CN102002506B - Application of OsPSK3 gene of rice on aspect of improving economical characters of rice - Google Patents

Abstract

The invention belongs to the field of a transgenic technology, in particular to application of an OsPSK3 gene of rice on the aspect of improving the economical characters of the rice. When the gene is overexpressed in indica type rice, a transplant plant exhibits a stronger growth tendency as follows: the germination and the growth of plants are quicker; a fibrous root system is more advanced than the contrast; the color of the leaves is obviously darkened and the stem is prolonged; and the stem is thicker and the color of the leaves is green black when the plants are ripe. A series of changes in economical phenotypes strengthen the growth tendency of the plants; and the phenotype with the content of the chlorophyll in the leaves obviously increased from the seedling stage strengthens the photosynthesis of the species. The invention has the advantages that the OsPSK3 transgenic rice is cultivated by utilizing a gene engineering method; and the economical characters of the growth tendency, the photosynthesis and the like of the rice crop are enhanced.

Description

The application of rice Os PSK3 gene aspect improvement paddy rice economical character

Technical field

The invention belongs to field of transgenic technology, be specifically related to a kind of improvement paddy rice economical character method.

Background technology

Paddy rice is the main food crop of China, and 1,300,000,000 populations have 60% to be food with the rice.Along with China's Increase of population, the demand of paddy rice is also grown with each passing day.So improving rice yield has great importance.The process of growth of paddy rice is divided into nourishes and grows and reproductive growth two portions, and excellent nutrition proterties is the important prerequisite that guarantees the paddy rice stable and high yields.

At present utilizing the technology of transgene improvement farm crop economic characters both at home and abroad mainly is the relation according to known functional gene and phenotypic character; Adopt constitutive expression carrier or tissue specificity expression vector that goal gene is imported target plant, in the hope of obtaining the improvement of specific economic characters of crop or resistance proterties.

Plant sulphur peptide hormone (Phytosulfokine, PSK-α) is newfound a kind of plant hormone that promotes cell fission and differentiation that has.By Matsubayashi etc. ^[1]From officinalis (Asparagus officinalis Linn) mesophyll cell, separate for the first time and obtain.After this, the researchist has identified PSK-α again successively from the conditioned medium of species such as corn, Radix Dauci Sativae, paddy rice, zinnia, Japanese cypress and Arabidopis thaliana ^{[2 ~ 9]}, explain that PSK extensively exists in plant.Matsubayashi etc. ^[10]Found that plant sulphur peptide hormone, growth hormone and phytokinin three are indispensable, acting in conjunction promotes cell proliferation; And the generation of PSK need receive the common adjusting of growth hormone and phytokinin.The existing PSK of discovering also has following function: promote conduit differentiation and cells,primordial to form ^[9]Promote plant organ to form and growth ^{[2,6-8,11-12]}In substratum, add under the PSK-α situation population effect that can regulate pollen ^[13], chlorophyll content in the cotyledon of raising yellow ^[14], and can improve the resistance of plant through keeping seedling fresh weight and chlorophyll content to heat stress ^[15]PSK is mainly used in the group training at present, promotes the propagation of lower concentration suspension cell as pheromone.

Summary of the invention

The object of the invention is for proposing paddy rice OsPSKThe application of gene aspect economical characters such as improvement paddy growth gesture and photosynthesis.

The present invention utilizes paddy rice OsPSK3Coded sequence makes up composing type or organizing specific type expression vector rice transformation (comprising long-grained nonglutinous rice and japonica rice), cultivates growth potential enhancing, and plant is sturdy, and plant type is good, the paddy rice transgenic strain that chlorophyll content is high.

The present invention also comprises: paddy rice OsPSK3The separation of gene, clone and transgenic functional study etc.

1) plant sulphur peptide hormone gene OsPSK3The structure of expression vector

Employing pCAMBIA1304 is an expression vector, will OsPSK3Gene is inserted into pCAMBIA1304 carrier 35S constitutive promoter downstream B GlII and S PeL.The expression vector structure is seen Fig. 1.Rice plants sulphur peptide hormone amyloid protein precursor gene OsPSK3Full-length cDNA (AK062614), see SEQ.ID.NO.1.

2) plant sulphur peptide hormone amyloid protein precursor gene OsPSK3Rice transformation experiment and result

Utilize long-grained nonglutinous rice 9311 to be transgene receptor.With rice paddy seed shell the sterilization after be seeded in evoked callus on the dedifferentiation plant tissue culture media.After callus induction 2-3 week, adopt particle gun micropellet bombardment method, will contain OsPSK3The purified recombinant plasmid of gene imports long-grained nonglutinous rice 9311 callus cells.Cultured continuously 3-4 week screening resistant cell line on the MS substratum that adds the 30mg/L Totomycin is transferred to division culture medium with the clone of screening then and is induced and sprout and take root.The resistance seedling verifies that through PCR finally obtaining 4 strains changes OsPSK3Gene masculine seedling (Fig. 2).

3) sxemiquantitative PCR and quantitative fluorescent PCR (real-time PCR) are analyzed endogenous OsPSK3In contrast 9311 and commentaries on classics OsPSK3Expression amount in the gene plant

Detect a transgenic T1 of 14 days of seedling in generation with sxemiquantitative PCR OsPSK3The expression of gene in root, stem, foliage organ.With long-grained nonglutinous rice 9311 is contrast, with β-actin as confidential reference items (Fig. 3).We find OsPSK3Expression amount in each organ of contrast is very low; In the transgenic lines in the stem position OsPSK3Genetic expression is stronger.

Through adjustment PCR system and increase cycle number, utilize Real-time PCR to detect in the axis OsPSK3The expression of gene amount.Data presentation (Fig. 4): OsPSK3Expression amount in transfer-gen plant compares and has improved approximately 40% according to 9311, and this shows equally OsPSK3The introducing of gene fragment has caused really OsPSK3The expression of gene amount increases.

4) change plant sulphur peptide hormone amyloid protein precursor gene OsPSK3Paddy rice shows the nutrition proterties that is superior to contrasting

OsPSK3Transgenic paddy rice T ₁Representative is revealed and is superior to contrasting 9311 economical character: change OsPSK3Trans-genetic hybrid rice seed germination speed is obviously faster than contrast, and the continued that shows money or valuables one carries unintentionally is cultivated 14 days visible commentaries on classics OsPSK3The trans-genetic hybrid rice seedling compares according to growing more adventive root, is to differentiate more root hair on the root, and fibrous root system contrast is more flourishing.The statistical result showed transgenic strain on average has 5.1 adventive root, and contrast 9,311 3.0 adventive root is arranged on average.The stem of transfer-gen plant obviously is longer than contrast, and this growth vigor can be retained to knot fringe phase, sophisticated commentaries on classics always OsPSK3Gene plant cane more sturdy (Fig. 5).

5) change plant sulphur peptide hormone amyloid protein precursor gene OsPSK3Chlorophyll content significantly improves in the paddy rice

Transgenic paddy rice just shows leaf color than the apparent intensification of illumination, color dark green (Fig. 6) when tri-leaf period.Fresh blade measuring chlorophyll content result shows that chlorophyll content is 2.097 ± 0.449 mg/g in the rotaring gene plant blade, is 0.893 ± 0.137 mg/g in the contrast 9311, and the chlorophyll content that changes OsPSK3 gene line plant is 2.3 times of contrast 9311, shows OsPSK3The expression of crossing of gene has improved the chlorophyllous content of plant, has improved the ability (Fig. 7) that plant chlorophyll forms.

Among the present invention, be used for rice transformation OsPSK3The albumen of gene order and translation, the pcr amplification primer of use is (SEQ.ID.NO.2):

osPSK3-2-1s?(5’-AAACAGATCTCGCCATGTCACCGAAG-3’)

osPSK3-2-1a（5’-TGACTAGTATTGTGTTTGCCCTGCGTGT-3’）

The sequence of using is (SEQ.ID.NO.3):

atgtcaccgaaggtcatagccatttgccttgtagcacttctcctt

M S P K V I A I C L V A L L L

cccatcagcataagccatggtggtagaattgggccaattgaaccc

P I S I ?S H G G R I G P I E P

agcaaagcttccagtaaggttgtggagaggggaaactacgatggt

S K A S S K V V E R G N Y D G

agagtggaaggttgcgaagaagatgattgcctagtggagcgtttg

R V E G C E E D D C L V E R L

ctcgtggctcatctggactacatctacacgcagggcaaacacaat

L V A H L D Y I Y T Q G K H N

actagt

Utilize with OsPSK3The primer GUS1 of the downstream GusA gene design of gene linkage carries out positive detection, and primer sequence is (SEQ.ID.NO.4):

GUS1s 5'-TCGGCTTTCAGCTGTCTTTAGG-3’

GUS1a 5'-GTCGGTGTACATTGAGTGCAGC-3'

Expanding fragment length 494bp.

Description of drawings

Fig. 1, OsPSK3-pCAMIBIA1304 plant expression vector construction synoptic diagram.

Fig. 2, OsPSK3-pCAMIBIA 1304 transgenic paddy rice T0 detect M:DL 2000 DNA Ladder for paddy rice PCR; +: the plasmid positive control;-: negative control; 1 ~ 4:OsPSK3-pCAMIBIA, 1304 transgenic positive plant; The negative plant of 5 ~ 12:OsPSK3-pCAMIBIA, 1304 transgenics.

The expression of OsPSK3 in root, stem, leaf in Fig. 3, commentaries on classics OsPSK3 trans-genetic hybrid rice and the contrast 9311, Control is contrast 9311.

Fig. 4, commentaries on classics OsPSK3 trans-genetic hybrid rice and contrast 9311 OsPSK3 expression amount situation in stem.

Fig. 5, seedling phase and knot fringe phase OsPSK3ox-1 plant and contrast 9311 phenotypes, a, b:OsPSK3ox-1 and contrast 14 d seedling plant; C:14 d contrast seedling root; D:14 d OsPSK3ox-1 seedling root; E, f:OsPSK3ox-1 plant and contrast knot fringe phase plant (left side is contrast 9311).

Fig. 6, tri-leaf period the OsPSK3ox-1 plant with the contrast seedling.

Fig. 7, contrast and OsPSK3ox-1 chlorophyll content in leaf blades are relatively.

Embodiment

1) expression vector pCAMBIA1304-OsPSK3 makes up

Primer clone rice plants sulphur peptide hormone amyloid protein precursor gene with the band restriction enzyme site OsPSK3, will OsPSK3Gene is inserted into pCAMBIA1304 carrier 35S constitutive promoter downstream B GlII and S PeL.Expression vector pCAMBIA1304-OsPSK3 makes up completion.

2) inducing paddy rice is more gone up tissue culture medium (TCM)

Induce and subculture medium: MS+2 mg/L 2,4-D.

Height oozes substratum: MS+2 mg/L 2,4-D+46.67 g/L sorbyl alcohols+46.67 g/L N.F,USP MANNITOL.

Wheel screening culture medium: MS+2 mg/L 2,4-D+30 mg/L Totomycin.

Division culture medium: MS+3 mg/L 6-BA+0.5 mg/L NAA+30mg/L Totomycin.

Strong plantlets and rootage substratum: 1/2 MS+0.1 mg/L NAA.

Annotate: above substratum all contains 30g/L sucrose+2.5 g/L agar, and pH 5.8.Callus of induce, subculture, screening and culturing condition are 26-28 ℃ of dark the cultivation, and differentiation, strong plantlets and rootage are 26-28 ℃ and 16 hour photoperiod.

3) callus induction and processing

Get 12-15 days the immature seed in pollination back, under aseptic condition, embathe 10 min with 70% ethanol earlier, change 0.1% mercuric chloride over to and soak 20 min, sterile water wash 3 times.Under aseptic condition, peel off rataria, be inoculated on the callus of induce substratum, 26-28 ℃ of dark the cultivation after about 20 days cut bud, and subculture once.In subculture medium, select the growth about 30-50 piece of vigorous, flaxen callus (about every 3 mm), place height to ooze on the substratum central authorities, line up in the circle of about 2.5 cm of diameter, be used for conversion after cultivating about 4-5 h.

4) particle gun transforms

Particle gun: the high pressure gas particle gun that Xin Zhi Science and Technology Ltd. purchases from Ningbo, model: GJ-1000.

Particulate bullet preparation: take by weighing 60mg tungsten powder (about 1 um of diameter), join in the 1.5 ml sterilization centrifuge tube, add the 1ml absolute ethyl alcohol again; 1 min that vibrates in centrifugal 10 s of 10000 rpm, abandons supernatant; After repeating to wash once, bronze is suspended in existing using or-20 ℃ of preservations in the 1 ml sterilized water.

Draw 50 ul tungsten powder suspension-s in 1.5 ml centrifuge tubes, add 5 ug DNA, 50 ul, 2.5 M CaCl successively ₂, 20 ul, 0.1 M spermidine, vibrated 5 minutes, centrifugal 20 s of 10000 rpm abandon supernatant, with 140 ul absolute ethyl alcohol rinsings twice, add 60 ul absolute ethyl alcohols, it is for use to suspend.

5) bombardment receptor material

Particle gun is put on the Bechtop, cleans Vakuumkammer with 70% alcohol, and can split film, carry granulosa, metal baffle screen (by the supply of material of Ningbo Xin Zhi Science and Technology Ltd.) sterilization 30 minutes in 70% alcohol, blot or blow off residual alcohol then with aseptic filter paper.Turn on the power switch vacuum pump and helium cylinder valve.Can split film pack into fixing, screw.

Get the tungsten powder absolute ethyl alcohol suspension-s that 10 ul encapsulate DNA, evenly coat the granulosa center of carrying, be placed on the super clean bench and dry up.Carry granulosa and backstop little bullet launching device of packing into what be loaded with little bullet, particulate one is faced down.Petridish is placed on the pallet, makes callus concentrate on petridish central authorities.Open gas cylinder, regulate pressure 1100 Psi.Vacuumize, when vacuum tightness reaches desired value, forward the VAC key to the Hold position.Bombardment, every ware bombardment 2 times (for the first time after the bombardment revolve carry out bombardment second time with petridish after turning 90 degrees) makes the vacuum meter reading return zero by the venting key, the taking-up sample.

The bombardment back is oozed in height and is continued to cultivate 12-16 h on the substratum.

6) transformed calli screening

The back height of shooting is oozed callus on the substratum to be changed over to and recovers growth 5-7 days on the inducing culture that does not contain selective agent.Callus is forwarded on the screening culture medium that contains 30 mg/L Totomycin, evenly put, secretly cultivate and carried out resistance screening in 7-14 days, and then screened 10 days.

7) paddy rice OsPSK3Screening of gene transformation plant and detection

Callus illumination on division culture medium of screening back survival was cultivated 30 days.After waiting to differentiate plantlet, change plantlet over to the strong plantlets and rootage substratum, the back of growing up moves into the greenhouse.Adopt the pcr amplification method to detect candidate's resistant plant respectively.

Reference

[1]?Matsubayashi?Y,?Sakagami?Y.?Phytosulfokine,?sulfated?peptides?that?induce?the?proliferation?of?single?mesophyll?cells?of?Asparagus?officinalis?L.?Proc?Natl?Acad?Sci?USA,?1996,?93(15):?7623–7627.

[2]?Stuart?R,?Street?HE.?Studies?on?the?growth?in?culture?of?plant?cells:?IV.?The?initiation?of?division?in?suspensions?of?stationary-phase?cells?of?Acer?Pseudoplatanus?L.?J.?Exp.?Bot.,?1969,?20(3):?556–571.

[3]?Yang?HP,?Matsubayashi?Y,?Nakamura?K,?Sakagami?Y.?Diversity?of?Arabidopsis?genes?encoding?precursors?for?phytosulfokine,?a?peptide?growth?factor.?Plant?Physiol,?2001,?127(3):?842–851.

[4]?Yang?HP,?Matsubayashi?Y,?Nakamura?K,?Sakagami?Y.?Oryza?sativa?PSK?gene?encodes?a?precursor?of?phytosulfokine-α,?a?sulfated?peptide?growth?factor?found?in?plants.?Proc?Natl?Acad?Sci?USA,?1999,?96(23):?13560–13565.

[5]?Lorbiecke?R,?Sauter?M.?Comparative?analysis?of?PSK?peptide?growth?factor?precursor?homologs.?Plant?Sci,?2002,?163(2):?321–332.

[6]?Yang?G,?Shen?S,?Kobayashi?T,?Matsubayashi?Y,?Sakagami?Y,?Kamada?H.?Stimulatory?effects?of?a?novel?peptidyl?plant?growth?factor,?phytosulfokine-.alpha.,?on?the?adventitious?bud?formation?from?callus?of?Antirrhinum?majs.?Plant?Biotechnol?J,?1999,?16(3):?231–234.

[7]?Igasaki?T,?Akashi?N,?Ujino-Ihara?T,?Matsubayashi?Y,?Sakagami?Y,?Shinohara?K.?Phytosulfokine?stimulates?somatic?embryogenesis?in?Cryptomeria?japonica.?Plant?Cell?Physiol,?2003,?44(12):?1412–1416.

[8]?Hanai?H,?Matsuno?T,?Yamamoto?M,?Matsubayashi?Y,?Kobayashi?T,?Kamada?H,?Sakagami?Y.?A?secreted?peptide?growth?factor,?phytosulfokine,?acting?as?a?stimulatory?factor?of?carrot?somatic?embryo?formation.?Plant?Cell?Physiol,?2000,?41(1):?27–32.

[9]?Matsubayashi?Y,?Takagi?Y,?Omura?N,?Morita?A,?Sakagami?Y.?The?endogenous?sulfated?pentapeptide?phytosulfokine-alpha?stimulates?tracheary?element?differentiation?of?isolated?mesophyll?cells?of?Zinnia.?Plant?Physiol,?1999,?120(4):?1043–1048.

[10]Matsubayashi?Y,?Morita?A,?Matsunaga?E,?Furuya?A,?Hanai?N,?Sakagami?Y.?Physiological?relationships?between?auxin,?cytokinin,?and?a?peptide?growth?factor,?phytosulfokine-α,?in?stimulation?of?asparagus?cell?proliferation.?Planta,?1999,?207(4):?559–565.

[11]?Kutschmar?A,?Rzewuski?G,?Stuhrwohldt?N,?Beemster?GTS,?Inze?D,?Sauter?M.?PSK-a?promotes?root?growth?in?Arabidopsis.?New?Phytol,?2009,?181(4):?820–831.

[12]Amano?Y,?Tsubouchi?H,?Shinohara?H,?Ogawa?M,?Matsubayashi?Y.?Tyrosine-sulfated?glycopeptide?involved?in?cellular?proliferation?and?expansion?in?Arabidopsis.?Proc?Natl?Acad?Sci?USA,?2007,?104(46):?18333–18338.

[13]?Chen?YF,?Matsubayashi?Y,?Sakagami?Y.?Peptide?growth?factor?phytosulfokine-α?contributes?to?the?pollen?population?effect.?Planta,?2000,?211(5):?752–755.

[14]?Yamakawa?S,?Matsubayashi?Y,?Sakagami?Y,?Kamada?H,?Satoh?S.?Promotion?by?a?peptidyl?growth?factor,?phytosulfokine,?of?chlorophyll?formation?in?etiolated?cotyledon?of?cucumber.?Biosci?Biotech?Bioch,?1998,?62(12):?2441–2443.

[15]Yamakawa?S,?Matsubayashi?Y,?Sakagami?Y,?Kamada?H,?Satoh?S.?Promotive?effects?of?the?peptidyl?plant?growth?factor,?phytosulfokine-alpha,?on?the?growth?and?chlorophyll?content?of?Arabidopsis?seedlings?under?high?night-time?temperature?conditions.?Biosci?Biotech?Bioch,?1999,?63(12):?2240–2243。

< 110>Fudan University

< 120>application of rice Os PSK3 gene aspect improvement paddy rice economical character

<130> 001

<160> 4

<170> PatentIn?version?3.3

<210> 1

<211> 666

<212> DNA

<213>

<400> 1

atgcaggttc?catgacctat?tcgatactag?tcctacacaa?acataacacg?ccatgtcacc 60

 

gaaggtcata?gccatttgcc?ttgtagcact?tctccttccc?atcagcataa?gccatggtgg 120

 

tagaattggg?ccaattgaac?ccagcaaagc?ttccagtaag?gttgtggaga?ggggaaacta 180

 

cgatggtaga?gtggaaggtt?gcgaagaaga?tgattgccta?gtggagcgtt?tgctcgtggc 240

 

tcatctggac?tacatctaca?cgcagggcaa?acacaattag?aagcagagga?gtagatgcac 300

 

gtttgcaatg?agcaatccat?gcaagaataa?accgccgagc?agaaaaaaga?aagcgagcaa 360

 

gcttgacgtt?agatgataat?gtgtgtacaa?cctatatatc?atgggaaaat?agagccgctg 420

 

gatatcagga?agacaggaag?gagcctgata?tcaataatta?tgaagaaata?tgagcacact 480

 

ccggaaatgg?aatcaagtgc?gagaaggcgt?ccagctaagc?taataactga?gctaggcgca 540

 

gttctctgag?ctacccattg?tgtttttttc?tagagtggag?aaagtatata?taaagtttgt 600

 

atgaagttta?agtgtttgta?tgtatgtatg?aagtttgtaa?aggtaattat?gaacttatgt 660

 

tgttcg 666

 

 

<210> 2

<211> 54

<212> DNA

<213>

<400> 2

aaacagatct?cgccatgtca?ccgaagtgac?tagtattgtg?tttgccctgc?gtgt 54

 

<210> 3

<211> 231

<212> DNA

<213>

<400> 3

atgtcaccga?aggtcatagc?catttgcctt?gtagcacttc?tccttcccat?cagcataagc 60

 

catggtggta?gaattgggcc?aattgaaccc?agcaaagctt?ccagtaaggt?tgtggagagg 120

 

ggaaactacg?atggtagagt?ggaaggttgc?gaagaagatg?attgcctagt?ggagcgtttg 180

 

ctcgtggctc?atctggacta?catctacacg?cagggcaaac?acaatactag?t 231

 

<210> 4

<211> 44

<212> DNA

<213>

<400> 4

tcggctttca?gctgtcttta?gggtcggtgt?acattgagtg?cagc 44

 

 

Claims (2)

1. paddy rice OsPSK3The application of gene aspect improvement paddy rice economical character is characterized in that utilizing paddy rice OsPSK3The gene transformation long-grained nonglutinous rice is to improve growth potential, the photosynthesis of rice crop, said paddy rice OsPSK3The sequence of gene is SEQ.ID.NO.1.

2. application according to claim 1 is characterized in that adopting long-grained nonglutinous rice 9311 to be transgene receptor, makes up OsPSK3The mistake express transgenic plant of gene.

Images