CN102002525B - Reverse transcription detecting method of mammal RNA specimen - Google Patents
Reverse transcription detecting method of mammal RNA specimen Download PDFInfo
- Publication number
- CN102002525B CN102002525B CN 201010541770 CN201010541770A CN102002525B CN 102002525 B CN102002525 B CN 102002525B CN 201010541770 CN201010541770 CN 201010541770 CN 201010541770 A CN201010541770 A CN 201010541770A CN 102002525 B CN102002525 B CN 102002525B
- Authority
- CN
- China
- Prior art keywords
- rna
- reverse transcription
- poly
- primer
- reaction solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a reverse transcription detecting method of mammal RNA specimen, comprising (1) extracting RNA specimen by using a conventional method, then adding a Poly (A) structure into the tail end of RNA by using a Poly (A) polymerase; (2) converting the reaction system to the buffer condition of reverse transcription by using a conversion buffer, then binding with a reverse transcription primer comprising a specific sequence by taking the Poly (A) as a binding site and then implementing reverse transcription and detecting RNA. The reverse transcription detecting method of mammal RNA specimen provided by the invention has the advantages that the method is simple, the cost is low, the macromolecular RNA and the micromolecular RNA can be simultaneously subjected into reverse transcription and a plurality of indexes can be detected.
Description
Technical field
The invention belongs to RNA and send out the field of transcribing, particularly relate to a kind of mammalian rna sample reverse transcription detection method.
Background technology
Now, in the biology field, the detection of the detection technique of RNA, especially mRNA, miRNA and siRNA is occupying very important effect aspect gene function, the genetic expression.But existing technological method is difficult to transcribe efficiently, at low cost simultaneously detection mRNA, miRNA, and this also becomes one of factor of restriction gene studies.
Traditional technology is to extract total RNA at RNA extraction agents such as using Trizol from sample, then with its reverse transcription.CDNA with reverse transcription carries out real-time quantitative PCR with Auele Specific Primer then, to detect the rna expression situation of target gene.Single extraction can detect a plurality of indexs.But it is to detect small molecular weight RNA such as miRNA that this technology has a fatal defective.Reason has following two.At first, small molecular weight RNA such as miRNA do not contain Poly special constructions such as (A), and the random primer combination rate is also lower, causes small molecular weight RNA to be difficult to be inverted record.Secondly, even if successful reverse transcription, the PCR product of small component RNA also very easily confuses with primer dimer and is difficult to analyze
In view of above reason, there are two tame u s companys once to propose solution, but the defective that all exists.
It at first is U.S. Applied Biotechnology company limited.It proposes to take specific probe primer to lead reverse transcription and detection, and is highly sensitive.But its subject matter is once to test to detect an index, detects a plurality of genes or index as need and then need buy a plurality of expensive but test kits that content is similar, and not only cost is higher and bigger to the consumption of sample.
Next is a U.S. QIAGEN Bioisystech Co., Ltd.The method that it adopts is the special tail end sequence of tail end polymerization at all RNA molecules, and carries out reverse transcription and detection with this sequence.But because the enzyme efficient of this reaction is lower, thus must remove most of macromolecule RNA with special extraction agent box, to guarantee detection to small molecular weight RNA.The result is exactly that this system can only detect small molecular weight RNA such as miRNA, then needs not only waste time and energy, and error also can increase with traditional method extracting again as macromolecule RNA such as need detection mRNA.
In addition, the common problem of existing method is that cost is higher, though the solution defectiveness of above-mentioned two companies is owing to lacking more practical technique, so the monopoly position of occuping.The cost that its single detects approximately is 5～10 times of traditional method.
The patent No. of Abi company and Qiagen company is: ABI:US:5, and 538,848,5,723,591,5,876,930,6,030,787,6,258,569, and 5,804, and 375;
Qiagen：U.S..5,035,996；5,945,313；6,287,823；or 6,518,026。
Summary of the invention
Technical problem to be solved by this invention provides a kind of mammalian rna sample reverse transcription detection method, and this method is simple, and cost is low, and reverse transcription macromole and microRNA carry out the detection of a plurality of indexs simultaneously.
A kind of mammalian rna sample reverse transcription detection method of the present invention comprises:
(1) uses the traditional method for extracting sample rna, use intestinal bacteria Poly (A) polysaccharase to add Poly (A) structure then at the tail end of RNA;
(2) after above-mentioned enzyme reaction finishes, reaction system is converted to the buffer conditions of reverse transcription with conversion buffered liquid, be binding site with Poly (A) then, in conjunction with on include the reverse transcription primer of specific sequence, and carry out reverse transcription, at last according to the sequence of purpose RNA and design specific primer in conjunction with the specific sequence of the reverse transcription primer that gets on and (at first copy the miRNA sequence as positive-sense strand, copy one section joint sequence as antisense strand according to the Tm value of positive-sense strand then), all kinds of RNA in the sample are detected.
Described step (1) adopts Trizol single stage method or phenol-chloroform method extracting RNA.
Described step (1) 1X Poly (A) polymeric enzyme reaction damping fluid [50mMTris-HCl (pH 7.9@25 ℃), 250mMNaCl, 10mMMgCl
2] and 1mMATP, at 37 ℃ of incubations.
The preparation method of the conversion buffered liquid in the described step (2) is as follows:
Dispose reaction solution A and reaction solution B respectively
C) reaction solution A:
i.PAP buffer：1.5ul
ii.ATP(10mM)：1.5ul
Iii.Poly A polysaccharase: 1U
iv.RNA：3ug
V. supply water to 15ul
D) reaction solution B
i.Replenish buffer：3.5ul
Ii.dNTP (NEB, article No. N0446S): 2ul
Iii.MMLV ThermoScript II (NEB, article No. M0253L): 1U
Iv. supply water to 35ul
PAP buffer:0.5M Tris-HCl (pH 7.9@25 ℃) wherein, 2.5M NaCl, 100mMMgCl
2Replenish buffer:0.5M Tris-HCl (pH 7.9@25 ℃), 143mM DTT;
Reaction solution A is put into 37 ℃ hatch 30min, add reaction solution B reaction 90min then, last 85 ℃ of 5min sex change obtain conversion buffered liquid.
In the described step (2) is the following 37 ℃ of annealing of current buffer system in conjunction with condition.
Specific sequence in the described step (2) is
GCTGTCAACGATACGCTACCTAACGGCATGACAGTG。
The reverse transcription primer that includes specific sequence in the described step (2) is made up of three parts, promptly any Nucleotide, Oligo-dT and specific sequence.
Oligo-dT be used for identification and in conjunction with Poly (A) structure, mononucleotide is used for primer is anchored on the zero position of Poly (A) structure, specific sequence (3) is used for synthetic downstream primer, with remedy after the microRNA reverse transcription can't PCR defective, mainly detect as subsequent P CR.
The reverse transcription primer that includes specific sequence in the described step (2) is
GCTGTCAACGATACGCTACCTAACGGCATGACAGTGTTTTTTTTTTTTTTTN, wherein TTTTTTTTTTTTTTT represents Oligo-dT, N represents any Nucleotide.
This specific sequence adopts takes from the genomic DNA fragment of mitten crab, does not all have homology with all vertebrate dna sequence dna, can effectively avoid non-specific amplification.
Specific sequence amounts to 40bp, can satisfy design of primers requirements such as various Tm values, GC content, and not worry structures such as hairpin structure, primer dimer.Can use one of target sequence primer specifically, distinguished sequence synthetic primer matches therewith, the aim sequence that can increase specifically, and needn't remove to buy special-purpose probe.For macromolecular RNA, also can use any ready-madely or detect primer with the RNA of additive method design, and needn't redesign synthetic.When detecting, situation or detection index are selected the primer of the various designs in all kinds of sources such as GAPDH, U6, β-actin, c-Myc, rRNA arbitrarily per sample.
The present invention adds Poly (A) polysaccharase earlier in the RNA sample that extracting goes out, make its end at the RNA molecule under the effect of ATP add Poly (A) tail, uses conversion buffered liquid reaction environment to be converted to the buffered environment that is fit to MLV then.In new reaction environment, add special primer, M-MLV ThermoScript II and dNTP, utilize the affinity of the Oligo-dT structure on Poly (A) structure and the special primer, special primer and ThermoScript II are attached on the RNA molecule, then under the effect of dNTP, the M-MLV ThermoScript II is converted to cDNA with the RNA molecule, and last, the cDNA that reverse transcription forms can use the SYBR-Green method to detect all kinds of RNA.Detect primer and can use a special primer to match, also can use the detection primer of any additive method design with special sequence synthetic primer.All kinds of confidential reference items primers all can be used as reference.
Beneficial effect
Method of the present invention is simple, and cost is low, and single experiment just can be tested and be comprised mRNA, miRNA, siRNA are in interior all kinds of RNA indexs, and the reaction of standard reaction system single can be tested 200 indexs in theory, and traditional method can only be surveyed 20～50, and offshore company's like product can only be surveyed 1～5; Even if but like this,, operate identically with ordinary method for the experimenter, and do not need extra training, only need on the basis of conventional art, carry out a little improvement; And compare with external like product price up to ten thousand easily, the reagent cost of this programme only has more 10% cost than ordinary method; In addition, the existing RNA detection method of present method and all is perfect compatible, can directly use the detection primer of arbitrarily existing method and with reference to primer.
Description of drawings
Fig. 1 operational flowchart of the present invention; 1. being the RNA molecule in the sample, 2. is Poly (A) polysaccharase, 3. is ATP, 4. is the primer of particular design, 5. is the M-MLV ThermoScript II, 6. is dNTP, 7. the cDNA molecule that forms for reverse transcription;
Fig. 2 Δ Rn is with circulation change figure;
Fig. 3 RNA detected result.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after the content of having read the present invention's instruction, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
(1) gets fresh tissue or cell specimen;
(2) with Trizol single stage method or phenol-chloroform method extracting RNA, use intestinal bacteria Poly (A) polysaccharase to add Poly (A) structure then at the tail end of RNA, 1X Poly (A) polymeric enzyme reaction damping fluid [50mMTris-HCl (pH 7.9@25 ℃), 250mM NaCl, 10mMMgCl
2] and 1mM ATP, at 37 ℃ of incubations;
(3) prepare conversion buffered liquid
Dispose reaction solution A and reaction solution B respectively
A) reaction solution A:
i.PAP buffer：1.5ul
ii.ATP(10mM)：1.5ul
Iii.Poly A polysaccharase: 1U
iv.RNA：3ug
V. supply water to 15ul
B) reaction solution B
i.Replenish buffer：3.5ul
ii.dNTP：2ul
Iii.MMLV ThermoScript II: 1U
Iv. supply water to 35ul
PAP buffer:0.5M Tris-HCl (pH 7.9@25 ℃) wherein, 2.5M NaCl, 100mMMgCl
2Replenish buffer:0.5M Tris-HCl (pH 7.9@25 ℃), 143mM DTT;
Reaction solution A is put into 37 ℃ hatch 30min, add reaction solution B reaction 90min then, last 85 ℃ of 5min sex change obtain conversion buffered liquid;
(4) after above-mentioned steps (2) enzyme reaction finishes, converting reaction system the buffer conditions of reverse transcription to conversion buffered liquid, is binding site with Poly (A) then, the following 37 ℃ of annealing of current buffer system, in conjunction with on include the reverse transcription primer of specific sequence
GCTGTCAACGATACGCTACCTAACGGCATGACAGTGTTTTTTTTTTTTTTTN, and carry out reverse transcription, at last design specific primer, all kinds of RNA in the sample are detected according to the sequence of purpose RNA and in conjunction with the specific sequence of the reverse transcription primer that gets on.
Claims (4)
1. mammalian rna sample reverse transcription detection method comprises:
(1) use the traditional method for extracting sample rna, use intestinal bacteria Poly(A then) polysaccharase adds Poly (A) structure at the tail end of RNA, 1X Poly (A) polymeric enzyme reaction damping fluid 50mM Tris-HCl, pH7.9, at 25 ℃, 250mM NaCl, 10mMMgCl
2With 1mM ATP, at 37 ℃ of incubations;
(2) after above-mentioned enzyme reaction finishes, reaction system is converted to the buffer conditions of reverse transcription with conversion buffered liquid, be binding site with Poly (A) then, in conjunction with on include the reverse transcription primer of specific sequence, and carry out reverse transcription, at last design specific primer, all kinds of RNA in the sample are detected according to the sequence of purpose RNA and in conjunction with the specific sequence of the reverse transcription primer that gets on; The described reverse transcription primer that includes specific sequence is
GCTGTCAACGATACGCTACCTAACGGCATGACAGTGTTTTTTTTTTTTTTTN, wherein TTTTTTTTTTTTTTT represents Oligo-dT, N represents any Nucleotide;
The preparation method of conversion buffered liquid is as follows:
Dispose reaction solution A and reaction solution B respectively
A) reaction solution A:
i. PAP buffer：1.5μl
ii. ATP10mM：1.5μl
Iii. Poly A polysaccharase: 1U
iv. RNA：3μg
V. supply water to 15 μ l
B) reaction solution B
i. Replenish buffer：3.5μl
ii. dNTP：2μl
Iii. MMLV ThermoScript II: 1U
Iv. supply water to 35 μ l
PAP buffer:0.5M pH7.9 wherein is at 25 ℃ of Tris-HCl, 2.5M NaCl, 100mMMgCl
2Replenish buffer:0.5M pH7.9 is at 25 ℃ of Tris-HCl, 143mM DTT;
Reaction solution A is put into 37 ℃ hatch 30min, add reaction solution B reaction 90min then, last 85 ℃ of 5min sex change obtain conversion buffered liquid.
2. according to the described a kind of mammalian rna sample reverse transcription detection method of claim 1, it is characterized in that: described step (1) adopts Trizol single stage method or phenol-chloroform method extracting RNA.
3. according to the described a kind of mammalian rna sample reverse transcription detection method of claim 1, it is characterized in that: in the described step (2) is the following 37 ℃ of annealing of current buffer system in conjunction with condition.
4. according to the described a kind of mammalian rna sample reverse transcription detection method of claim 1, it is characterized in that: the specific sequence in the described step (2) is GCTGTCAACGATACGCTACCTAACGGCATGACAGTG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010541770 CN102002525B (en) | 2010-11-12 | 2010-11-12 | Reverse transcription detecting method of mammal RNA specimen |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010541770 CN102002525B (en) | 2010-11-12 | 2010-11-12 | Reverse transcription detecting method of mammal RNA specimen |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102002525A CN102002525A (en) | 2011-04-06 |
| CN102002525B true CN102002525B (en) | 2013-07-24 |
Family
ID=43810227
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010541770 Expired - Fee Related CN102002525B (en) | 2010-11-12 | 2010-11-12 | Reverse transcription detecting method of mammal RNA specimen |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102002525B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148342B (en) * | 2016-06-15 | 2018-10-02 | 内蒙古农业大学 | A kind of miRNA sequence, preparation method and applications |
| CN106148343B (en) * | 2016-06-15 | 2018-10-02 | 内蒙古农业大学 | The miRNA sequence of donkey, preparation method and applications |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1763223A (en) * | 2004-10-19 | 2006-04-26 | 中国人民解放军军事医学科学院放射医学研究所 | MiRNA detection method and test kit |
-
2010
- 2010-11-12 CN CN 201010541770 patent/CN102002525B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1763223A (en) * | 2004-10-19 | 2006-04-26 | 中国人民解放军军事医学科学院放射医学研究所 | MiRNA detection method and test kit |
Non-Patent Citations (1)
| Title |
|---|
| 毛瑞鑫 等.中华绒螯蟹部分基因组文库构建和微卫星位点的筛选.《上海水产大学学报》.2004,(第2期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102002525A (en) | 2011-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dueholm et al. | Generation of comprehensive ecosystem-specific reference databases with species-level resolution by high-throughput full-length 16S rRNA gene sequencing and automated taxonomy assignment (AutoTax) | |
| Courts et al. | Specific micro‐RNA signatures for the detection of saliva and blood in forensic body‐fluid identification | |
| Clokie et al. | Transcription of a ‘photosynthetic’T4‐type phage during infection of a marine cyanobacterium | |
| Seashols‐Williams et al. | High‐throughput miRNA sequencing and identification of biomarkers for forensically relevant biological fluids | |
| He et al. | Genomic and enzymatic evidence for acetogenesis among multiple lineages of the archaeal phylum Bathyarchaeota widespread in marine sediments | |
| Nercessian et al. | Bacterial populations active in metabolism of C1 compounds in the sediment of Lake Washington, a freshwater lake | |
| CN111334609B (en) | Primer group and kit for detecting mRNA corresponding to ORF1ab gene and N gene of 2019 novel coronavirus | |
| Imachi et al. | Methanolinea tarda gen. nov., sp. nov., a methane-producing archaeon isolated from a methanogenic digester sludge | |
| Shanks et al. | Quantitative PCR for detection and enumeration of genetic markers of bovine fecal pollution | |
| Imachi et al. | Non-sulfate-reducing, syntrophic bacteria affiliated with Desulfotomaculum cluster I are widely distributed in methanogenic environments | |
| Smith et al. | Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology | |
| Hodgkinson et al. | Addictions biology: haplotype-based analysis for 130 candidate genes on a single array | |
| Morono et al. | Hot-alkaline DNA extraction method for deep-subseafloor archaeal communities | |
| Connelly et al. | Urea uptake and carbon fixation by marine pelagic bacteria and archaea during the Arctic summer and winter seasons | |
| Lin et al. | Development of a dinoflagellate-oriented PCR primer set leads to detection of picoplanktonic dinoflagellates from Long Island Sound | |
| CN101109018A (en) | Method of detecting mononucleotide pleomorphism of CYP2D6 gene ninth exon | |
| CN108165613A (en) | A kind of method for detecting excretion body tRFRNA | |
| Jia et al. | Rare taxa exhibit disproportionate cell-level metabolic activity in enriched anaerobic digestion microbial communities | |
| Nesbø et al. | Searching for mesophilic Thermotogales bacteria:“mesotogas” in the wild | |
| CN102002525B (en) | Reverse transcription detecting method of mammal RNA specimen | |
| Fauquenoy et al. | Repression of cell differentiation by a cis-acting lincRNA in fission yeast | |
| Hatamoto et al. | Detection of active butyrate-degrading microorganisms in methanogenic sludges by RNA-based stable isotope probing | |
| Paul et al. | Genome sequence of the solvent-producing bacterium Clostridium carboxidivorans strain P7T | |
| Castellanos et al. | Single nucleotide polymorphisms in the IS 900 sequence of Mycobacterium avium subsp. paratuberculosis are strain type specific | |
| WO2021194603A3 (en) | Methods, oligonucleotides, and kits for detection and treatment of coronavirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130724 Termination date: 20151112 |
|
| EXPY | Termination of patent right or utility model |