CN102002478A - Adipose-derived stem cell separation culture method - Google Patents
Adipose-derived stem cell separation culture method Download PDFInfo
- Publication number
- CN102002478A CN102002478A CN 201010568873 CN201010568873A CN102002478A CN 102002478 A CN102002478 A CN 102002478A CN 201010568873 CN201010568873 CN 201010568873 CN 201010568873 A CN201010568873 A CN 201010568873A CN 102002478 A CN102002478 A CN 102002478A
- Authority
- CN
- China
- Prior art keywords
- stem cell
- cell
- fat
- fat stem
- obtains
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an adipose-derived stem cell separation culture method comprising the following steps of: separating and acquiring from adipose tissues; and culturing SVF (Stromal-vascular fraction) cells. The separation culture method is characterized by also comprising the following steps of: removing Lin+cells included in the SVF cells to obtain an Lin-cell mass by using a magnetic-activated cell sorting method; gathering CD271+Sca-1+cells from the obtained Lin-cell mass to obtain the adipose-derived stem cells by using a fluorescent-activated cell sorting method; and culturing the obtained adipose-derived stem cells by using a culture medium containing LIF (Leukemia Inhibitory Factor) and FGF2 (Fibroblast Growth Factor). The invention can efficiently and fast obtain the high-purity adipose-derived stem cells by combining FACS (Fluorescent-Activated Cell Sorting) with MACS (Magnetic-Activated Cell Sorting), wherein the high-purity adipose-derived stem cells have higher clone forming ability, self-renewal ability and multi-directional differentiation potentiality; P16 generation adipose-derived stem cells obtained by the separation culture method still have higher adipose forming ability and bone forming ability; in addition, the invention provides a new method for acquiring a large quantity of seed cells with dryness in vitro to apply to tissue regeneration.
Description
Technical field
The present invention relates to the isolation cultivation method of a kind of stem cell, specifically, relate to a kind of combine method of separation and Culture high purity fat stem cell of fluorescence-activation fluidic cell classification and the sorting of magnetic activating cells that adopts.
Background technology
(Adipose-derived Stem Cells ASCs), is a kind of adult stem cell (Cowan CM .Nat Biotechnol, 2004. 22:560-567) that is widely used in organizational project and regenerative medicine research field at present to fat stem cell.Fat stem cell is the same with mesenchymal stem cells MSCs to have multidirectional differentiation potential, under given conditions can be to a plurality of directions differentiation such as adipocyte, scleroblast, chondroblast, sarcoplast, one-tenth endotheliocyte and neuroblast.In addition, fat stem cell also has the not available advantage of many other types adult stem cells, as fatty tissue source abundance, the convenience of drawing materials, slight, the no ethics dispute of acquisition process damage, on average can obtain about 1 * 10 in the fatty tissue of per 100 mL
6Individual stem cell, the cell in fatty tissue source has 2% to have cells and characteristic of stem approximately, far above mesenchymal stem cells MSCs (bone marrow mesenchymal stem cells, BMSCs) (about 0.02% cell has cells and characteristic of stem).And fat stem cell has stable population doublings rate, self potential and good immune compatibility (Strem BM,. Trends Biotechnol, 2005.24:1246-1253), its gene transfection efficient height, energy stable expression of exogenous gene, research (the Gimble JM that has been widely used in regenerative medicine,. Circ Res, 2007:1249-1260).And ASCs to be divided into the efficiency ratio BMSCs of adipocyte higher.Therefore, fat stem cell is one of Tissue Engineering Study ideal seed cell, promises to be the seed cell of adipose tissue engineering most.
Fat stem cell isolation cultivation method at present commonly used is to separate from fatty tissue to obtain cell, after machinery or method of enzymatically treating separate mature cells such as removing red corpuscle, adopts the substratum that contains 10% foetal calf serum to carry out succeeding transfer culture.Though the substratum that contains 10% foetal calf serum can promote the propagation of fat stem cell to be difficult to keep its undifferentiated state, make that the fat stem cell of succeeding transfer culture is aging easily.Machinery or method of enzymatically treating only can be removed mature cells such as red corpuscle, matter blood vessel fragment cell (Stromal-vascular fraction between removing this part cell essence after red and being, the SVF cell), still contain a large amount of mature cells in this part cell, thereby, the existing fat stem cell purity that obtains is not high, because the growth of cell is relevant with the signal traffic between the cell, the stem cell that purity is not high is easier to be aging, often external cultivate fat stem cell through going down to posterity for 5-6 time after, fat stem cell just occurs aging.Stem cell aging (or claiming old and feeble) is meant the stem cells hyperplasia ability drop, and multidirectional differentiation potential (or claiming dryness) reduces or disappears.Wearing out means the minimizing of stem cell population and going down of function, also can be described as and can't regenerate.Fat stem cell aging limited its further investigation of using in adipose tissue engineering and hetero-organization engineering thereof.
The method of separation and purification stem cell has fluidic cell separating method, immunological magnetic bead sorting method etc. at present, for example utilization such as In ' t Anker fluidic cell separating method obtains the fetus mescenchymal stem cell from amniotic fluid, utilization immunomagnetic beads methods such as Coppi from amniocyte, isolate the AFS cell (amniotic fluid stem cells, AFS).But these in-vitro separation technology to stem cell are based upon on the pair cell surface markers base of recognition mostly, as isolated AFS cells such as Coppi is c-Kit or CD117(STEM CELL FACTOR acceptor) express positive cells, and various adult stem cell has unique separately marker.(Fluorescent-activated cell sorting FACS) is separated to Lin to Rodeheffer MS etc. from fatty tissue with the cell airflow classification
-CD29
+CD34
+Sca-1
+CD24
+Cell mass, but this group cell can only break up to adipocyte, and gained quantity lower (0.08% ± 0.015)).Up to the present, the specific marker of fat stem cell does not also find, also do not find adipose stromal cells (Adipose-derived stromal cells, ADSCs) lining has the cell mass of dryness, and domestic and international research all can not obtain highly purified fat stem cell (the high purity fat stem cell refers to the stem cell that the cell-surface antigens sign is identical, have homogeneity, the self a group fatty tissue source consistent with multidirectional differentiation capability).
The existing problem that isolating fat stem cell purity is not high, the fat stem cell vitro culture is difficult to keep self and multidirectional differentiation potential has greatly limited contrast and repetition between the domestic and international result of study.
Summary of the invention
The objective of the invention is to overcome in the prior art deficiency that fat stem cell under the condition of in vitro culture is difficult to keep self and multidirectional differentiation potential, a kind of isolation cultivation method and effectively new substratum thereof of fat stem cell is provided.Through according to this method separation and Culture fat stem cell, through more than 10 for succeeding transfer culture after fat stem cell still can keep the potential of its self and multidirectional differentiation.
The present invention realizes that the technical scheme of foregoing invention purpose is:
A kind of isolation cultivation method of fat stem cell comprises from fatty tissue separating and obtains, cultivates the SVF cell, also comprises with the immunological magnetic bead sorting method removing Lin in the SVF cell
+Cell obtains Lin
-Cell mass; With the Lin of fluidic cell separating method from obtaining
-Enrichment CD271 in the cell mass
+Sca-1
+Cell obtains fat stem cell; With the fat stem cell culture medium culturing that contains LIF, FGF2 that obtains.
In the isolation cultivation method of above-mentioned fat stem cell, the marker that is adopted in the immunological magnetic bead sorting method is CD5, CD45R, CD11b, Anti-Gr-1 and Ter-119.
In the isolation cultivation method of above-mentioned fat stem cell, the marker that uses in the fluidic cell separating method is Lin, CD271 and Sca-1.
In the isolation cultivation method of above-mentioned fat stem cell, cultivating the used substratum of fat stem cell that obtains is the α-MEM substratum that contains LIF, FGF2.
In the isolation cultivation method of above-mentioned fat stem cell, cultivating the used substratum of fat stem cell that obtains is to contain 10% volume ratio foetal calf serum, 10
3-10
5α-MEM substratum of U/mL LIF, 10-100 ng/ mL FGF2.
In the isolation cultivation method of above-mentioned fat stem cell, cultivating the used substratum of fat stem cell that obtains is to contain 10% foetal calf serum, 10
3The α of U/mL LIF, 20 ng/mL FGF2-MEM substratum.
In the isolation cultivation method of above-mentioned fat stem cell, also comprise the fat stem cell that the obtains cultivation of going down to posterity.
In the isolation cultivation method of above-mentioned fat stem cell, the described cultivation of going down to posterity is an adherent culture.
In the isolation cultivation method of above-mentioned fat stem cell, when the stand density of the fat stem cell that obtains in the culture dish bottom reaches 70-90%, the cultivation of going down to posterity.
Preferably, in the isolation cultivation method of above-mentioned fat stem cell, when the stand density of the fat stem cell that obtains in the culture dish bottom reaches 80%, the cultivation of going down to posterity.
In the isolation cultivation method of above-mentioned fat stem cell, separating the process of obtaining the SVF cell from fatty tissue is: cut mouse inguinal region fat pad under conventional aseptic condition, through rinsing, shred, remove blood etc. and handle after, in fatty tissue, add and the isopyknic 0.1% I Collagen Type VI enzyme of fat, be the SVF cell through digest, filter, split the cell that is obtained after red, centrifugal.
In the isolation cultivation method of above-mentioned fat stem cell, the α-MEM substratum that contains 10% volume ratio foetal calf serum is adopted in the cultivation of SVF cell, and culture condition is 37 ℃, 5%(v/v) CO
2
The fat stem cell of the isolation cultivation method institute separation and Culture of any as previously mentioned one fat stem cell is used for the production of purifying or clone stem cell, transgenosis stem cell line or is used to produce fat/scleroblast.
Fat stem cell is used to produce fat/osteoblastic method and is as previously mentioned:
(1), sorting combines to separate and obtains ASCs with the magnetic activating cells for fluorescence-activation fluidic cell classification;
(2), with ASCs respectively conjugated fibre albumen and BCP timbering material, be inoculated in the damaged place of nude mice back or mouse femur.
6-12 took out graft and carries out HE section statining, immunohistochemistry detection etc. after week.
The cultivation of going down to posterity of fat stem cell occurs aging easily in the prior art, at this problem, the contriver has carried out extensive studies, found that, to separate the SVF cell that obtains from fatty tissue combines with immunological magnetic bead sorting method and fluidic cell separating method, can remove the mature cell in the SVF cell as much as possible, can obtain thus the antigen sign identical, have homogeneity, a self high purity fat stem cell consistent with multidirectional differentiation capability.The contriver has compared in substratum and to have added the factor LIF that suppresses differentiation of stem cells and the factor FGF2 that promotes stem cells hyperplasia and the clonality under the conventional culture condition, multidirectional differentiation capability, found that to add the factor LIF that suppresses cytodifferentiation and promote the growth factor FGF-2 2 of stem cells hyperplasia can keep the dryness of the high purity stem cell of acquisition in substratum.
Therefore, the present invention separates from fatty tissue and obtains, cultivates the SVF cellular fat, adopts the MACS method to remove CD5 again from the SVF cell
+, CD45R
+, CD11b
+And Ter
-119
+These hematopoiesis and mature cell, enrichment Lin
-Cell; Adopt FACS from Lin then
-Sorting CD271, Sca-1 express positive cells, enrichment CD271 in the cell mass
+Sca-1
+Cell (being fat stem cell ASCs); After obtaining fat stem cell, by in substratum, adding the factor LIF that suppresses cytodifferentiation and promoting the growth factor FGF-2 2 of stem cells hyperplasia to keep the dryness of stem cell.The present invention has compared in substratum and to have added the factor LIF that suppresses differentiation of stem cells and the factor FGF2 that promotes stem cells hyperplasia and the clonality under the conventional culture condition, multidirectional differentiation capability, proved in substratum, to add LIF and FGF2, helped to keep the dryness of fat stem cell.The present invention has measured cultivation and the clonality of ASCs, and confirms that from aspects such as morphology, immunocytochemistry, mRNA and protein levels the ASCs obtained has a function such as multidirectional differentiation potential with external in vivo.
The present invention adopts FACS and MACS to combine, and can efficiently obtain highly purified fat stem cell fast, and compared with prior art, the present invention has the following advantages and positively effect:
1, the present invention adopts the method that the fluorescence-activation fluidic cell is classified (FACS) and magnetic activating cells sorting (MACS) combines to use Lin at home and abroad first
-: CD271
+: Sca-1
+Be enriched to highly purified fat stem cell subgroup, this group cell has stronger clonality, self ability and multidirectional differentiation potential, and other cell does not possess this ability is arranged.
2, the present invention's utilization contains the conditioned medium culturing cell of LIF and FGF2, and P16 fat subsitutes stem cell still has stronger one-tenth fat ability, and P16 fat subsitutes stem cell still has the ability of skeletonization.
3, the present invention uses scleroproein and biphasic calcium phosphate pottery (BCP) carrier as fat stem cell, the ASCs that adopts the gfp transgene mouse is as spike, proved that ASCs becomes in fat/skeletonization microenvironment in vivo can be converted into adipocyte and scleroblast.
4, the present invention found a kind of feasible, efficiently obtain the method for fat stem cell, for obtaining a large amount of seed cells and apply to tissue regeneration new method is provided with dryness external.
Description of drawings
The Lin of Fig. 1 for obtaining through MACS
-Cell mass dyes back fluidic cell sorting altogether with CD271 and two antibody of Sca-1 then, obtains Lin
-: CD271
+: Sca-1
+Cell mass (being fat stem cell).
Fig. 2 clones cultivation for adopting limiting dilution assay to ASCs: wherein A is Lin
-: CD271
+: Sca-1
+Cell mass has formed clone (the 3rd day), Scale bars=100 μ m; B is Lin
-: CD271
+: Sca-1
+The clone (the 5th day) that cell mass forms, Scale bars=100 μ m.
Fig. 3 A, B are the light microscopic figure of fat stem cell growth conditions, and cell is for becoming the fiber-like fusiformis, visible typical whirlpool shape growth, the Scale bars=40 μ m of A figure wherein, the Scale bars=100 μ m of B figure.
Fig. 4 is the external multidirectional differentiation figure of ASCs, wherein A: after becoming fat to induce, oil red O dyes lipid for orange red, Scale bars=200 μ m; B: after the osteogenic induction differentiation, sodium alizarinsulfonate dyeing shows that the calcium tubercle is flaky red dying, Scale bars=100 μ m; C: after becoming the chondrocyte induction differentiation, Toluidine blue staining shows that cartilage matrix is blue, has cartilage cavities to form Scale bars=400 μ m; D: after becoming flesh to induce differentiation, α-SMA immunocytochemical stain is positive, and DAPI is blue with nuclei dyeing, Scale bars=400 μ m.
Fig. 5 detects ASCs after becoming fat (PPAR γ 2, C/EBP-α, LPL), skeletonization (Runx2, Opn), becoming cartilage (Acan, Sox9) and become flesh (Myog, Myod1) to induce for RT-PCR, the Expression of Related Genes situation, and confidential reference items are GAPDH.The result shows, after multidirectional the inducing of process, PPAR γ 2, C/EBP-α, LPL, Acan, Sox9, Myog, Myod1 expression of gene level raise, and have proved absolutely that from the mRNA level fat stem cell that we cultivate can be to fat, bone, cartilage, the differentiation of myocyte's direction.
Fig. 6 FGF2 and LIF are to the influence of ASCs multiplication capacity.The substratum that adds FGF2 and LIF has been kept the fast breeding ability of ASCs, has been stablized the cell colony doubling time; In the contorl of no FGF2, LIF substratum group, along with passage number increases, the cell colony doubling time prolongs.
Fig. 7 is FGF2 and LIF form ability to the CFU-F of ASCs influence.FGF2 and LIF substratum group CFU-F formation ability do not have obvious decline; CFU-F forms obvious minimizing in the contorl group of FGF2, LIF substratum and do not have.
Fig. 8 for FGF2 and LIF to keeping the influence that ASCs becomes the fat differentiation potential.A be FGF2 with the LIF substratum in P16 become fat to induce oil red O stain result after 10 days for ASCs, the P16 that B cultivates for no FGF2 and LIF becomes fat to induce oil red O stain result after 10 days for ASCs, ASCs one-tenth fat ability obviously reduces Scale bars=200 μ m.
Fig. 9 glycerol-3-phosphate dehydrogenase active level is measured.From P6 for, FGF2, LIF are arranged and do not have becomes fat to induce afterwards between two groups of ASCs that FGF2, LIF cultivate significant difference appears in the glycerol-3-phosphate dehydrogenase activity, data are represented (n=3) with mean ± SE, (P ﹤ 0.01).
Figure 10 A: have under the culture condition of FGF2 and LIF, P16 forms for the visible mineralising tubercle of ASCs osteogenic induction hystazarin red colouring; B: under the culture condition of no FGF2 and LIF, P16 does not see that the mineralising tubercle forms after for the ASCs osteogenic induction.Scale?bars=?100μm。
The GFP fat stem cell of Figure 11 C57 mouse is fibroblast-like fusiformis, and no fat drips in the born of the same parents, and egfp expression is all arranged.Figure 11 A is the image of ordinary optical microscope, and Figure 11 B is the observed image of inverted fluorescence microscope.Scale?bars=?40μm。
Figure 12 cell-scleroproein mixture one-tenth fat situation behind the 6w that implants.The A:HE demonstration of dyeing, rounded or Polygons, kytoplasm contains cavity, and cavity is for making the position of being dripped by molten degrease in the slicing processes, and karyon is dripped by fat and presses to a side, is oblate, Scale bars=200 μ m.B: oil red O stain shows that fat drips and is that orange, nucleus are pressed against on one side, are blue, Scale bars=200 μ m.C: the newborn anti-GFP immunohistochemistry of the adipocyte positive, Scale bars=100 μ m.
Skeletonization situation after Figure 13 cell-BCP timbering material mixture implants.A, B are HE and Masson dyeing, and newly bone mainly forms in the hole of BCP timbering material, are the bone island sample and distribute, and new bone periphery is a scleroblast, and the visible rose pink bone trabecula of HE dyeing reaches just at the collegen filament of mineralising, can see the formation of bone lacuna; The visible new bone trabecula that forms of Masson dyeing and be blueness just at the collegen filament of mineralising.Scale?bars=200μm。C is that new fracture GFP immunohistochemistry detects, wherein the positive cell of light brown person, the as seen anti-GFP positive of scleroblast (shown in the red arrow).Scale?bars=200μm。
Embodiment
The present invention is described in further detail below in conjunction with testing example and embodiment.But this should be interpreted as that the scope of the above-mentioned theme of the present invention only limits to following embodiment, allly all belong to scope of the present invention based on the technology that content of the present invention realized.
The fatty tissue of being mentioned in the embodiment of the invention derives from mouse, and used main raw, reagent and equipment are as follows in the embodiment of the invention:
C57 mouse (providing) by Sichuan University's West China medical experiment animal center;
Gfp transgene C57 mouse (biotherapy National Key Laboratory stem cell biological is learned the research department and is so kind as to give);
Nude mouse (available from Institute of Experimental Animals, Chinese Academy of Medical Sciences);
Fibrin Glue support (the general Ji in Hangzhou, China);
Porous biphasic calcium phosphate pottery (BCP) timbering material (providing) by country of Sichuan University biomedical material Engineering Technical Research Centre.
α-MEM substratum (Hyclone, the U.S.);
Foetal calf serum (Hyclone, the U.S.);
Trypsinase-ethylenediamine tetraacetic acid (EDTA) (EDTA) (Gibco, the U.S.);
FGF2 (Peprotech Inc, the U.S.);
LIF, Anti-GFP antibody (Millipore, the U.S.);
Type i collagen enzyme (COLLAGENASE TYPE I), dimethyl sulfoxide (DMSO) (DMSO), dexamethasone (Dex), L-xitix (L-ascorbic acid), 1,25-dihydroxyvitamin D3 (1,25-(OH) 2VitD3), 3-isobutyl-1-methylxanthine (IBMX), indomethacin, oil red O is all available from U.S. Sigma company;
RNA extraction agent box (Shanghai Hua Shun, China);
TaKaRa one step RNA PCR Kit (AMV), DL2000 are all available from Japanese TaKaRa company.
Constant water bath box (Heto-Hoten, Denmark); Micropipet (Gilson company, France); Culturing bottle (Corning, the U.S.), electronic balance (Strtorius, the U.S.), 0.22pm Millex Syringe Filters (Millipor, the U.S.), ultrapure water machine UNIQUE-R30(Millipore, the U.S.); CO2 incubator (Thermo, Germany, desk centrifuge SORVALLR LEGEND RM(Thermo, Germany), temperature control desk centrifuge SORVALLR LEGEND T(Thermo, Germany), Thermo KS12 Bechtop (Thermo, Germany), Thermo-86 ℃ of HERA freeze, (Thermo, Germany); OLYMPUS IX71 is inverted and differs fluorescent microscope (Olympus, Japan), OLYMPUS CKX41 inverted microscope (Olympus, Japan), OLYMPUS CX41 is just putting microscope (Olympus, Japan) ,-152 ℃ of Ultralow Temperature Freezer (SANYO, Japan), scanning electronic microscope (JSM-5900LV) (Jeol Ltd.); Tanon-2500 gel imaging instrument (sky, Shanghai energy, China); PCR instrument (BIO-RAD, the U.S.), gel imaging analysis software Quantity One 4.6.2 (BIO-RAD, the U.S.).
The isolation cultivation method of the fat stem cell described in the listed examples of the present invention comprises from the mouse fatty tissue separating and obtains, cultivates the SVF cell, also comprises with the immunological magnetic bead sorting method removing Lin in the SVF cell
+Cell obtains Lin
-Cell mass; With the Lin of fluidic cell separating method from obtaining
-Enrichment CD271 in the cell mass
+Sca-1
+Cell obtains fat stem cell; The fat stem cell usefulness that obtains is contained the culture medium culturing of LIF, FGF2 and the cultivation of going down to posterity.
In the isolation cultivation method of above-mentioned fat stem cell, from the mouse fatty tissue, separate and obtain, cultivate the SVF cell and comprise, under conventional aseptic condition, cut mouse inguinal region fat pad, through rinsing, shred, remove blood and handle after, in fatty tissue, add and the isopyknic 0.1% I Collagen Type VI enzyme of fat, be the SVF cell through digest, filter, split the cell that is obtained after red, centrifugal.
α-MEM the substratum that contains 10% foetal calf serum is adopted in the cultivation of SVF cell, and culture condition is v) CO of 37 ℃, 5%(v/
2
The marker that is adopted in the immunological magnetic bead sorting method is CD5, CD45R, CD11b, Anti-Gr-1 and Ter-119.The marker that uses in the fluidic cell separating method is Lin, CD271 and Sca-1.
Cultivating the used substratum of fat stem cell that obtains is to contain 10% volume ratio foetal calf serum, 10
3The α of U/mLLIF, 20ng/mLFGF2-MEM substratum.
Carry out the adherent cultivation of going down to posterity, when the stand density of the fat stem cell that obtains in the culture dish bottom reaches 80%, the cultivation of going down to posterity, and, be used to produce fat/scleroblast with the fat stem cell of P16.
1, the obtaining and cultivating of matter blood vessel fragment (SVF) cell:
1) gets female C57 mouse in 4 ages in week,, under aseptic condition, get rat inguinal region fat pad after the anesthesia produce effects, with aseptic PBS solution cleansing tissue piece with vetanarcol 0.1mg/100g intraperitoneal injection of anesthesia;
2) in Bechtop, the fatty tissue piece is shredded, on 37 ℃ of constant temperature shaking tables, digest 45-60 min with equal-volume 0.1% I Collagen Type VI enzyme, during suitably vibrate with abundant digestion;
3) add in the substratum that contains 10% volume ratio foetal calf serum and I Collagen Type VI enzyme, remove not digest big completely tissue block and the remaining residue of digestion with the cell sieving of 70 μ m, low-speed centrifugal (1200g, 5 min), the centrifuge tube bottom is cell mass;
4) absorb the fatty tissue and the mature fat cell of surface flotation, cell mass is resuspended and leave standstill 10 min, centrifugal (300g, 5 min) with freshly prepared erythrocyte cracked liquid;
5) collect the cell mass (a matter blood vessel fragment cell, SVF cell) of centrifuge tube bottom, substratum washing 3 times is inoculated in the culture dish of diameter 10cm by the cell density of 1 * 105/mL, at saturated humidity, 37 ℃, 5%CO
2Incubator in cultivate, changed substratum in per 3 days, substratum is the 10% volume ratio FBS+ α-MEM substratum that contains 100u/mL penicillin and 100 μ g/mL Streptomycin sulphates;
6) cell reaches about 80% when merging at culture dish bill kept on file layer growth, the cultivation of going down to posterity.
2, enrichment fat stem cell from the SVF cell
2.1 obtain SVF, select for use Lineage Cell Depletion Kit the moon to select Lin
-Cell:
1) with the SVF cell counting that obtains, PBS solution is washed, and centrifugal (300 * g, 10 min) absorb supernatant fully.
2) 40 μ L damping fluids resuspended 10
7Individual cell.
3) add 10 μ L Biotin-Antibody Cocktail in 10
7In the cell.
4) abundant mixing is hatched 10 min for 4 ℃.
5) add 30 μ L damping fluids in 10
7In the cell.
6) add 20 μ L Anti-Biotin Microbeads.
7) fully behind the mixing 4 ℃ hatch 15 min.
8) 1-2 mL damping fluid is washed cell, and centrifugal (300 * g, 10 min) absorb supernatant.
9) re-suspended cell is in 500 μ L damping fluids.
10) the magnetic post is put in the correct position of magnet stand, 500 μ L damping fluids are washed pillar once.
11) 500 μ L cell suspensions are added in the magnetic post, collect effusive liquid, the inside is contained to be Lin
-Cell
12) 500 μ L damping fluids are washed the magnetic post 3 times, and the effluent liquid that the effluent liquid of collection and previous step are collected mixes.
13) move down the magnetic post, place new collection tube top, add 1 mL damping fluid in the magnetic post, release the cell of magnetic mark rapidly.This gained cell is Lin
+Cell (CD5, CD45R, CD11b, Anti-Gr-1 or the Ter-119 positive).
2.2 FACS is from Lin
-Enrichment CD271 in the cell mass
+Sca-1
+Cell
1) with the rapid Lin that collects of previous step
-The cell numeration places 1.5mL EP pipe.
2) PBS liquid is washed once, with the α-MEM substratum re-suspended cell that does not contain serum.
3) CD271 one anti-(the anti-mouse of rabbit) of adding purified, lucifuge is hatched 30 min.
4) PBS liquid is washed, and with the α-MEM substratum re-suspended cell that does not contain serum, adds fluorescence two anti-(the anti-rabbit of monkey), hatches 30 min.
5) PBS liquid is washed, and with the α-MEM substratum re-suspended cell that does not contain serum, adds Sca-1 and 7AAD or DAPI, hatches 30 min.
6) PBS liquid is washed, and with the α-MEM substratum re-suspended cell that does not contain serum, the aseptic sorting of upflowing cell instrument obtains Lin
-: CD271
+: Sca-1
+A group cell and Lin
-: CD271
-And Lin
-: CD271
+: Sca-1
-Cell mass.
7) Lin that obtains
-: CD271
+: Sca-1
+Cell mass is cultivated.Simultaneously, with the Lin that collects
+Cell mass, Lin
-: CD271
-Cell mass and Lin
-: CD271
+: Sca-1
-Cell mass is also cultivated.
3, ASCs clonality (Clony-forming unit-fibroblast, mensuration CFU-F)
Adopt the limiting dilution method to clone cultivation the cell mass of fresh separated, make the suspension of individual cells, one cell is drawn in each hole of 48 orifice plates, add 20%FBS+ α-MEM substratum with micropipet with 20%FBS+ α-MEM substratum.
Detect clone's formation situation behind the 14d, cloning efficiency=(clone's formation/inoculating cell number) * 100%, cloning efficiency is 15.7% ± 0.58 after measured, cell forms clone in good condition as shown in Figure 2.
4, the detection of the external multidirectional differentiation capability of ASCs, this step are in order to verify the multidirectional differentiation capability of the fat stem cell that obtains.
4.1 becoming fat induces
P1 is inoculated in six orifice plates for ASCs, adds into the fat induced liquid behind 24 h and cultivate, the induced liquid composition sees Table 1, and amount was changed liquid in per 3 days half; Become fat to induce after 10 days with 4% Paraformaldehyde 96 fixed cell, carry out oil red O stain, DAPI dyes nuclear.Shown in Fig. 4 A, round fat drips and takes on a red color, be distributed in cell around, illustrate that cell can be to the differentiation of fatty direction.
The various induced liquid prescriptions of table 1
RT-PCR is detected as fat and induces one-tenth fat genes involved peroxisome proliferation body activated receptor γ 2 (peroxisome proliferator-activated receptor-γ 2 in the process, PPAR γ 2), CCAAT enhancer binding protein α (CCAAT/enhancer-binding α, C/EBP-α) and lipoprotein lipase (lipoprotein lipase, expression Lpl).RNA extraction agent box with reference to Shanghai China Shun Bioisystech Co., Ltd extracts cell total rna, and is according to the synthetic cDNA of the operation instructions of TaKaRa One Step RNA PCR Kit (AMV), that the cDNA template-20 ℃ storage that obtains is standby then.According to gene order to be detected, adopt Primer 5.0 primer-design softwares design primer, with house-keeping gene GAPDH as confidential reference items.The forward primer (Forward primer), reverse primer (Reverse primer), annealing temperature of design (annealing temperature, Tm) and expection product size etc. see Table 2.As shown in Figure 5, after inducing, the specific gene PPAR γ 2 of adipocyte, the expression of C/EBP-α, Lpl strengthen cell significantly, further show into fat from gene level and break up successfully through fat.
4.2 osteogenic induction
P1 is inoculated in six orifice plates for ASCs, changes osteogenic induction liquid behind the 24h into and cultivate, the induced liquid composition sees Table 1, changes liquid in per 3 days.Osteogenic induction after cultivating 14d dyes the capable sodium alizarinsulfonate of cell climbing sheet, observes the nodular formation situation of mineralising.Shown in Fig. 4 B, fat stem cell after inducing, is divided into scleroblast through bone, has typical red calcium tubercle to form.
RT-PCR detects skeletonization genes involved Runt associated transcription factor 2/ core binding factor a1 (runt related transcription factor 2/ core binding factor a1 in the skeletonization culturing process, Runx2/Cbfal) and osteopontin (osteopontin, expression OPN).As shown in Figure 5, the expression of Runx2, OPN significantly raises, and further shows the Osteoblast Differentiation success from gene level.
4.3 one-tenth chondrocyte induction
P1 is resuspended in the 1.2% low viscous alginate jelly with the cell concn of 1 * 107/mL for ASCs, with the CaCl2 solution crosslinking of 100mM, places into chondrocyte induction liquid and cultivates, and the induced liquid composition sees Table 1, changes liquid in per 3 days.After becoming chondrocyte induction to cultivate for 3 weeks sample is fixed, cut into slices and then use Toluidine blue staining, observe the formation of cartilage matrix.Shown in Fig. 4 C, fat stem cell is after becoming chondrocyte induction, and the Toluidine blue staining positive illustrates that fat stem cell can break up to the cartilage direction.
RT-PCR is detected as cartilage genes involved SRY box and comprises gene 9 (SRY-box containing gene 9, Sox9)) and aggrecan (aggrecan, expression Acan).As shown in Figure 5, the genetic expression of these 2 cartilage specificities strengthens, and further shows into cartilage from gene level and breaks up successfully.
4.4 becoming flesh induces
P1 is inoculated in six orifice plates for ASCs, changes into the flesh induced liquid behind the 24h into and cultivate, the induced liquid composition sees Table the hydrocortisone that 1(contains 50 μ mol/L, 5%HS, the DMEM/F12 of 10%FBS).4% Paraformaldehyde 96 is fixed α-SMA antibody mediated immunity fluorescent dye after 3 weeks.Shown in Fig. 4 D, the immunocytochemistry fluorescent dye of smooth muscle cell specific proteins α-SMA be positive (green).
RT-PCR is detected as the expression of myocyte's genes involved Myog and Myod1.As shown in Figure 5, the expression amount of Myog and Myod1 significantly increases, and confirms that further ASCs breaks up to one-tenth flesh direction on the mRNA level after one-tenth flesh is induced.
The primer sequence of gene to be detected is as shown in table 2:
The primer of table 2 testing gene and expection product situation
Annotate: PPAR-γ 2: peroxisome proliferation body activated receptor γ 2; C/EBP-α: CCAAT enhancer binding protein α; Lpl: the white enzyme of fat; Runx2:Runt associated transcription factor 2; Opn: osteopontin; The Sox9:SRY box comprises gene 9; Acan: aggrecan; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
5, add FGF2 and LIF influence to ASCs propagation and multidirectional differentiation capability
5.1 FGF2 and LIF are to the influence of ASCs multiplication capacity
1) ASCs is divided into no FGF2 and LIF group and FGF2 and LIF group is arranged, FGF2 and LIF group 10% FBS (v/ v)+add the FGF2 of 20 ng/mL and the LIF of 1000 units/mL in α-MEM substratum.Get the ASCs in the 1st, 6,11 and 16 generations in two groups respectively, with 5 * 103/ holes the cell kind is gone in 12 orifice plates, 2,4,6,8 and 10d take out the cell that adds and do not add FGF2, LIF respectively, detect cell number with mtt assay, draw growth curve, calculate the population doubling time of cell.
2) with 10/cm
2Inoculating cell detects the clone have and do not have among two groups of FGF2, the LIF respectively and forms situation behind 14 d, calculate cloning efficiency.
5.2 FGF2 and LIF are to keeping the effect of the multidirectional differentiation potential of ASCs
5.2.1 to becoming the influence of fat differentiation potential
Get the ASCs in the 1st, 6,11 and 16 generations in two groups respectively, with identical density inoculating cell.Add into the fat induced liquid behind the 24h and cultivate, become fat to induce after 10 days and carry out oil red O stain.By glycerol-3-phosphate dehydrogenase (glycerol-3-phosphate dehydrogenase, GPDH) adipocyte formation amount is judged in determination of activity, the GPDH activity determination method is washed the purpose cell with reference to reported method such as Hauner: PBS, the 25 mM Tris-HCl damping fluid collecting cells (pH 7.5) that comprise 1 mM EDTA of precooling, get supernatant behind the ultrasonic degradation cell, UV spectrophotometer measuring GPDH activity, reaction system: 100 mM trolamine HCl damping fluids (pH 7.5), 2.5 mM EDTA, 0.12mM NADH, 0.1 mM mercaptoethanol and 0.2 mM phosphodihydroxyacetone.
5.2.2 influence to Osteoblast Differentiation potential
1) gets the ASCs in the 1st, 3,6,11 and 16 generations in two groups respectively, with identical density inoculating cell.Add osteogenic induction liquid behind 24 h and cultivate, carry out sodium alizarinsulfonate dyeing after 14 days, observe the nodular formation situation of mineralising.
2) with P1 for the conventional osteogenic induction of one group of row of ASCs, other one group adds the FGF2 of 20 ng/mL and the LIF of 1000 units/mL simultaneously in osteogenic induction liquid.Extracted total RNA at the 4th, 7,14 and 21 day respectively, skeletonization genes involved Runx2 and Ocn are detected according to preceding method.
3) according to 1) same grouping, extract total RNA of the ASCs that has or do not have the 1st, 3,6,11 and 16 generations that FGF2 and LIF cultivate respectively, the mRNA that RT-PCR detects the early stage genes involved Runx2 of skeletonization expresses, and judges whether it has skeletonization potential.
The result shows that under the culture condition of no FGF-2 and LIF, ASCs cultivates P16 generation, does not see behind the osteogenic induction that the mineralising tubercle forms, and have under the culture condition of FGF-2 and LIF that ASCs cultivates P16 and forms for still seeing the mineralising tubercle.In the osteogenic induction substratum of no FGF-2 and LIF, skeletonization early gene Runx2 expression amount in the time of 7～14 days is higher for ASCs for P1, expresses in the time of 21 days to disappear, and expressing appearred in the time of the 7th day in skeletonization significant gene Ocn in late period, continued to 21 days.And contain in the osteogenic induction substratum of FGF-2 and LIF, the skeletonization early gene Runx2 among the ASCs still had expression in the time of 21 days, and skeletonization late gene Ocn never expresses in inducing process.In the basic medium that FGF-2 and LIF are arranged, ASCs P16 for the time still can detect the expression of skeletonization early gene Runx2; And do not have in the basic medium of FGF-2 and LIF, ASCs P16 for the time fail to detect the expression of Runx2.
6, the obtaining and cultivating of GFP fat stem cell (with the C57 mouse), this test is the fat stem cell that is marked with GFP in order to obtain, and further carries out the in vivo test checking.
1) adopts method enrichment Lin from GFP transgenosis C57 mouse fatty tissue same as described above
-: CD271
+: Sca-1
+GFP fat stem cell group;
2) with the cell that obtains by 1 * 10
5The cell density of/mL is inoculated in the culture dish of diameter 10cm and cultivates, 10%FBS (v/ v)+α-MEM substratum (containing FGF-2 and LIF), at saturated humidity, 37 ℃, 5%CO
2Incubator in cultivate, changed substratum in per 3 days.
3) Lin
-: CD271
+: Sca-1
+GFP fat stem cell group's external one-tenth fat differentiation
With the P3 that obtains for the GFP fat stem cell with 1 * 10
5Cells is seeded in the culture dish of diameter 3.5cm, begin into fat behind 24 h and induce, fat comprises α-MEM basic medium, 10% FBS, 1 μ M dexamethasone, 10 μ M Regular Insulin, 0.5mM 3-isobutyl-1-methylxanthine and 0.2mM indomethacin and 100u/mL penicillin, 100 μ g/mL Streptomycin sulphates to inducing culture.Per 3 days half amounts are changed and are comprised α-MEM basic medium and 10% FBS (v/ substratum v).
RT-PCR is detected as fat and induces the mRNA expression that becomes fat genes involved PPAR γ 2 and C/EBP-α in the process.The GFP fat stem cell of fat after inducing 10d detects fat with oil red O stain and drips the formation situation.
4) Lin
-: CD271
+: Sca-1
+GFP fat stem cell group's external Osteoblast Differentiation
P3 is inoculated in six orifice plates for the GFP fat stem cell, changes the skeletonization induced liquid behind 24 h and cultivate, the osteogenic induction substratum comprises α-MEM basic medium, 10% FBS, 10mM β-phospho-glycerol sodium, 10
-8Mol/L dexamethasone, 50 μ M xitix and 0.01 μ M 1,25-dihydroxyvitamin D3 and 100u/mL penicillin, 100 μ g/mL Streptomycin sulphates.
The expression of skeletonization genes involved Runx2 and Ocn in the RT-PCR detection skeletonization culturing process.Osteogenic induction is cultivated the capable sodium alizarinsulfonate dyeing of cell climbing sheet of 21d and is observed the nodular formation of mineralising.
The result shows
The GFP fat stem cellShow as the inoblast sample form of fusiformis, reach 80% ~ 90% cytogamy about 6 days, the egfp expression of all cells is all positive.After the GFP fat stem cell became fat to induce, the lipid that forms in its endochylema identified that with oil red O stain lipid is dyed orange red, and control group dyeing is negative; Detect by RT-PCR, one-tenth fat induces the mRNA that becomes fat specific gene PPAR γ 2 and C/EBP-α in the process to express obvious the enhancing; Confirm that the GFP fat stem cell successfully is divided into adipocyte after becoming fat to induce.The capable sodium alizarinsulfonate dyeing of the cell climbing sheet of 21d can be observed the formation of red mineralized material behind the GFP fat stem cell osteogenic induction; The expression of skeletonization specific gene Runx2 and Ocn in the RT-PCR detection skeletonization culturing process; Confirm that the GFP fat stem cell breaks up to the skeletonization direction after inducing through bone.
7, the structure and the body of cell-scleroproein mixture are implanted into, and the effect of this test is the interior one-tenth of the body fat differentiation of checking fat stem cell.
1) adopt P3 for GFP
+Lin
-: CD271
+: Sca-1
+Fat stem cell is with 2 * 10
7The density of cells/mL mixes with the 100 μ l fibrinogen solutions that contain 1 μ g FGF2.With Lin
-: CD271
-And Lin
-: CD271
+: Sca-1
-Groups of cells in contrast.
2) under the aseptic condition, the chloral hydrate anesthesia nude mice with 3.5%.
3) after the anesthesia produce effects, with 1) in celliferous fibrinogen solution and 100 μ L thrombin solutions to inject the nude mice back simultaneously subcutaneous.
8, the structure and the body of cell-BCP timbering material mixture are implanted into, and the effect of this test is the interior Osteoblast Differentiation of the body of checking fat stem cell.
8.1 the structure of the characteristics of BCP timbering material and cell-BCP timbering material mixture
(Biphasic calcium phosphate ceramics, BCP) (ratio of β-TCP) is 30:70 to porous biphasic calcium phosphate pottery, long 5mm, diameter 1.5mm for hydroxyapatite (HA) and bata-tricalcium phosphate in the timbering material.Adopt H
2O
2The drilling of microwave foaming method, macropore pore size 200
~500 μ m, connectivity is good between the hole, and tens to tens microns a large amount of micropores that connect are mutually arranged on the macropore hole wall.Standby after ultrasonic cleaning, high-temperature steam sterilization.
With 5 * 10
6The density of cells/mL is seeded in BCP timbering material surface with the GFP fat stem cell.After 5 days the cell-scaffold material composite is washed 2 times with PBS, 2.5% glutaraldehyde is fixedly spent the night for 4 ℃; 30%, 50%, 75%, 85%, 95%, 100% volume fraction alcohol gradient dehydration; Be immersed in displacement 1 h in the isoamyl acetate after the dehydration; Critical point drying, metal spraying; Scanning electron microscope detects.
8.2 the body of cell-BCP timbering material mixture is implanted into
1) adopt above-mentioned same method to make up GFP fat stem cell-BCP timbering material mixture, totally 4 samples.With Lin
-: CD271
-And Lin
-: CD271
+: Sca-1
-Groups of cells in contrast.
2) under the aseptic condition, the chloral hydrate anesthesia male common C57 mouse in 8 age in week with 3.5%.
3) after the anesthesia produce effects, do otch in the femur district under the aseptic condition, the passivity separating muscle exposes femur.Femur defect with the long 5mm of low speed electric drill preparation.
4) GFP fat stem cell-BCP timbering material mixture implantable bone defective region, silk thread are fixed.The layering apposition suture.
9, the detection of repopulating cell-timbering material mixture.
9.1 the detection of cell-scleroproein mixture
1) mixture is implanted 6w, and laboratory animal is put to death in excessive anesthesia, takes out cell-scleroproein mixture of implanting, routine paraffin wax embedding, HE section statining.
2) frozen section oil red O stain, step is as follows:
The true tumor that A takes out is fixedly spent the night with 10% neutral formalin.
Frozen section in the B-25 ℃ cryostat, slice thickness 10 μ m.
Wash slightly in C 60% Virahol.
D oil red O dye liquor infects 10 min.
E flowing water washes 5 min.
F Hematorylin liquid is contaminated 2 min.
G flowing water washes 5 min, 1% (v) hydrochloride alcohol differentiation of v/.
10min is to the nucleus oil blackeite in the H washing.
I inhales and removes excessive moisture on every side, glycogelatin mounting.
3) immunohistochemistry of anti-GFP detects, and step is as follows:
A makes the thick paraffin section of 5 μ m, 24 h in 60 ℃ of baking ovens.
C dehydrated alcohol 5 min, 95%, 85%, 75% (v/ is each 5 min of ethanol v).
D flowing water washes 5 min.
(v/ is H v) for E 3%
2O
2Incubated at room 15 min, the activity of blocking-up endogenous peroxydase.
F ddH
2O soaks 3 min * 3 time, jolting on the low speed shaking table in the immersion process.
G adds antigen retrieval liquid, 95 ℃ of water-bath 45 min.
Cooling 30 min under the H room temperature.Outwell antigen retrieval liquid, ddH2O soaks 1 min.
(v/ v) hydrochloride alcohol breaks up 3 sec to I 1%.
K is hatched 45 min for 37 ℃, PBS flushing, 5 min * 3 time.
It is anti-that L drips the anti-mouse of the rabbit of 1:100 two, hatches 30 min for 37 ℃, PBS flushing, 5 min * 3 time
M drips the 1:100 horseradish peroxidase complex, hatches 30 min for 37 ℃, PBS flushing, 5 min * 3 time.
N DAB colour developing is grasped dye levels at microscopically, and flowing water washes 10 min.
O haematoxylin redyeing 2min, 1% (v) hydrochloride alcohol differentiation of v/, flowing water flushing 10min.
P dehydration, transparent, the neutral gum mounting, microscopically is observed.
9.2 the detection of cell-BCP timbering material mixture
1) mixture is implanted 6w, and laboratory animal is put to death in excessive anesthesia, takes out GFP fat stem cell-BCP timbering material mixture of implanting, 12% EDTA decalcification 2w in 37 ℃ of water-baths.Make the thick paraffin section of 5 μ m, conventional H E dyeing, Masson dyeing.
2) make the thick paraffin section of 5 μ m, the immunohistochemistry of the anti-GFP of row detects.
The result shows 6w in the implantation nude mouse, and the true tumor of taking-up is yellow-white, obviously reduces when volume is implanted.Through HE, oil red O stain, confirm the fatty tissue of true tumor.Fat is obviously many than not inducing group to the adipocyte amount of inducing group.The anti-GFP immunohistochemistry of the new adipocyte that forms detects positive, and the GFP fat stem cell that is indicated as implantation is transformed.
GFP fat stem cell-BCP timbering material mixture is implanted C57 mouse femur defective region 6w, and the true tumor of taking-up confirms to have new bone forming through HE, Masson dyeing.The capable anti-GFP immunohistochemistry of tissue slice is detected, visible its part scleroblast positive, and other scleroblast is negative, shows that the GFP fat stem cell of implantation partly is converted into scleroblast, participates in the formation of new bone.
In the present invention, proved that from aspects such as morphology, immunocytochemistry, mRNA and protein levels the ASCs that obtains has the potential of self ability and multidirectional differentiation, clonality is stronger, and confirms that it can be converted into adipocyte/scleroblast under the microenvironment that becomes fat/skeletonization.This method has been set up a kind of novel method that obtains high purity ASCs efficiently, fast, for external obtain a large amount of seed cells and be applied to tissue regeneration with dryness new way is provided.
Sequence table
＜110〉Sichuan University
＜120 〉
A kind of isolation cultivation method of fat stem cell
<160>16
<210>1
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: PPAR-γ 2 upstream primers
<400>1
agaccactcgcattcctttgac22
<210>2
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: PPAR-γ 2 downstream primers
<400>2
tgctttatccccacagactcg21
<210>3
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: C/EBP-α upstream primer
<400>3
ggatggtttcgggtcgctggat22
<210>4
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: C/EBP-α downstream primer
<400>4
cacggcctgactccctcatctta23
<210>5
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: Lp1 upstream primer
<400>5
gaggatggcaagcaacac18
<210>6
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: Lp1 downstream primer
<400>6
tgggttagccaccgttta18
<210>7
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: Runx2 upstream primer
<400>7
actacccagccacctttacctac23
<210>8
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: Runx2 downstream primer
<400>8
gtcagcgtcaacaccatcattc22
<210>9
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: Opn upstream primer
<400>9
tggtgcctgacccatctc18
<210>10
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: Opn downstream primer
<400>10
gctgccctttccgttgtt18
<210>11
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: Sox9 upstream primer
<400>11
gctctactccaccttcactt20
<210>12
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: Sox9 downstream primer
<400>12
ttctccaatcgtcctcca18
<210>13
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: Acan upstream primer
<400>13
atggaaaccagcacggagacac22
<210>14
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: Acan downstream primer
<400>14
ccagcctcagggtaagcagaca22
<210>15
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: GAPDH upstream primer
<400>15
tcaacggcacagtcaagg18
<210>16
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: GAPDH downstream primer
<400>16
accagtggatgcagggat18
Claims (10)
1. the isolation cultivation method of a fat stem cell comprises separating from fatty tissue and obtains, cultivates the SVF cell, it is characterized in that further comprising the steps of: remove Lin in the SVF cell with the immunological magnetic bead sorting method
+Cell obtains Lin
-Cell mass; With the Lin of fluidic cell separating method from obtaining
-Enrichment CD271 in the cell mass
+Sca-1
+Cell obtains fat stem cell; With the fat stem cell culture medium culturing that contains LIF, FGF2 that obtains.
2. the isolation cultivation method of fat stem cell according to claim 1, it is characterized in that: the marker that is adopted in the immunological magnetic bead sorting method is CD5, CD45R, CD11b, Anti-Gr-1 and Ter-119.
3. the isolation cultivation method of fat stem cell according to claim 1, it is characterized in that: the marker that uses in the fluidic cell separating method is Lin, CD271 and Sca-1.
4. the isolation cultivation method of fat stem cell according to claim 1 is characterized in that: cultivating the used substratum of fat stem cell that obtains is to contain 10% volume ratio foetal calf serum, 10
3-10
5The α of U/mL LIF, 10-100 ng/mL FGF2-MEM substratum.
5. the isolation cultivation method of fat stem cell according to claim 4 is characterized in that: cultivating the used substratum of fat stem cell that obtains is to contain 10% volume ratio foetal calf serum, 10
3The α of U/mL LIF, 20 ng/mL FGF2-MEM substratum.
6. the isolation cultivation method of fat stem cell according to claim 1 is characterized in that: also comprise the fat stem cell that the obtains cultivation of going down to posterity.
7. the isolation cultivation method of fat stem cell according to claim 6 is characterized in that: describedly go down to posterity that to cultivate be adherent culture.
8. the isolation cultivation method of fat stem cell according to claim 7 is characterized in that: when the stand density of the fat stem cell that obtains in the culture dish bottom reaches 70-90%, and the cultivation of going down to posterity.
9. according to the application of the fat stem cell of the isolation cultivation method institute separation and Culture of any fat stem cell of claim 1-8, it is characterized in that it is applied to the production of purifying or clone stem cell, transgenosis stem cell line or is used to produce fat/scleroblast.
10. the application of fat stem cell according to claim 9 is characterized in that it is applied to produce fat/osteoblastic method and is:
(1), sorting combines to separate and obtains ASCs with the magnetic activating cells for fluorescence-activation fluidic cell classification;
(2), with ASCs respectively conjugated fibre albumen and BCP timbering material, be inoculated in the damaged place of nude mice back or mouse femur.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010568873 CN102002478B (en) | 2010-12-01 | 2010-12-01 | Adipose-derived stem cell separation culture method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010568873 CN102002478B (en) | 2010-12-01 | 2010-12-01 | Adipose-derived stem cell separation culture method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102002478A true CN102002478A (en) | 2011-04-06 |
| CN102002478B CN102002478B (en) | 2013-01-02 |
Family
ID=43810180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010568873 Active CN102002478B (en) | 2010-12-01 | 2010-12-01 | Adipose-derived stem cell separation culture method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102002478B (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102485885A (en) * | 2011-06-09 | 2012-06-06 | 臻景生物技术（上海）有限公司 | Separating method and application of fat stem cells |
| CN103830275A (en) * | 2012-11-21 | 2014-06-04 | 瑟弗维股份有限公司 | Adipose tissue-derived stem cells for veterinary use |
| CN104630140A (en) * | 2013-11-06 | 2015-05-20 | 吉林济惠生物科技有限公司 | Isolation and culture method of placenta mesenchyma precursor stem cells |
| CN106337036A (en) * | 2016-08-26 | 2017-01-18 | 杭州易文赛生物技术有限公司 | Method for increasing extraction rate of CD34 positive stromal vascular fraction (SVF) in high-fat tissue |
| CN106399234A (en) * | 2016-08-31 | 2017-02-15 | 肖锷 | Processing method of adipose tissue, mesenchymal stem cell, single processed adipose cell, and extracellular matrix |
| CN107254435A (en) * | 2017-06-08 | 2017-10-17 | 黎洪棉 | A kind of internal construction method of study of vascularized tissue engineering fat flap |
| CN107345897A (en) * | 2016-05-04 | 2017-11-14 | 上海米洋杨生物科技有限公司 | A kind of screening technique of retinal photoreceptor cells specific surfaces albumen |
| CN109266601A (en) * | 2018-07-12 | 2019-01-25 | 江苏瑞思坦生物科技有限公司 | The method for constructing clinical fat stem cell bank |
| US10589268B2 (en) | 2016-06-08 | 2020-03-17 | The Regents Of The University Of California | Method and device for processing tissues and cells |
| CN111040994A (en) * | 2019-11-20 | 2020-04-21 | 中国人民解放军陆军军医大学第一附属医院 | Method for efficiently separating adipose-derived mesenchymal stem cells |
| US10683480B2 (en) | 2013-06-21 | 2020-06-16 | The Regents Of The University Of California | Microfluidic tumor tissue dissociation device and method |
| US10722540B1 (en) | 2016-02-01 | 2020-07-28 | The Regents Of The University Of California | Microfluidic device and method for shear stress-induced transformation of cells |
| CN113215092A (en) * | 2021-05-26 | 2021-08-06 | 山东博森医学工程技术有限公司 | Rapid adipose-derived mesenchymal stem cell adipogenic differentiation method |
-
2010
- 2010-12-01 CN CN 201010568873 patent/CN102002478B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| 《国际口腔医学杂志》 20080930 管晓光 脂肪基质细胞骨向诱导分化的研究进展 第35卷, 第5期 2 * |
| 《实用口腔医学杂志》 20040131 陈希哲等 人体脂肪基质细胞分离培养及其成骨潜能 第20卷, 第1期 2 * |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102485885A (en) * | 2011-06-09 | 2012-06-06 | 臻景生物技术（上海）有限公司 | Separating method and application of fat stem cells |
| CN103830275A (en) * | 2012-11-21 | 2014-06-04 | 瑟弗维股份有限公司 | Adipose tissue-derived stem cells for veterinary use |
| US10683480B2 (en) | 2013-06-21 | 2020-06-16 | The Regents Of The University Of California | Microfluidic tumor tissue dissociation device and method |
| US11427798B2 (en) | 2013-06-21 | 2022-08-30 | The Regents Of The University Of California | Microfluidic tissue dissociation device and method |
| CN104630140A (en) * | 2013-11-06 | 2015-05-20 | 吉林济惠生物科技有限公司 | Isolation and culture method of placenta mesenchyma precursor stem cells |
| US10722540B1 (en) | 2016-02-01 | 2020-07-28 | The Regents Of The University Of California | Microfluidic device and method for shear stress-induced transformation of cells |
| CN107345897A (en) * | 2016-05-04 | 2017-11-14 | 上海米洋杨生物科技有限公司 | A kind of screening technique of retinal photoreceptor cells specific surfaces albumen |
| US11130127B2 (en) | 2016-06-08 | 2021-09-28 | The Regents Of The University Of California | Method and device for processing tissues and cells |
| US10589268B2 (en) | 2016-06-08 | 2020-03-17 | The Regents Of The University Of California | Method and device for processing tissues and cells |
| CN106337036A (en) * | 2016-08-26 | 2017-01-18 | 杭州易文赛生物技术有限公司 | Method for increasing extraction rate of CD34 positive stromal vascular fraction (SVF) in high-fat tissue |
| CN106399234A (en) * | 2016-08-31 | 2017-02-15 | 肖锷 | Processing method of adipose tissue, mesenchymal stem cell, single processed adipose cell, and extracellular matrix |
| CN107254435A (en) * | 2017-06-08 | 2017-10-17 | 黎洪棉 | A kind of internal construction method of study of vascularized tissue engineering fat flap |
| CN109266601A (en) * | 2018-07-12 | 2019-01-25 | 江苏瑞思坦生物科技有限公司 | The method for constructing clinical fat stem cell bank |
| CN111040994A (en) * | 2019-11-20 | 2020-04-21 | 中国人民解放军陆军军医大学第一附属医院 | Method for efficiently separating adipose-derived mesenchymal stem cells |
| CN113215092A (en) * | 2021-05-26 | 2021-08-06 | 山东博森医学工程技术有限公司 | Rapid adipose-derived mesenchymal stem cell adipogenic differentiation method |
| CN113215092B (en) * | 2021-05-26 | 2022-04-05 | 广州峰缘生物科技有限公司 | Rapid adipose-derived mesenchymal stem cell adipogenic differentiation method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102002478B (en) | 2013-01-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102002478B (en) | Adipose-derived stem cell separation culture method | |
| Williams et al. | Young developmental age cardiac extracellular matrix promotes the expansion of neonatal cardiomyocytes in vitro | |
| US20180117087A1 (en) | Stem cells from urine and methods for using the same | |
| JP6687757B2 (en) | Methods for preparing 3D cartilage organoid blocks | |
| Greiner et al. | Efficient animal-serum free 3D cultivation method for adult human neural crest-derived stem cell therapeutics | |
| Valarmathi et al. | A 3-D cardiac muscle construct for exploring adult marrow stem cell based myocardial regeneration | |
| CN107937342B (en) | Method for amplifying neural stem cells through endothelial cell-derived exosomes | |
| JP2010539970A (en) | Optimized and defined method for isolating and storing progenitor cells from human umbilical cord | |
| CN105779381A (en) | Clinical treatment grade preparation method used for screening human umbilical cord derived WJ-MSCs (Wharton's jelly mesenchymal stem cells) in large scale by applying extracellular matrices through three-dimensional attachment and for cell treatment | |
| CN105779384A (en) | Seed cell screening and culturing cryopreservation technical method of human amniotic mesenchymal stem cells for tissue engineering | |
| CN109234229A (en) | Method and digestive enzyme compositions used from placenta blood vessel separating mesenchymal stem cell | |
| De Rosa et al. | Amniotic fluid-derived mesenchymal stem cells lead to bone differentiation when cocultured with dental pulp stem cells | |
| CN106978396A (en) | A kind of amplification cultivation method of fat mesenchymal stem cell clone | |
| CN105647860A (en) | Serum-free in-vitro extraction and preparation method of clinical treatment-grade placental decidua basalis-mesenchymal stem cells (PDB-MSCs) | |
| Niu et al. | Comparative study of three types of polymer materials co-cultured with bone marrow mesenchymal stem cells for use as a myocardial patch in cardiomyocyte regeneration | |
| Gorkun et al. | The duo of osteogenic and angiogenic differentiation in ADSC-derived spheroids | |
| CN111548990A (en) | Dental pulp stem cell polymer for exfoliating deciduous teeth and preparation method and application thereof | |
| CN102533640B (en) | Method for generating adult stem cells into spheroid cell populations | |
| CN105713869A (en) | In-vitro three-dimensional isolated culture and storage method for hCDMSC (human chorion-derived mesenchymal stem cell) for clinical adoptive therapy | |
| CN109897815A (en) | It is a kind of without coated fatty endothelial progenitor cells efficiently separate and cultural method | |
| CN109628388A (en) | With digestive enzyme compositions from placenta blood vessel separating mesenchymal stem cell | |
| WO2009080794A1 (en) | Method for preparing cell-specific extracellular matrices | |
| CN106676056A (en) | Method for inducing differentiation from umbilical cord mesenchymal stem cells to insulin secretion cells | |
| CN110484491B (en) | Method for obtaining amniotic membrane and amniotic fluid derived endothelial progenitor cells and purification culture method thereof | |
| US20230279355A1 (en) | Method for the in vitro or ex vivo amplification of stem cells of brown or beige adipocytes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210412 Address after: No.11, 18 / F, building 9, No.399, Xiduan, Fucheng Avenue, Chengdu hi tech Zone, China (Sichuan) pilot Free Trade Zone, Chengdu, Sichuan 610000 Patentee after: Chengdu Lide enterprise management center (L.P.) Address before: 610041 No. three, South Renmin Road, Sichuan, Chengdu Province 14 Patentee before: SICHUAN University |
|
| TR01 | Transfer of patent right | ||
| CP02 | Change in the address of a patent holder |
Address after: No.11, 18th floor, building 9, No.399, Fucheng avenue west section, Chengdu hi tech Zone, 610000 China (Sichuan) pilot Free Trade Zone, Chengdu, Sichuan Province Patentee after: Chengdu Lide enterprise management center (L.P.) Address before: No.11, 18 / F, building 9, No.399, Xiduan, Fucheng Avenue, Chengdu hi tech Zone, China (Sichuan) pilot Free Trade Zone, Chengdu, Sichuan 610000 Patentee before: Chengdu Lide enterprise management center (L.P.) |
|
| CP02 | Change in the address of a patent holder | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210628 Address after: 2-3 / F, building E7, No.16, hemin street, Chengdu hi tech Zone, China (Sichuan) pilot Free Trade Zone, Chengdu, Sichuan 610000 Patentee after: Chengdu worldlink Health Biotechnology Co.,Ltd. Address before: No.11, 18th floor, building 9, No.399, west section of Fucheng Avenue, Chengdu hi tech Zone, China (Sichuan) pilot Free Trade Zone, Chengdu, Sichuan 610000 Patentee before: Chengdu Lide enterprise management center (L.P.) |
|
| TR01 | Transfer of patent right |