone -2,3- acetonides,(20S) dihydro poststerone -2,3- acetonides,(5 α-H)-dihydro rubrosterone,2,14,22,- 5 α of deoxidation of 25- tetra--ecdysterone,5 α -one glycol,Bake sterol,2α,3α,22S,- 5 α of 25- tetrahydroxys-cholesteric -6- ketone,(5 α-H) -2- deoxidation -21- hydroxyl ecdysterones,Chestnut sterone,24- Biao-chestnut sterone,Sterone A is integrated in (5 α-H) -2- deoxidations,Sterone A is integrated in (5 α-H) -22- deoxidations,(5 α-H) -20- hydroxyl ecdysterones,24,The double dehydrogenation Dacryhainansteroncs of 25-,25,The double dehydrogenation Dacryhainansteroncs of 26-,5- deoxidations OK a karaoke club reaches sterone (Dacryhainansteronc),(14 α-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,25- hydroxyl Dacryhainansteroncs,Rubrosterone,(5 β-H)-dihydro rubrosterone,- 17 β of dihydro rubrosterone-acetic acid esters,This ground sterone,20- hydroxyls ecdysterone -2,3,22- triacetates,14- deoxidations (14 β-H) -20- hydroxyl ecdysterones,14- table -20- hydroxyl ecdysterones,9α,20- dihydroxy ecdysterones,Malaysia sterone,2- deoxidations carinula element B-3- β-D- glucopyranosides,Ajugalactone,Its blue ketone B,2β,3β,6 α-the β of trihydroxy-5-cholestane,2β,3β,6 β-the β of trihydroxy-5-cholestane,14- dehydrogenations this reach sterone,Stachysterone B,2β,3β,9α,20R,22R,- 5 β of 25- hexahydroxys-cholesteric -7,14- diene -6- ketone,OK a karaoke club reaches sterone,(14 β-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,4- dehydrogenation -20- hydroxyl ecdysterones,14- methyl isophthalic acid 2- alkene-Si Da sterones,14- methyl isophthalic acid 2- alkene -15,20- dihydroxy ecdysterones,Sufficient sterone B,2β,3β,20R,Fluoro- 5 β of 22R- tetrahydroxys -25--cholesteric -8,14- diene -6- ketone (25- fluorine foot sterone B),Charon sterone,14- deoxidations -14,18- ring -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyl ecdysterones,9βα,14 beta epoxide -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyls ecdysterone 2,3,20,The acetonides of 22- bis-,28- high rape plain lactones,Iso- high rape plain lactone,Regulate and control the non-steroidal ligands of the separately operable recombination switch,Or the compound of following chemical formula：

Wherein R¹、R²、R³And R⁴For

A) H, (C₁-C₆) alkyl；(C₁-C₆) alkylhalide group；(C₁-C₆) cyanoalkyl；(C₁-C₆) hydroxyalkyl；(C_1-4) alkoxy (C₁-C₆) alkyl；(C₂-C₆) alkenyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；(C₂-C₆) alkynyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；C₃-C₅Cycloalkyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；Or

B) unsubstituted or substituted benzyl, wherein substituent stand alone as 1-5 H, halogen, nitro, cyano group, hydroxyl, (C₁-C₆) alkyl or (C₁-C₆) alkoxy；And

R⁵For H；OH；F；Cl；Or (C₁-C₆) alkoxy.

12. a kind of composition for including multiple separately operable recombination switches, each gene switching is controlled by a different part, it is characterised in that each separately operable gene switching is included：

A) one or more expression casettes, comprising

First polynucleotides of one the first polypeptide of coding, comprising：

One transactivation domain；

One nuclear receptor ligands binding structural domain；

Second polynucleotides of one the second polypeptide of coding, comprising：

One DNA binding structural domain, identification is with expressing the response element that target gene is operatively connected for needing to be regulated and controled；

One nuclear receptor ligands binding structural domain；

One the 3rd polynucleotides, comprising：

One response element for can be incorporated on the DNA binding structural domains；

One promoter for being operationally coupled on response element；And

One target gene；

B) a part, wherein part is：

20- hydroxyl ecdysterone -2- methyl ethers,20- hydroxyl ecdysterone -3- methyl ethers,20- hydroxyl ecdysterone -14- methyl ethers,20- hydroxyls ecdysterone -2,22- dimethyl ethers,20- hydroxyls ecdysterone -3,22- dimethyl ethers,20- hydroxyls ecdysterone -14,22- dimethyl ethers,20- hydroxyls ecdysterone -22,25- dimethyl ethers,20- hydroxyls ecdysterone -2,3,14,22- tetramethyl ethers,20- hydroxyl ecdysterone -22- n-propyl ethers,20- hydroxyl ecdysterone -22- n-butyl ethers,20- hydroxyl ecdysterone -22- allyl ethers,20- hydroxyl ecdysterone -22- benzylic ethers,20- hydroxyl ecdysterone -22- (28R,S) -2 '-ethyl epoxy ethyl ether,Ponasterone A's -2- methyl ethers,Ponasterone A's -14- methyl ethers,Ponasterone A's -22- methyl ethers,Ponasterone A -2,22- dimethyl ethers,Ponasterone A -3,22- dimethyl ethers,Ponasterone A -14,22- dimethyl ethers,Dacryhainansteronc -22- methyl ethers,25,The double dehydrogenation ponasterone As of 26-,(different stachysterone C (Δ 25 (26))),This reaches sterone (stachysterone D),Stachysterone C,22- deoxidation -20- hydroxyls ecdysterones (Japanese yew sterone),Ponasterone A,Bracket fungus sterone B,22- dehydrogenation -20- hydroxyl ecdysterones,Ponasterone A's -22- methyl ethers,20- hydroxyl ecdysterones,Pterosterone,(25R)-Inokosterone,(25S)-Inokosterone,The native China fir sterone of sharp leaf,25- fluorine ponasterone A,24 (28)-dehydrogenation makisterone A,24-epi-makisterone A,Makisterone A,20- hydroxyl ecdysterone -22- methyl ethers,20- hydroxyl ecdysterone -25- methyl ethers,Abutasterone,22,Bis--tables of 23--Pheheirospermum japonicum sterone,20,26- dihydroxy ecdysterone (sufficient sterone C),24- tables-abutasterone,Pheheirospermum japonicum sterone,29- cyasterones,Ajugasterone B,24 (28) [Z]-dehydrogenation amarasterone B,Amarasterone A,Ajugasterone C,Deer root sterone C,20- hydroxyls ecdysterone -22,25- dimethyl ethers,20- hydroxyl ecdysterone -22- ethylethers,Deer root sterone,24 (25)-dehydrogenation precyaterone,Loose Rhapontisterone,Cyasterone,20- hydroxyl ecdysterone -22- allyl ethers,24 (28) [Z]-dehydrogenation -29- hydroxyl podecdysone Cs,20- hydroxyl ecdysterone -22- acetic acid esters,Wei Teke sterones E (20- hydroxyl ecdysterone -25- acetic acid esters),20- hydroxyl ecdysterone -22- n-propyl ethers,24- hydroxyl cyasterones,20- hydroxyl ecdysterone -22- n-butyl ethers,The native China fir sterone A 22- hemisuccinic acid esters of sharp leaf,22- acetoacetyl -20- hydroxyl ecdysterones,20- hydroxyl ecdysterone -22- benzylic ethers,Atyiplex canescen sterone,20- hydroxyl ecdysterone -22- hemisuccinic acid esters,Inokosterone -26- hemisuccinic acid esters,20- hydroxyl ecdysterone -22- benzoin esters,20- hydroxyl ecdysterone -22- β-D- glucopyranosides,20- hydroxyl ecdysterone -25- β-D- glucopyranosides,This Lenno glucosides A (alpha-galactoside of 20- hydroxyls ecdysterone -22),The β of 3- deoxidations -1,20- dihydroxy ecdysterone (sterone A is integrated in 3- deoxidations),Sterone A is integrated in 2- deoxidations,1- tables-integration sterone A,Integrate sterone A,This Lenno glucosides C (integrates the alpha-galactosides of sterone A 22),2,22- double deoxidation -20- hydroxyl ecdysterones,2- deoxidation -20- hydroxyl ecdysterones,2- deoxidation -20- hydroxyl ecdysterone -3- acetic acid esters,2- deoxidations -20,26- dihydroxy ecdysterones,2- deoxidation -20- hydroxyl ecdysterone -22- acetic acid esters,2- deoxidation -20- hydroxyls ecdysterone -3,22- diacetate esters,2- deoxidation -20- hydroxyl ecdysterone -22- benzoin esters,The native China fir sterone A 2- hemisuccinic acid esters of sharp leaf,20- hydroxyl ecdysterone -2- methyl ethers,20- hydroxyl ecdysterone -2- acetic acid esters,20- hydroxyl ecdysterone -2- hemisuccinic acid esters,20- hydroxyl ecdysterone -2- β D- glucopyranosides,2- pellet sulphonyl -20- hydroxyl ecdysterones,20- hydroxyls ecdysterone -2,22- dimethyl ethers,Native β-D- xylopyranoses the glucosides (Bai Manghua glucosides B) of China fir sterone A 3 of sharp leaf,20- hydroxyl ecdysterone -3- methyl ethers,20- hydroxyl ecdysterone -3- acetic acid esters,β-D- xylopyranoses the glucosides (Bai Manghua glucosides A) of 20- hydroxyls ecdysterone -3,20- hydroxyl ecdysterone -3- β-D- glucopyranosides,This Lenno glucosides D (alpha-galactoside of 20- hydroxyls ecdysterone -3),β-D- glucopyranoses the acyl of 20- hydroxyls ecdysterone 3-[1-3]-β-D- xylopyranoses glucosides (Bai Manghua glucosides C),20- hydroxyls ecdysterone -3,22- dimethyl ethers,Cyasterone -3- acetic acid esters,2- dehydrogenation -3- table -20- hydroxyl ecdysterones,3- table -20- hydroxyls ecdysterones (Serratula centauroides sterone),Deer root sterone D,3- dehydrogenation -20- hydroxyl ecdysterones,5 beta-hydroxies -25,The native China fir sterone A of the dehydrogenations of 26- bis- point leaf,5 beta-hydroxy stachysterone C,25- deoxidations carinula element B,Carinula element B,25- fluorine carinula element B,5 beta-hydroxy abutasterones,26- hydroxyls carinula element B,29- promise hydroxyl cyasterones,Hydroxyl cyasterone,6 beta-hydroxy -20- hydroxyl ecdysterones,6 alpha-hydroxy-2 0- hydroxyl ecdysterones,20- hydroxyl ecdysterone -6- oximes,The native China fir sterone A 6- carboxymethyl oximes of sharp leaf,20- hydroxyl ecdysterone -6- carboxymethyl oximes,Ajugasterone C,Deer root sterone B,The happy sterone A of rice,Magnificent fried dough twist sterone B,Magnificent fried dough twist sterone A,Turkesterone -2- acetic acid esters,Slope Buddhist nun's sterone (Rhapontisterone),Turkesterone,Magnificent fried dough twist sterone C,25- hydroxyls China fried dough twist sterone B,25- hydroxyls China fried dough twist sterone A,The western sterone of handkerchief,Turkesterone -2,22- diacetate esters,Turkesterone -22- acetic acid esters,The α of Turkesterone-11-acetic acid esters,Turkesterone -2,11 α-diacetate esters,The MCPP-propionic acid) ester of Turkesterone -11,The iophenoxic acid ester of Turkesterone -11,The α of Turkesterone-11-capronate,The α of Turkesterone-11-decylate,The α of Turkesterone-11-laurate,The α of Turkesterone-11-myristate,The α of Turkesterone-11-Arachidate,The beta-hydroxy promise hydroxyl cyasterone of 22- dehydrogenations -12,The beta-hydroxy cyasterone of 22- dehydrogenations -12,The beta-hydroxy hydroxyl cyasterone of 22- dehydrogenations -12,14- deoxidations (14 α-H) -20- hydroxyl ecdysterones,20- hydroxyl ecdysterone -14- methyl ethers,14 α-perhydroxyl radical -20- hydroxyl ecdysterones,20- hydroxyls ecdysterone 14,22- dimethyl ethers,20- hydroxyls ecdysterone -2,3,14,22- tetramethyl ethers,(20S) -22- deoxidations -20,21- dihydroxy ecdysterones,22,25- double deoxidation ecdysterones,(22S)-20-(2,2 '-bis- methylfuran bases) ecdysterone,(22R)-20-(2,2 '-bis- methylfuran bases) ecdysterone,22- deoxidation ecdysterones,25- deoxidation ecdysterones,22- deoxidation ecdysterones,Ecdysterone,22- tables-ecdysterone,24- methyl ecdysterone (20- deoxidations makisterone A),Ecdysterone -22- hemisuccinic acid esters,25- deoxidation ecdysterone -22- β-D- glucopyranosides,Ecdysterone -22- myristates,The iso- ecdysterones of 22- dehydrogenations -20-,The iso- ecdysterones of 20-,The iso- 22- tables-ecdysterones of 20-,2- deoxidation ecdysterones,This Lenno glucosides E (beta-glucosidases of 2- deoxidations ecdysterone 3；Cloth indigo plant glucosides A),2- deoxidation ecdysterone -22- acetic acid esters,2- deoxidations ecdysterone -3,22- diacetate esters,2- deoxidation ecdysterone -22- β-D- glucopyranosides,2- deoxidation ecdysterone 25- β-D- glucopyranosides,2- deoxidation -21- hydroxyl ecdysterones,The iso- ecdysterones of 3- tables -22-,3- dehydrogenation -2- deoxidations ecdysterones (silenosterone),3- dehydrogenation ecdysterones,3- dehydrogenation -2- deoxidation ecdysterone -22- acetic acid esters,Ecdysterone -6- carboxymethyl oximes,Ecdysterone -2,3- acetonides,14- table -20- hydroxyls ecdysterone -2,3- acetonides,20- hydroxyls ecdysterone -2,3- acetonides,20- hydroxyls ecdysterone -20,22- acetonides,14- table -20- hydroxyls ecdysterone -2,3,20,The acetonides of 22- bis-,The western sterone -20 of handkerchief,22-p- phenol methylene acetals,Poststerone,(20R)-dihydro poststerone,(20S) dihydro poststerone,Poststerone -20- pellet sulfohydrazides,(20S)-dihydro poststerone -2,3,The benzoates of 20- tri-,(20R)-dihydro poststerone -2,3,The benzoates of 20- tri-,(20R) dihydro poststerone -2,3- acetonides,(20S) dihydro poststerone -2,3- acetonides,(5 α-H)-dihydro rubrosterone,2,14,22,- 5 α of deoxidation of 25- tetra--ecdysterone,5 α -one glycol,Bake sterol,2α,3α,22S,- 5 α of 25- tetrahydroxys-cholesteric -6- ketone,(5 α-H) -2- deoxidation -21- hydroxyl ecdysterones,Chestnut sterone,24- Biao-chestnut sterone,Sterone A is integrated in (5 α-H) -2- deoxidations,Sterone A is integrated in (5 α-H) -22- deoxidations,(5 α-H) -20- hydroxyl ecdysterones,24,The double dehydrogenation Dacryhainansteroncs of 25-,25,The double dehydrogenation Dacryhainansteroncs of 26-,5- deoxidations OK a karaoke club reaches sterone (Dacryhainansteronc),(14 α-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,25- hydroxyl Dacryhainansteroncs,Rubrosterone,(5 β-H)-dihydro rubrosterone,- 17 β of dihydro rubrosterone-acetic acid esters,This ground sterone,20- hydroxyls ecdysterone -2,3,22- triacetates,14- deoxidations (14 β-H) -20- hydroxyl ecdysterones,14- table -20- hydroxyl ecdysterones,9α,20- dihydroxy ecdysterones,Malaysia sterone,2- deoxidations carinula element B-3- β-D- glucopyranosides,Ajugalactone,Its blue ketone B,2β,3β,6 α-the β of trihydroxy-5-cholestane,2β,3β,6 β-the β of trihydroxy-5-cholestane,14- dehydrogenations this reach sterone,Stachysterone B,2β,3β,9α,20R,22R,- 5 β of 25- hexahydroxys-cholesteric -7,14- diene -6- ketone,OK a karaoke club reaches sterone,(14 β-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,4- dehydrogenation -20- hydroxyl ecdysterones,14- methyl isophthalic acid 2- alkene-Si Da sterones,14- methyl isophthalic acid 2- alkene -15,20- dihydroxy ecdysterones,Sufficient sterone B,2β,3β,20R,Fluoro- 5 β of 22R- tetrahydroxys -25--cholesteric -8,14- diene -6- ketone (25- fluorine foot sterone B),Charon sterone,14- deoxidations -14,18- ring -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyl ecdysterones,9βα,14 beta epoxide -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyls ecdysterone 2,3,20,The acetonides of 22- bis-,28- high rape plain lactones,Iso- high rape plain lactone,Regulate and control the non-steroidal ligands of the separately operable recombination switch,Or the compound of following chemical formula：

Wherein R¹、R²、R^{3 Hes}R⁴For

A) H, (C₁-C₆) alkyl；(C₁-C₆) alkylhalide group；(C₁-C₆) cyanoalkyl；(C₁-C₆) hydroxyalkyl；(C_1-4) alkoxy (C₁-C₆) alkyl；(C₂-C₆) alkenyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；(C₂-C₆) alkynyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；C₃-C₅Cycloalkyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；Or

B) unsubstituted or substituted benzyl, wherein substituent stand alone as 1-5 H, halogen, nitro, cyano group, hydroxyl, (C₁-C₆) alkyl or (C₁-C₆) alkoxy；And

R⁵For H；OH；F；Cl；Or (C₁-C₆) alkoxy.

13. composition as claimed in claim 12, it is characterised in that the composition includes at least two gene switchings.

14. composition as claimed in claim 13, it is characterised in that one in the gene switching is activated by non-steroidal ligands.

15. composition as claimed in claim 14, it is characterised in that the non-steroidal ligands are selected from the group：Diacyl hydrazide, acid amides ketone and

Bisoxazoline.

16. composition as claimed in claim 12, it is characterised in that each gene switching is one or more nucleic acid codings as present on same vector polynucleotides.

17. composition as claimed in claim 12, it is characterised in that one heterodimeric receptor compound of each gene switching formation.

18. composition as claimed in claim 17, it is characterised in that the heterodimeric receptor compound of each gene switching has a common component.

19. composition as claimed in claim 18, it is characterised in that the common constituent includes RXR ligand binding domains or RXR/USP inserted type ligand binding domains.

20. composition as claimed in claim 12, it is characterised in that each separately operable gene switching controls a different target gene.

21. composition as claimed in claim 12 a, it is characterised in that target gene can kill cell.

22. composition as claimed in claim 21, it is characterised in that the target gene that can kill cell is toxin.

23. composition as claimed in claim 12 a, it is characterised in that target gene is therapeutic objective gene.

24. composition as claimed in claim 12 a, it is characterised in that target gene is cell factor.

25. composition as claimed in claim 12, it is characterised in that one or more nuclear receptor ligands binding structural domains are H group nuclear receptor ligands binding structural domains.

26. composition as claimed in claim 12, it is characterised in that one or more nuclear receptor ligands binding structural domains are the chimera of USP ligand binding domains, RXR ligand binding domains, RXR cognate ligand binding structural domains, or RXR ligand binding domains.

27. composition as claimed in claim 12, it is characterised in that one or more nuclear receptor ligands binding structural domains are H group nuclear receptor ligands binding structural domains；And wherein one or more nuclear receptor ligands binding structural domains are the chimera of USP ligand binding domains, RXR ligand binding domains, RXR cognate ligand binding structural domains, or RXR ligand binding domains.

28. composition as claimed in claim 27, it is characterized in that, H group nuclear receptor ligands binding structural domains are from ecdysterone acceptor, the ecdysterone acceptor of mutation, Lepidoptera ecdysterone acceptor, the Lepidoptera ecdysterone acceptor being mutated, the V390I/Y410E mutant of choristoneura fumigerana ecdysterone acceptor, choristoneura fumigerana ecdysterone acceptor, the E274V/V390I/Y410E mutant of choristoneura fumigerana ecdysterone acceptor.

29. it is a kind of by giving method of the part of effective dose to activate recombination switching system,It is characterized in that,The part is 20- hydroxyl ecdysterone -2- methyl ethers,20- hydroxyl ecdysterone -3- methyl ethers,20- hydroxyl ecdysterone -14- methyl ethers,20- hydroxyls ecdysterone -2,22- dimethyl ethers,20- hydroxyls ecdysterone -3,22- dimethyl ethers,20- hydroxyls ecdysterone -14,22- dimethyl ethers,20- hydroxyls ecdysterone -22,25- dimethyl ethers,20- hydroxyls ecdysterone -2,3,14,22- tetramethyl ethers,20- hydroxyl ecdysterone -22- n-propyl ethers,20- hydroxyl ecdysterone -22- n-butyl ethers,20- hydroxyl ecdysterone -22- allyl ethers,20- hydroxyl ecdysterone -22- benzylic ethers,20- hydroxyl ecdysterone -22- (28R,S) -2 '-ethyl epoxy ethyl ether,Ponasterone A's -2- methyl ethers,Ponasterone A's -14- methyl ethers,Ponasterone A's -22- methyl ethers,Ponasterone A -2,22- dimethyl ethers,Ponasterone A -3,22- dimethyl ethers,Ponasterone A -14,22- dimethyl ethers,Dacryhainansteronc -22- methyl ethers,25,The double dehydrogenation ponasterone As of 26-,(different stachysterone C (Δ 25 (26))),This reaches sterone (this reaches sterone) (stachysterone D),Stachysterone C,22- deoxidation -20- hydroxyls ecdysterones (Japanese yew sterone),Ponasterone A,Bracket fungus sterone B,22- dehydrogenation -20- hydroxyl ecdysterones,Ponasterone A's -22- methyl ethers,20- hydroxyl ecdysterones,Pterosterone,(25R)-Inokosterone,(25S)-Inokosterone,The native China fir sterone of sharp leaf,25- fluorine ponasterone A,24 (28)-dehydrogenation makisterone A,24-epi-makisterone A,Makisterone A,20- hydroxyl ecdysterone -22- methyl ethers,20- hydroxyl ecdysterone -25- methyl ethers,Abutasterone,22,Bis--tables of 23--Pheheirospermum japonicum sterone,20,26- dihydroxy ecdysterone (sufficient sterone C),24- tables-abutasterone,Pheheirospermum japonicum sterone,29- cyasterones,Ajugasterone B,24 (28) [Z]-dehydrogenation amarasterone B,Amarasterone A,Ajugasterone C,Deer root sterone C,20- hydroxyls ecdysterone -22,25- dimethyl ethers,20- hydroxyl ecdysterone -22- ethylethers,Deer root sterone,24 (25)-dehydrogenation precyaterone,Loose Rhapontisterone,Cyasterone,20- hydroxyl ecdysterone -22- allyl ethers,24 (28) [Z]-dehydrogenation -29- hydroxyl podecdysone Cs,20- hydroxyl ecdysterone -22- acetic acid esters,Wei Teke sterones E (20- hydroxyl ecdysterone -25- acetic acid esters),20- hydroxyl ecdysterone -22- n-propyl ethers,24- hydroxyl cyasterones,20- hydroxyl ecdysterone -22- n-butyl ethers,The native China fir sterone A 22- hemisuccinic acid esters of sharp leaf,22- acetoacetyl -20- hydroxyl ecdysterones,20- hydroxyl ecdysterone -22- benzylic ethers,Atyiplex canescen sterone,20- hydroxyl ecdysterone -22- hemisuccinic acid esters,Inokosterone -26- hemisuccinic acid esters,20- hydroxyl ecdysterone -22- benzoin esters,20- hydroxyl ecdysterone -22- β-D- glucopyranosides,20- hydroxyl ecdysterone -25- β-D- glucopyranosides,This Lenno glucosides A (alpha-galactoside of 20- hydroxyls ecdysterone -22),The β of 3- deoxidations -1,20- dihydroxy ecdysterone (sterone A is integrated in 3- deoxidations),Sterone A is integrated in 2- deoxidations,1- tables-integration sterone A,Integrate sterone A,This Lenno glucosides C (integrates the alpha-galactosides of sterone A 22),2,22- double deoxidation -20- hydroxyl ecdysterones,2- deoxidation -20- hydroxyl ecdysterones,2- deoxidation -20- hydroxyl ecdysterone -3- acetic acid esters,2- deoxidations -20,26- dihydroxy ecdysterones,2- deoxidation -20- hydroxyl ecdysterone -22- acetic acid esters,2- deoxidation -20- hydroxyls ecdysterone -3,22- diacetate esters,2- deoxidation -20- hydroxyl ecdysterone -22- benzoin esters,The native China fir sterone A 2- hemisuccinic acid esters of sharp leaf,20- hydroxyl ecdysterone -2- methyl ethers,20- hydroxyl ecdysterone -2- acetic acid esters,20- hydroxyl ecdysterone -2- hemisuccinic acid esters,20- hydroxyl ecdysterone -2- β D- glucopyranosides,2- pellet sulphonyl -20- hydroxyl ecdysterones,20- hydroxyls ecdysterone -2,22- dimethyl ethers,Native β-D- xylopyranoses the glucosides (Bai Manghua glucosides B) of China fir sterone A 3 of sharp leaf,20- hydroxyl ecdysterone -3- methyl ethers,20- hydroxyl ecdysterone -3- acetic acid esters,β-D- xylopyranoses the glucosides (Bai Manghua glucosides A) of 20- hydroxyls ecdysterone -3,20- hydroxyl ecdysterone -3- β-D- glucopyranosides,This Lenno glucosides D (alpha-galactoside of 20- hydroxyls ecdysterone -3),β-D- glucopyranoses the acyl of 20- hydroxyls ecdysterone 3-[1-3]-β-D- xylopyranoses glucosides (Bai Manghua glucosides C),20- hydroxyls ecdysterone -3,22- dimethyl ethers,Cyasterone -3- acetic acid esters,2- dehydrogenation -3- table -20- hydroxyl ecdysterones,3- table -20- hydroxyls ecdysterones (Serratula centauroides sterone),Deer root sterone D,3- dehydrogenation -20- hydroxyl ecdysterones,5 beta-hydroxies -25,The native China fir sterone A of the dehydrogenations of 26- bis- point leaf,5 beta-hydroxy stachysterone C,25- deoxidations carinula element B,Carinula element B,25- fluorine carinula element B,5 beta-hydroxy abutasterones,26- hydroxyls carinula element B,29- promise hydroxyl cyasterones,Hydroxyl cyasterone,6 beta-hydroxy -20- hydroxyl ecdysterones,6 alpha-hydroxy-2 0- hydroxyl ecdysterones,20- hydroxyl ecdysterone -6- oximes,The native China fir sterone A 6- carboxymethyl oximes of sharp leaf,20- hydroxyl ecdysterone -6- carboxymethyl oximes,Ajugasterone C,Deer root sterone B,The happy sterone A of rice,Magnificent fried dough twist sterone B,Magnificent fried dough twist sterone A,Turkesterone -2- acetic acid esters,Slope Buddhist nun's sterone (Rhapontisterone),Turkesterone,Magnificent fried dough twist sterone C,25- hydroxyls China fried dough twist sterone B,25- hydroxyls China fried dough twist sterone A,The western sterone of handkerchief,Turkesterone -2,22- diacetate esters,Turkesterone -22- acetic acid esters,The α of Turkesterone-11-acetic acid esters,Turkesterone -2,11 α-diacetate esters,The MCPP-propionic acid) ester of Turkesterone -11,The iophenoxic acid ester of Turkesterone -11,The α of Turkesterone-11-capronate,The α of Turkesterone-11-decylate,The α of Turkesterone-11-laurate,The α of Turkesterone-11-myristate,The α of Turkesterone-11-Arachidate,The beta-hydroxy promise hydroxyl cyasterone of 22- dehydrogenations -12,The beta-hydroxy cyasterone of 22- dehydrogenations -12,The beta-hydroxy hydroxyl cyasterone of 22- dehydrogenations -12,14- deoxidations (14 α-H) -20- hydroxyl ecdysterones,20- hydroxyl ecdysterone -14- methyl ethers,14 α-perhydroxyl radical -20- hydroxyl ecdysterones,20- hydroxyls ecdysterone 14,22- dimethyl ethers,20- hydroxyls ecdysterone -2,3,14,22- tetramethyl ethers,(20S) -22- deoxidations -20,21- dihydroxy ecdysterones,22,25- double deoxidation ecdysterones,(22S)-20-(2,2 '-bis- methylfuran bases) ecdysterone,(22R)-20-(2,2 '-bis- methylfuran bases) ecdysterone,22- deoxidation ecdysterones,25- deoxidation ecdysterones,22- deoxidation ecdysterones,Ecdysterone,22- tables-ecdysterone,24- methyl ecdysterone (20- deoxidations makisterone A),Ecdysterone -22- hemisuccinic acid esters,25- deoxidation ecdysterone -22- β-D- glucopyranosides,Ecdysterone -22- myristates,The iso- ecdysterones of 22- dehydrogenations -20-,The iso- ecdysterones of 20-,The iso- 22- tables-ecdysterones of 20-,2- deoxidation ecdysterones,This Lenno glucosides E (beta-glucosidases of 2- deoxidations ecdysterone 3；Cloth indigo plant glucosides A),2- deoxidation ecdysterone -22- acetic acid esters,2- deoxidations ecdysterone -3,22- diacetate esters,2- deoxidation ecdysterone -22- β-D- glucopyranosides,2- deoxidation ecdysterone 25- β-D- glucopyranosides,2- deoxidation -21- hydroxyl ecdysterones,The iso- ecdysterones of 3- tables -22-,3- dehydrogenation -2- deoxidations ecdysterones (silenosterone),3- dehydrogenation ecdysterones,3- dehydrogenation -2- deoxidation ecdysterone -22- acetic acid esters,Ecdysterone -6- carboxymethyl oximes,Ecdysterone -2,3- acetonides,14- table -20- hydroxyls ecdysterone -2,3- acetonides,20- hydroxyls ecdysterone -2,3- acetonides,20- hydroxyls ecdysterone -20,22- acetonides,14- table -20- hydroxyls ecdysterone -2,3,20,The acetonides of 22- bis-,The western sterone -20 of handkerchief,22-p- phenol methylene acetals,Poststerone,(20R)-dihydro poststerone,(20S) dihydro poststerone,Poststerone -20- pellet sulfohydrazides,(20S)-dihydro poststerone -2,3,The benzoates of 20- tri-,(20R)-dihydro poststerone -2,3,The benzoates of 20- tri-,(20R) dihydro poststerone -2,3- acetonides,(20S) dihydro poststerone -2,3- acetonides,(5 α-H)-dihydro rubrosterone,2,14,22,- 5 α of deoxidation of 25- tetra--ecdysterone,5 α -one glycol,Bake sterol,2α,3α,22S,- 5 α of 25- tetrahydroxys-cholesteric -6- ketone,(5 α-H) -2- deoxidation -21- hydroxyl ecdysterones,Chestnut sterone,24- Biao-chestnut sterone,Sterone A is integrated in (5 α-H) -2- deoxidations,Sterone A is integrated in (5 α-H) -22- deoxidations,(5 α-H) -20- hydroxyl ecdysterones,24,The double dehydrogenation Dacryhainansteroncs of 25-,25,The double dehydrogenation Dacryhainansteroncs of 26-,5- deoxidations OK a karaoke club reaches sterone (Dacryhainansteronc),(14 α-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,25- hydroxyl Dacryhainansteroncs,Rubrosterone,(5 β-H)-dihydro rubrosterone,- 17 β of dihydro rubrosterone-acetic acid esters,This ground sterone,20- hydroxyls ecdysterone -2,3,22- triacetates,14- deoxidations (14 β-H) -20- hydroxyl ecdysterones,14- table -20- hydroxyl ecdysterones,9α,20- dihydroxy ecdysterones,Malaysia sterone,2- deoxidations carinula element B-3- β-D- glucopyranosides,Ajugalactone,Its blue ketone B,2β,3β,6 α-the β of trihydroxy-5-cholestane,2β,3β,6 β-the β of trihydroxy-5-cholestane,14- dehydrogenations this reach sterone,Stachysterone B,2β,3β,9α,20R,22R,- 5 β of 25- hexahydroxys-cholesteric -7,14- diene -6- ketone,OK a karaoke club reaches sterone,(14 β-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,4- dehydrogenation -20- hydroxyl ecdysterones,14- methyl isophthalic acid 2- alkene-Si Da sterones,14- methyl isophthalic acid 2- alkene -15,20- dihydroxy ecdysterones,Sufficient sterone B,2β,3β,20R,Fluoro- 5 β of 22R- tetrahydroxys -25--cholesteric -8,14- diene -6- ketone (25- fluorine foot sterone B),Charon sterone,14- deoxidations -14,18- ring -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyl ecdysterones,9βα,14 beta epoxide -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyls ecdysterone 2,3,20,The acetonides of 22- bis-,28- high rape plain lactones,Iso- high rape plain lactone,Non-steroidal ligands,Or compound as claimed in claim 1,Wherein described recombination switches set compound produces response to the part.

30. a kind of method of the goal of regulation and control gene expression in host cell, it is characterised in that the host cell includes one first restructuring box, wherein the first restructuring box is included：

One is concentrated the first polynucleotides for encoding one or more polypeptides, comprising：

One transactivation domain；

One DNA binding structural domain, identification is with expressing the response element that target gene is operatively connected for needing to be regulated and controled；

One nuclear receptor ligands binding structural domain, one H group nuclear receptor ligands binding structural domain, one ecdysterone receptor ligand binding domain, the substitution mutant of one choristoneura fumigerana ecdysterone receptor ligand binding domain, the V390I/Y410E mutant of one choristoneura fumigerana ecdysterone receptor ligand binding domain, or a choristoneura fumigerana ecdysterone receptor ligand binding domain E274V/V390I/Y410E mutant；And

One second restructuring box, comprising：

One response element for can be incorporated on the DNA binding structural domains；

One promoter for being operationally coupled on response element；And

One target gene；

Methods described includes contacting the host cell with the compound with following chemical formula：

Wherein

R¹、R²、R³And R⁴For

A) H, (C₁-C₆) alkyl；(C₁-C₆) alkylhalide group；(C₁-C₆) cyanoalkyl；(C₁-C₆) hydroxyalkyl；(C_1-4) alkoxy (C₁-C₆) alkyl；(C₂-C₆) alkenyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；(C₂-C₆) alkynyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；C₃-C₅Cycloalkyl, optionally by halogen, cyano group, hydroxyl or (C₁-C₄) alkyl substitution；Or

B) unsubstituted or substituted benzyl, wherein substituent stand alone as 1-5 H, halogen, nitro, cyano group, hydroxyl, (C₁-C₆) alkyl or (C₁-C₆) alkoxy；And

R⁵For H；OH；F；Cl；Or (C₁-C₆) alkoxy；

On condition that：

Work as R¹、R²、R³And R⁴For isopropyl, then R⁵It is not hydroxyl；

Work as R¹、R²、R³And R⁴For H, then R⁵It is not methoxyl group；

Work as R¹、R²And R³All it is H and R⁵During for hydroxyl, then R⁴It is not methyl or ethyl；

Work as R¹、R²Or R⁴In one, two or three be methyl when, then H groups nuclear receptor ligands binding structural domain is not the silkworm of wild type, maduca sexta, choristoneura fumigerana, Drosophila melanogaster, Aedes Aegypti, lone star tick, Bemisia argentifolii, rice green leafhopper, yellow meal worm ligand binding domains, nor the E274V/V390I/Y410E mutant of choristoneura fumigerana ligand binding domains；Wherein,

As (1) R¹、R²、R³And R⁴For H and R⁵During for H, hydroxyl or fluorine, or (2) R¹、R²、R³And R⁴In one be methyl and it is remaining be H, and R⁵During for H or hydroxyl, or (3) R¹、R²And R³In one be methyl, R⁴For methyl, and R⁵During for H or hydroxyl, or (4) R¹、R²、R³And R⁴All it is methyl, and R⁵During for hydroxyl, or (5) R¹、R²And R³All it is H, R⁴For n-propyl or benzyl, and R⁵During for hydroxyl, then H groups nuclear receptor ligands binding structural domain is not the choristoneura fumigerana ligand binding domains of wild type, nor the E274V/V390I/Y410E mutant of choristoneura fumigerana ligand binding domains.

31. a kind of method of the goal of regulation and control gene expression in host cell, it is characterised in that host cell includes：

First restructuring box of one the first polynucleotides comprising first polypeptide of coding, comprising：

One transactivation domain；

One H group nuclear receptor ligands binding structural domain；

Second restructuring box of one the second polynucleotides comprising second polypeptide of coding, comprising：

One DNA binding structural domain, the target gene that identification needs to be regulated and controled with expression is operationally coupled to response element；

One H group nuclear receptor ligands binding structural domain, one ecdysterone receptor ligand binding domain, the substitution mutant of one choristoneura fumigerana ecdysterone receptor ligand binding domain, the V390I/Y410E mutant of one choristoneura fumigerana ecdysterone receptor ligand binding domain, or a choristoneura fumigerana ecdysterone receptor ligand binding domain E274V/V390I/Y410E mutant；

One the 3rd restructuring box, comprising：

One response element for can be incorporated on the DNA binding structural domains；

One promoter for being operationally coupled on response element；And

One target gene；

Methods described is included contacts 20- hydroxyl ecdysterone -2- methyl ethers by the host cell,20- hydroxyl ecdysterone -3- methyl ethers,20- hydroxyl ecdysterone -14- methyl ethers,20- hydroxyls ecdysterone -2,22- dimethyl ethers,20- hydroxyls ecdysterone -3,22- dimethyl ethers,20- hydroxyls ecdysterone -14,22- dimethyl ethers,20- hydroxyls ecdysterone -22,25- dimethyl ethers,20- hydroxyls ecdysterone -2,3,14,22- tetramethyl ethers,20- hydroxyl ecdysterone -22- n-propyl ethers,20- hydroxyl ecdysterone -22- n-butyl ethers,20- hydroxyl ecdysterone -22- allyl ethers,20- hydroxyl ecdysterone -22- benzylic ethers,20- hydroxyl ecdysterone -22- (28R,S) -2 '-ethyl epoxy ethyl ether,Ponasterone A's -2- methyl ethers,Ponasterone A's -14- methyl ethers,Ponasterone A's -22- methyl ethers,Ponasterone A -2,22- dimethyl ethers,Ponasterone A -3,22- dimethyl ethers,Ponasterone A -14,22- dimethyl ethers,Dacryhainansteronc -22- methyl ethers,25,The double dehydrogenation ponasterone As of 26-,(different stachysterone C (Δ 25 (26))),This reaches sterone (this reaches sterone) (stachysterone D),Stachysterone C,22- deoxidation -20- hydroxyls ecdysterones (Japanese yew sterone),Ponasterone A,Bracket fungus sterone B,22- dehydrogenation -20- hydroxyl ecdysterones,Ponasterone A's -22- methyl ethers,20- hydroxyl ecdysterones,Pterosterone,(25R)-Inokosterone,(25S)-Inokosterone,The native China fir sterone of sharp leaf,25- fluorine ponasterone A,24 (28)-dehydrogenation makisterone A,24-epi-makisterone A,Makisterone A,20- hydroxyl ecdysterone -22- methyl ethers,20- hydroxyl ecdysterone -25- methyl ethers,Abutasterone,22,Bis--tables of 23--Pheheirospermum japonicum sterone,20,26- dihydroxy ecdysterone (sufficient sterone C),24- tables-abutasterone,Pheheirospermum japonicum sterone,29- cyasterones,Ajugasterone B,24 (28) [Z]-dehydrogenation amarasterone B,Amarasterone A,Ajugasterone C,Deer root sterone C,20- hydroxyls ecdysterone -22,25- dimethyl ethers,20- hydroxyl ecdysterone -22- ethylethers,Deer root sterone,24 (25)-dehydrogenation precyaterone,Loose Rhapontisterone,Cyasterone,20- hydroxyl ecdysterone -22- allyl ethers,24 (28) [Z]-dehydrogenation -29- hydroxyl podecdysone Cs,20- hydroxyl ecdysterone -22- acetic acid esters,Wei Teke sterones E (20- hydroxyl ecdysterone -25- acetic acid esters),20- hydroxyl ecdysterone -22- n-propyl ethers,24- hydroxyl cyasterones,20- hydroxyl ecdysterone -22- n-butyl ethers,The native China fir sterone A 22- hemisuccinic acid esters of sharp leaf,22- acetoacetyl -20- hydroxyl ecdysterones,20- hydroxyl ecdysterone -22- benzylic ethers,Atyiplex canescen sterone,20- hydroxyl ecdysterone -22- hemisuccinic acid esters,Inokosterone -26- hemisuccinic acid esters,20- hydroxyl ecdysterone -22- benzoin esters,20- hydroxyl ecdysterone -22- β-D- glucopyranosides,20- hydroxyl ecdysterone -25- β-D- glucopyranosides,This Lenno glucosides A (alpha-galactoside of 20- hydroxyls ecdysterone -22),The β of 3- deoxidations -1,20- dihydroxy ecdysterone (sterone A is integrated in 3- deoxidations),Sterone A is integrated in 2- deoxidations,1- tables-integration sterone A,Integrate sterone A,This Lenno glucosides C (integrates the alpha-galactosides of sterone A 22),2,22- double deoxidation -20- hydroxyl ecdysterones,2- deoxidation -20- hydroxyl ecdysterones,2- deoxidation -20- hydroxyl ecdysterone -3- acetic acid esters,2- deoxidations -20,26- dihydroxy ecdysterones,2- deoxidation -20- hydroxyl ecdysterone -22- acetic acid esters,2- deoxidation -20- hydroxyls ecdysterone -3,22- diacetate esters,2- deoxidation -20- hydroxyl ecdysterone -22- benzoin esters,The native China fir sterone A 2- hemisuccinic acid esters of sharp leaf,20- hydroxyl ecdysterone -2- methyl ethers,20- hydroxyl ecdysterone -2- acetic acid esters,20- hydroxyl ecdysterone -2- hemisuccinic acid esters,20- hydroxyl ecdysterone -2- β D- glucopyranosides,2- pellet sulphonyl -20- hydroxyl ecdysterones,20- hydroxyls ecdysterone -2,22- dimethyl ethers,Native β-D- xylopyranoses the glucosides (Bai Manghua glucosides B) of China fir sterone A 3 of sharp leaf,20- hydroxyl ecdysterone -3- methyl ethers,20- hydroxyl ecdysterone -3- acetic acid esters,β-D- xylopyranoses the glucosides (Bai Manghua glucosides A) of 20- hydroxyls ecdysterone -3,20- hydroxyl ecdysterone -3- β-D- glucopyranosides,This Lenno glucosides D (alpha-galactoside of 20- hydroxyls ecdysterone -3),β-D- glucopyranoses the acyl of 20- hydroxyls ecdysterone 3-[1-3]-β-D- xylopyranoses glucosides (Bai Manghua glucosides C),20- hydroxyls ecdysterone -3,22- dimethyl ethers,Cyasterone -3- acetic acid esters,2- dehydrogenation -3- table -20- hydroxyl ecdysterones,3- table -20- hydroxyls ecdysterones (Serratula centauroides sterone),Deer root sterone D,3- dehydrogenation -20- hydroxyl ecdysterones,5 beta-hydroxies -25,The native China fir sterone A of the dehydrogenations of 26- bis- point leaf,5 beta-hydroxy stachysterone C,25- deoxidations carinula element B,Carinula element B,25- fluorine carinula element B,5 beta-hydroxy abutasterones,26- hydroxyls carinula element B,29- promise hydroxyl cyasterones,Hydroxyl cyasterone,6 beta-hydroxy -20- hydroxyl ecdysterones,6 alpha-hydroxy-2 0- hydroxyl ecdysterones,20- hydroxyl ecdysterone -6- oximes,The native China fir sterone A 6- carboxymethyl oximes of sharp leaf,20- hydroxyl ecdysterone -6- carboxymethyl oximes,Ajugasterone C,Deer root sterone B,The happy sterone A of rice,Magnificent fried dough twist sterone B,Magnificent fried dough twist sterone A,Turkesterone -2- acetic acid esters,Slope Buddhist nun's sterone (Rhapontisterone),Turkesterone,Magnificent fried dough twist sterone C,25- hydroxyls China fried dough twist sterone B,25- hydroxyls China fried dough twist sterone A,The western sterone of handkerchief,Turkesterone -2,22- diacetate esters,Turkesterone -22- acetic acid esters,The α of Turkesterone-11-acetic acid esters,Turkesterone -2,11 α-diacetate esters,The MCPP-propionic acid) ester of Turkesterone -11,The iophenoxic acid ester of Turkesterone -11,The α of Turkesterone-11-capronate,The α of Turkesterone-11-decylate,The α of Turkesterone-11-laurate,The α of Turkesterone-11-myristate,The α of Turkesterone-11-Arachidate,The beta-hydroxy promise hydroxyl cyasterone of 22- dehydrogenations -12,The beta-hydroxy cyasterone of 22- dehydrogenations -12,The beta-hydroxy hydroxyl cyasterone of 22- dehydrogenations -12,14- deoxidations (14 α-H) -20- hydroxyl ecdysterones,20- hydroxyl ecdysterone -14- methyl ethers,14 α-perhydroxyl radical -20- hydroxyl ecdysterones,20- hydroxyls ecdysterone 14,22- dimethyl ethers,20- hydroxyls ecdysterone -2,3,14,22- tetramethyl ethers,(20S) -22- deoxidations -20,21- dihydroxy ecdysterones,22,25- double deoxidation ecdysterones,(22S)-20-(2,2 '-bis- methylfuran bases) ecdysterone,(22R)-20-(2,2 '-bis- methylfuran bases) ecdysterone,22- deoxidation ecdysterones,25- deoxidation ecdysterones,22- deoxidation ecdysterones,Ecdysterone,22- tables-ecdysterone,24- methyl ecdysterone (20- deoxidations makisterone A),Ecdysterone -22- hemisuccinic acid esters,25- deoxidation ecdysterone -22- β-D- glucopyranosides,Ecdysterone -22- myristates,The iso- ecdysterones of 22- dehydrogenations -20-,The iso- ecdysterones of 20-,The iso- 22- tables-ecdysterones of 20-,2- deoxidation ecdysterones,This Lenno glucosides E (beta-glucosidases of 2- deoxidations ecdysterone 3；Cloth indigo plant glucosides A),2- deoxidation ecdysterone -22- acetic acid esters,2- deoxidations ecdysterone -3,22- diacetate esters,2- deoxidation ecdysterone -22- β-D- glucopyranosides,2- deoxidation ecdysterone 25- β-D- glucopyranosides,2- deoxidation -21- hydroxyl ecdysterones,The iso- ecdysterones of 3- tables -22-,3- dehydrogenation -2- deoxidations ecdysterones (silenosterone),3- dehydrogenation ecdysterones,3- dehydrogenation -2- deoxidation ecdysterone -22- acetic acid esters,Ecdysterone -6- carboxymethyl oximes,Ecdysterone -2,3- acetonides,14- table -20- hydroxyls ecdysterone -2,3- acetonides,20- hydroxyls ecdysterone -2,3- acetonides,20- hydroxyls ecdysterone -20,22- acetonides,14- table -20- hydroxyls ecdysterone -2,3,20,The acetonides of 22- bis-,The western sterone -20 of handkerchief,22-p- phenol methylene acetals,Poststerone,(20R)-dihydro poststerone,(20S) dihydro poststerone,Poststerone -20- pellet sulfohydrazides,(20S)-dihydro poststerone -2,3,The benzoates of 20- tri-,(20R)-dihydro poststerone -2,3,The benzoates of 20- tri-,(20R) dihydro poststerone -2,3- acetonides,(20S) dihydro poststerone -2,3- acetonides,(5 α-H)-dihydro rubrosterone,2,14,22,- 5 α of deoxidation of 25- tetra--ecdysterone,5 α -one glycol,Bake sterol,2α,3α,22S,- 5 α of 25- tetrahydroxys-cholesteric -6- ketone,(5 α-H) -2- deoxidation -21- hydroxyl ecdysterones,Chestnut sterone,24- Biao-chestnut sterone,Sterone A is integrated in (5 α-H) -2- deoxidations,Sterone A is integrated in (5 α-H) -22- deoxidations,(5 α-H) -20- hydroxyl ecdysterones,24,The double dehydrogenation Dacryhainansteroncs of 25-,25,The double dehydrogenation Dacryhainansteroncs of 26-,5- deoxidations OK a karaoke club reaches sterone (Dacryhainansteronc),(14 α-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,25- hydroxyl Dacryhainansteroncs,Rubrosterone,(5 β-H)-dihydro rubrosterone,- 17 β of dihydro rubrosterone-acetic acid esters,This ground sterone,20- hydroxyls ecdysterone -2,3,22- triacetates,14- deoxidations (14 β-H) -20- hydroxyl ecdysterones,14- table -20- hydroxyl ecdysterones,9α,20- dihydroxy ecdysterones,Malaysia sterone,2- deoxidations carinula element B-3- β-D- glucopyranosides,Ajugalactone,Its blue ketone B,2β,3β,6 α-the β of trihydroxy-5-cholestane,2β,3β,6 β-the β of trihydroxy-5-cholestane,14- dehydrogenations this reach sterone,Stachysterone B,2β,3β,9α,20R,22R,- 5 β of 25- hexahydroxys-cholesteric -7,14- diene -6- ketone,OK a karaoke club reaches sterone,(14 β-H) -14- deoxidation -25- hydroxyl Dacryhainansteroncs,4- dehydrogenation -20- hydroxyl ecdysterones,14- methyl isophthalic acid 2- alkene-Si Da sterones,14- methyl isophthalic acid 2- alkene -15,20- dihydroxy ecdysterones,Sufficient sterone B,2β,3β,20R,Fluoro- 5 β of 22R- tetrahydroxys -25--cholesteric -8,14- diene -6- ketone (25- fluorine foot sterone B),Charon sterone,14- deoxidations -14,18- ring -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyl ecdysterones,9βα,14 beta epoxide -20- hydroxyl ecdysterones,9α,14 α-epoxy -20- hydroxyls ecdysterone 2,3,20,The acetonides of 22- bis-,28- high rape plain lactones,Iso- high rape plain lactone,Non-steroidal ligands,Or compound as claimed in claim 1.

Images