CN102000101A - Application of scutellarin to treatment of microglia-mediated diseases - Google Patents
Application of scutellarin to treatment of microglia-mediated diseases Download PDFInfo
- Publication number
- CN102000101A CN102000101A CN 201010522879 CN201010522879A CN102000101A CN 102000101 A CN102000101 A CN 102000101A CN 201010522879 CN201010522879 CN 201010522879 CN 201010522879 A CN201010522879 A CN 201010522879A CN 102000101 A CN102000101 A CN 102000101A
- Authority
- CN
- China
- Prior art keywords
- scutellarin
- disease
- microglia
- purposes
- medicine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Plant Substances (AREA)
Abstract
The invention relates to application of scutellarin shown as a formula I to the treatment of microglia-mediated diseases. Typically, the invention relates to the application of the scutellarin to the preparation of medicaments for treating and/or preventing the microglia-mediated diseases, in particular to the application of the scutellarin to the preparation of medicaments for treating and/or preventing microglia-mediated neurotoxicity-caused neural immune inflammatory diseases. The scutellarin has the novel functions of remarkably inhibiting the generation of inflammatory mediators, namely nitric oxide (NO), a tumor necrosis factor (TNF) alpha and interleukin (IL)-1beta which activate microglia, inhibiting the expression of inducible nitric oxide synthase (iNOS), TNF alpha and IL-1beta messenger ribonucleic acid (mRNA), inhibiting the generation of reactive oxygen species in the microglia, reducing the activation of nuclear factor (NF)-kappa B and remarkably alleviating the cytotoxicity of the microglia to neurons. Therefore, the scutellarin can be applied to the prevention and treatment of brain immune inflammatory related diseases such as Parkinson's disease and the like. The formula I is shown in the specifications.
Description
Technical field
The present invention relates to the new purposes of scutellarin, be specifically related to for example new purposes of diseases such as parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease of the caused nerve immunity inflammatory diseases of neurotoxic effect that scutellarin treats and/or prevents microglia mediation.
Background technology
Parkinson disease (Parkinson ' s disease) are the common dyskinetic disorders of a kind of middle-aged and elderly people, claim Parkinsonism again, and its main pathology is changed into the formation of Louis (Lewy) corpusculum in substantia nigra of midbrain dopaminergic neuron degeneration necrosis and the brain.The clinical symptoms such as static tremor, myotonia, bradykinesia that mainly show as.The Parkinsonian cause of disease and cause that the accurate mechanism of dopaminergic neuron degeneration does not throw a flood of light on so far yet.Parkinson disease are still the progressivity disease that can not cure, and present treatment in fact mainly is quality of life and the ability to work that improves patient.Along with aged tendency of population becomes clear day by day, the primary disease sickness rate has obvious ascendant trend.The most conservative estimation, China's parkinson disease sickness rate had increased more than 20 times at least in nearly 20 years, up to about 2%.Doctor trained in Western medicine clinical treatment parkinson disease are mainly selected goldstandard medicine levodopa (L-dihydroxy-phenylalanine) class preparation for use at present.But the many toxicities of normal appearance in the 2-5 of treatment, as nauseating, anorexia, slightly reduction of blood pressure, orthostatic hypotension, " agent end phenomenon ", " on-off phenomenon ", psychological problem etc., patient's compliance and quality of life have seriously been influenced, along with prolong and toxicity apparition, serious medicine time, and there are problems such as curative effect goes down.
Multiple sclerosis (multiple sclerosis) is a kind of inflammation of the central nervous system demyelinating disease by the autoimmune caused by abnormal, and alleviation-recurrence is an important feature in the course of disease, is the common cause of young neurologic disability.The definite cause of disease and pathogenesis are not bright, but think that multiple sclerosis is main by the cell-mediated autoimmune response disease of CD4+T.The medicine that is used for the treatment of multiple sclerosis at present comprises immunomodulator and immunosuppressant, as interferon-(IFN-β), glatiramer (acetate, glatiramer acetate), mitoxantrone (novantrone) etc., but said medicine all is the intestinal external administration, the patient uses inconvenience, and untoward reaction is all bigger.
Huntington's disease (Huntington ' s disease) be a kind of heritability degeneration encephalopathy, the cause of disease of Huntington's disease is the sudden change of huntingtin gene (Huntingtin gene).Although the formation of corresponding mutation-ure Huntingdon protein (Htt) polymer is relevant with the pathogeny of Huntington's disease, people do not know still whether it has really caused neural damage.Still there is not at present the effectively method of treatment Huntington's disease.
In recent years, along with deepening continuously of research, the abnormal activation of finding microglia (microglia) all plays a significant role in diseases such as parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease, is the main diseases therefore that causes nerve injury in the evolution of above-mentioned disease pathology.Microglia is central nervous system's immunocyte, under the pathological state of diseases such as parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease, the minor variations of microenvironment can activate microglia, makes it from the quiescent condition fast steering state of activation.Whole activation process presents water fall effect: differentiation, propagation, immune molecule is expressed or up-regulated, migrates to damaging part, and form, immundominance and changing function etc. take place.Its form upper volume increases, cell space becomes circle and have distortion, phagocytosis; On the function beginning great expression some with antigen recognition with offer relevant membrane surface molecule, as express main histocompatibility complex II (MHC) etc.; Overexpression stromatin enzyme 9 (MMP9), the degraded blood brain barrier.The more important thing is, significantly raise the secretion level of many cytokines, wherein small part such as GDNF promote neuronal survival, and major part has the neuron detrimental effect as tumor necrosis factor (TNF α), interleukin-11 β (IL-1 β), interleukin 6 (IL-6) etc., also has chemotactic factor such as monocyte chemoattractant protein 1 (MCP-1), irregular chemotactic factor (Fractalkine), macrophage inflammatory protein 1 mediated leucocytes chemotactics such as (MIP-1); Also produce nitric oxide (NO), reactive oxygen species (ROS) and eicosanoid class (as PGE2) etc., cause the Secondary cases cerebral lesion.Microglia is not only natural immunity effector lymphocyte, participates in starting and regulating acquired immunity simultaneously, participates in the multiple sclerosis morbidity.
Therefore, suppress the overactivity of microglia, its excretory various proinflammatory factors of balance can effectively prevent and treat diseases such as parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease.In the past document or patent also show, naloxone (naloxone, J Pharmacol Exp Ther 2000,293:607-617), dextromethorphan (dextromethorphan, J Pharmacol Exp Ther 2003,305:212-218), tetrahydro isoquinoline derivative (CN101553229A, Chinese patent application numbers 200780045274.0, open day on October 7th, 2009), tripchlorolide, T 4 (CN101332200A, Chinese patent application numbers 200810071485.8, on December 31st, open day) wait and can prevent and treat the brain inflammation relevant disease by suppressing the microglia activation.
Existing bibliographical information; scutellarin has control myocardial infarction (Chinese Pharmaceutical; 2010; 19:12-13), thrombosis (unming Medical College's journal, 2006,4:1-5), anticancer (Phytomedicine; 2010; 17:63-68) and the liver protecting (J Asian Nat Prod Res, 2010, function such as 12:175-184).Yet scutellarin is at the neurotoxicity that suppresses the microglia mediation, and prevents and treats aspects such as parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease and yet there are no report.
In sum, the abnormal activation of microglia is the main diseases therefore that causes nerve injury in the disease pathology evolutions such as parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease, suppress the overactivity of microglia, can effectively prevent and treat above-mentioned brain inflammatory relevant disease.And seek new clinical treatment method, to treat and/or prevent the nerve immunity diseases associated with inflammation, especially treat and/or prevent the nerve immunity diseases associated with inflammation relevant with microglia, for example treat and/or prevent nerve immunity diseases associated with inflammation such as parkinson disease that the neurotoxic effect of microglia mediation causes, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease, be still those skilled in the art's expectation.
Summary of the invention
The present invention seeks to the method that provides the disease that treats and/or prevents microglia mediation for clinical, especially treat and/or prevent the method for the caused nerve immunity inflammatory diseases of neurotoxic effect of microglia mediation, for example treat and/or prevent the method for nerve immunity inflammatory diseasess such as for example parkinson disease, multiple sclerosis and/or Huntington's disease that the neurotoxic effect of microglia mediation causes, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease.The inventor is surprisingly found out that scutellarin has the effect of desirable to microglia.The present invention is based on above-mentioned discovery and be accomplished.
Summary of the invention:
First aspect present invention provides scutellarin to treat and/or prevent purposes in the medicine of disease of microglia mediation in preparation.
Second aspect present invention provides a kind of pharmaceutical composition that is used for the treatment of and/or prevents the disease of microglia mediation, wherein comprise scutellarin that prevents and/or treats effective dose or the plant extract that comprises scutellarin, and optional pharmaceutically acceptable carrier.
Third aspect present invention provides a kind of method that treats and/or prevents the disease of microglia mediation in the experimenter who needs is arranged, and this method comprises to described experimenter to be used the scutellarin of effective dose or comprise the plant extract of scutellarin.
Fourth aspect present invention provides the scutellarin that is used for the treatment of and/or prevents the disease of microglia mediation.
Detailed Description Of The Invention:
First aspect present invention provides scutellarin to treat and/or prevent purposes in the medicine of disease of microglia mediation in preparation.
First aspect present invention also provides scutellarin to treat and/or prevent purposes in the medicine of neurotoxic effect caused nerve immunity inflammatory diseases of microglia mediation in preparation.
First aspect present invention also provides scutellarin to treat and/or prevent purposes in the medicine that is selected from following disease in preparation: parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease etc.
According to each purposes of first aspect present invention, the disease of wherein said microglia mediation is the caused nerve immunity inflammatory diseases of neurotoxic effect of microglia mediation.
According to each purposes of first aspect present invention, the disease of wherein said microglia mediation is selected from: parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease etc.
According to each purposes of first aspect present invention, the caused nerve immunity inflammatory diseases of neurotoxic effect of wherein said microglia mediation is selected from: parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease etc.
According to each purposes of first aspect present invention, wherein said medicine gives the experimenter (mammal for example, as the people) dosage every day count 0.01～100mg/kg body weight with scutellarin, be preferably 0.01～75mg/kg body weight, 0.01～50mg/kg body weight, 0.02～20mg/kg body weight, 0.02～10mg/kg body weight, 0.02～5mg/kg body weight, 0.02～2.5mg/kg body weight, 0.02～1mg/kg body weight or 0.02～0.5mg/kg body weight.
According to each purposes of first aspect present invention, wherein said scutellarin is to provide with the monomeric form of scutellarin.
According to each purposes of first aspect present invention, wherein said scutellarin is that the form with the plant extract that comprises scutellarin provides.In one embodiment, described plant is selected from: the leaf of high Radix Scutellariae (Scutellaria altissima L.), stem, the leaf of Radix Scutellariae (S.baicalensis Georgi), and Herba Scutellariae Barbatae (S.Barbara D.Don) herb.In one embodiment, comprise the above scutellarin of 30% (w/w) in the described plant extract, preferably comprise the scutellarin that 40% (w/w) is above, 50% (w/w) is above, 60% (w/w) is above, 70% (w/w) is above, 80% (w/w) is above, 90% (w/w) is above or 95% (w/w) is above.
Second aspect present invention provides a kind of pharmaceutical composition that is used for the treatment of and/or prevents the disease of microglia mediation, wherein comprise scutellarin that prevents and/or treats effective dose or the plant extract that comprises scutellarin, and optional pharmaceutically acceptable carrier.
According to each pharmaceutical composition of second aspect present invention, wherein said plant is selected from: the leaf of high Radix Scutellariae (Scutellaria altissima L.), stem, the leaf of Radix Scutellariae (S.baicalensis Georgi), and Herba Scutellariae Barbatae (S.Barbara D.Don) herb.
According to each pharmaceutical composition of second aspect present invention, comprise the above scutellarin of 30% (w/w) in the wherein said plant extract, preferably comprise the scutellarin that 40% (w/w) is above, 50% (w/w) is above, 60% (w/w) is above, 70% (w/w) is above, 80% (w/w) is above, 90% (w/w) is above or 95% (w/w) is above.
According to each pharmaceutical composition of second aspect present invention, it is a dosage form.
According to each pharmaceutical composition of second aspect present invention, it is to be selected from following dosage form: tablet, capsule, soft capsule, pill, granule, injection (comprising injection with small volume and high-capacity injection) etc.
According to each pharmaceutical composition of second aspect present invention, it is the dosage form of unit dose.In one embodiment, the scutellarin that comprises 0.001mg～5000mg in the dosage form of this unit dose; The scutellarin that perhaps comprises arbitrary subrange in the scope of 0.001mg～5000mg; The scutellarin that preferably comprises 0.01mg～2500mg, 0.01mg～1000mg, 0.1mg～500mg or 0.1mg～500mg.
According to each pharmaceutical composition of second aspect present invention, wherein said pharmaceutical composition gives the experimenter (mammal for example, as the people) dosage every day count 0.01～100mg/kg body weight with scutellarin, be preferably 0.01～75mg/kg body weight, 0.01～50mg/kg body weight, 0.02～20mg/kg body weight, 0.02～10mg/kg body weight, 0.02～5mg/kg body weight, 0.02～2.5mg/kg body weight, 0.02～1mg/kg body weight or 0.02～0.5mg/kg body weight.
According to each pharmaceutical composition of second aspect present invention, the disease of wherein said microglia mediation is the caused nerve immunity inflammatory diseases of neurotoxic effect of microglia mediation.
According to each pharmaceutical composition of second aspect present invention, the caused nerve immunity inflammatory diseases of neurotoxic effect of wherein said microglia mediation is selected from: parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease etc.
Third aspect present invention provides a kind of method that treats and/or prevents the disease of microglia mediation in the experimenter who needs is arranged, and this method comprises to described experimenter to be used the scutellarin of effective dose or comprise the plant extract of scutellarin.
According to each method of third aspect present invention, the disease of wherein said microglia mediation is the caused nerve immunity inflammatory diseases of neurotoxic effect of microglia mediation.
According to each method of third aspect present invention, the caused nerve immunity inflammatory diseases of neurotoxic effect of wherein said microglia mediation is selected from: parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease etc.
According to each method of third aspect present invention, wherein give the experimenter (mammal for example, as the people) dosage every day count 0.01～100mg/kg body weight with scutellarin, be preferably 0.01～75mg/kg body weight, 0.01～50mg/kg body weight, 0.02～20mg/kg body weight, 0.02～10mg/kg body weight, 0.02～5mg/kg body weight, 0.02～2.5mg/kg body weight, 0.02～1mg/kg body weight or 0.02～0.5mg/kg body weight.
According to each method of third aspect present invention, wherein said plant is selected from: the leaf of high Radix Scutellariae (Scutellaria altissima L.), stem, the leaf of Radix Scutellariae (S.baicalensis Georgi), and Herba Scutellariae Barbatae (S.Barbara D.Don) herb.
According to each method of third aspect present invention, comprise the above scutellarin of 30% (w/w) in the wherein said plant extract, preferably comprise the scutellarin that 40% (w/w) is above, 50% (w/w) is above, 60% (w/w) is above, 70% (w/w) is above, 80% (w/w) is above, 90% (w/w) is above or 95% (w/w) is above.
Fourth aspect present invention provides the scutellarin that is used for the treatment of and/or prevents the disease of microglia mediation.
The feature that each had of either side of the present invention or this either side is suitable for each of other either side or this other either side equally, as long as they can be not conflicting, certainly at where applicable each other, necessary words can be done suitably to modify to individual features.In the present invention, when for example, mentioning " first aspect present invention each ", should " each " be meant the arbitrary sub-aspect of first aspect present invention; When others are mentioned in a similar manner, also has identical meanings.
Be further described with characteristics to various aspects of the present invention below.
All documents that the present invention quoted from, their full content is incorporated this paper by reference into, and if the expressed implication of these documents and the present invention when inconsistent, be as the criterion with statement of the present invention.In addition, various terms and phrase that the present invention uses have the general sense of well known to a person skilled in the art, nonetheless, the present invention still wishes at this more detailed description and interpretation to be made in these terms and phrase, term of mentioning and phrase are as the criterion with the implication that the present invention was explained if any inconsistent with known implication.
According to the present invention, scutellarin (Scutellarin, 7-(beta-D-Glucopyranuronosylo xy)-5,6-dihydroxy-2-(4-hydroxyphenyl)-4H-1-benzopyran-4-one, molecular formula: C
21H
18O
12, molecular weight: 462.37, the CAS registration number: 27740-01-8), it has the structural formula as shown in the formula I:
Formula I
The plant origin of scutellarin includes but not limited to the leaf of the high Radix Scutellariae of labiate (Scutellaria altissima L.), stem, leaf and Herba Scutellariae Barbatae (S.Barbara D.Don) herb of Radix Scutellariae (S.baicalensis Georgi) etc.
As described herein, term " effective dose " is meant the purpose dosage that can realize preventing and/or treating disease of the present invention in the experimenter.Those skilled in the art can easily determine the using dosage of scutellarin according to the context of the invention.Especially, this is according to the present invention, and term " effective dose " can be understood as the scutellarin form of the plant extract that comprises scutellarin (perhaps with) with reasonable effect/risk of being applicable to any therapeutic treatment q.s than the treatment obstacle.But the total consumption per day that it should be understood that scutellarin of the present invention or its compositions can maked decision in the medical judgment scope reliably by those skilled in the art.For any concrete experimenter, the concrete horizontal fibrous root of prevention effective dose is decided according to multiple factor, and described factor comprises experimenter's age, body weight, general health situation, sex and diet; The concrete compositions that is adopted; Other therapeutic active substance that is used in combination or uses simultaneously with scutellarin; And the known similar factor of medical field.
As described herein, term " pharmaceutical composition ", it can exchange with " compositions " and use, and wherein comprises active component scutellarin and optional pharmaceutically acceptable carrier or excipient.
As described herein, term " experimenter ", also can refer to " patient ", take this scutellarin " user " etc., the compositions that can finger is subjected to scutellarin of the present invention or comprises scutellarin is to prevent and/or treat the animal of disease of the present invention, particularly mammal, for example people, Canis familiaris L., monkey, cattle, horse etc.
This is according to the present invention, and term " dosage form " also is called " dosage form ", " medicament ", " pharmaceutical preparation " etc.This is according to the present invention, and term " dosage form of unit dose " also is called " unit dosage form ", for example, is meant single tablet, single capsule etc., and this unit dosage form can provide for example 1/3,1/2,1 or 2 daily dose.For example for tablet, can contain the daily dose of one day usefulness in its a slice, this kind situation is preferred; In addition, the daily dose that can also contain 2 days usefulness in tablet, its can be for example in the middle of tablet standardized indentation so that user with this tablet in two, can use a slice in one day for the heavier person of body weight to the drug resistance person, and be that effective user can use half sheet every day for half tablet amounts.
As described herein, " % (w/w) " is meant the percentage ratio of weight by weight.
As described herein, term " plant extract " or be called " extract " as not indicating in addition, is meant by " extract " that comprise scutellarin such as but not limited to plant extract described herein.It will be appreciated by those skilled in the art that scutellarin of the present invention can be chemosynthesis, can also on derive from the plant extract as described herein of plant.In addition, people are well known by persons skilled in the art from the plant extract that the plant extract acquisition comprises scutellarin, and it also is well known by persons skilled in the art adopting chemical synthesis process to obtain scutellarin.It is to be noted, the plant extract that comprises the above scutellarin of 30% (w/w), comprise particularly that 40% (w/w) is above, 50% (w/w) above, 60% (w/w) is above, 70% (w/w) is above, 80% (w/w) is above, 90% (w/w) is above or the plant extract of the scutellarin that 95% (w/w) is above, it is realizing being equivalent to scutellarin aspect the object of the invention, for example purity is greater than the scutellarin of 98% (w/w), as long as dosage is torn open and is counted as equivalent.Therefore, according to the present invention, when mentioning " scutellarin ", it is desired expectation and shows the plant extract that comprises various purity scutellarins, specifically derive from plant extract and still derive from chemosynthesis and need not clear and definite its, also need not clear and definite its and specifically derive from and extract voluntarily or the synthetic commercial sources that still derives from.In the present invention, particularly in specific embodiment of the invention part, when mentioning scutellarin, as not indicating in addition, be meant the scutellarin of purity greater than 98% (w/w), it derives from commercial sources.
The invention provides the pharmaceutical composition that comprises with one or more nontoxic pharmaceutically acceptable carriers scutellarin formulated together.Described pharmaceutical composition can be mixed with solid especially specially or liquid form is for oral administration or supply rectally, perhaps is mixed with for drug administration by injection.
Solid dosage forms for oral administration includes but not limited to capsule, tablet, pill, powder and granule.In this type of solid dosage forms, reactive compound can be accepted excipient or carrier such as sodium citrate or dicalcium phosphate and/or following material with at least a inert medicine and mix: a) filler or extender such as starch, lactose, sucrose, glucose, mannitol and silicic acid; B) binding agent such as carboxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose and Radix Acaciae senegalis; C) wetting agent such as glycerol; D) disintegrating agent such as agar, calcium carbonate, Rhizoma Solani tuber osi or tapioca, alginic acid, some silicate and sodium carbonate; E) solution blocker such as paraffin; F) absorb accelerator such as quaternary ammonium compound; G) wetting agent such as spermol and glyceryl monostearate; H) adsorbent such as Kaolin and bentonite and i) lubricant such as Pulvis Talci, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulphate and their mixture.Under the situation of capsule, tablet and pill, also can comprise buffer agent in the described dosage form.
Liquid dosage form for oral administration comprises the acceptable Emulsion of medicine, solution, suspensoid, syrup and elixir.Liquid dosage form also can contain this area inert diluent commonly used except that containing the active ingredient beyond the region of objective existence, for example water or other solvents, solubilizing agent and emulsifying agent be ethanol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzylalcohol, benzyl benzoate, propylene glycol, 1,3 butylene glycol, dimethyl formamide, oils (particularly Oleum Gossypii semen, Oleum Arachidis hypogaeae semen, Semen Maydis oil, germ oil, olive oil, Oleum Ricini and Oleum sesami), glycerol, oxolane alcohol, Polyethylene Glycol and the fatty acid ester of sorbitan and their mixture for example.
The object of the present invention is to provide the new purposes of a kind of scutellarin, be specially the application that prevention and treatment relate to the caused brain inflammation relevant disease of neurotoxic effect of activation microglia mediation.In one embodiment, described brain immune inflammation disease is parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease.In one embodiment of the invention, provide scutellarin to treat and/or prevent purposes in the medicine of nerve immunity diseases associated with inflammation in preparation.In one embodiment of the invention, provide scutellarin to treat and/or prevent purposes in the medicine of the disease relevant with microglia in preparation.In one embodiment of the invention, provide the purposes in scutellarin treats and/or prevents brain inflammatory relevant diseases such as parkinson disease that the neurotoxic effect of microglia mediation causes, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease in preparation the medicine.In one embodiment of the invention, provide scutellarin to treat and/or prevent purposes in the medicine with microglia activation diseases associated in preparation.In one embodiment of the invention, provide the purposes of scutellarin in the medicine of preparation treatment parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease etc. and brain inflammation relevant disease.
Scutellarin of the present invention generally uses with the form of pharmaceutical composition, and this compositions contains the scutellarin and the pharmaceutically acceptable auxiliaries as active component for the treatment of effective dose.The pharmaceutical composition that contains scutellarin can be made dosage forms such as tablet, capsule, powder, granule, lozenge for clinical practice by oral, injection or mucosa delivery.The medicine of above-mentioned various dosage forms all can be according to the conventional method preparation of pharmaceutical field.
The invention provides the chemical compound scutellarin that relates to and have following function: reduce activation microglia NO, TNF α, IL-1 β, the generation of cytotoxicity inflammatory mediators such as ROS, reduce activation microglia inductivity nitricoxide synthase (iNOS), TNF α, the expression of IL-1 β mRNA, suppress the microglial activation inducing cell death, the consideration convey that suppresses activation microglia nuclear factor κ B (NF-κ B) move and DNA in conjunction with vigor, alleviate the activation microglia to neuronic damage, help to reduce the symptom of inflammation pathology neurologic impairment in the nerve immunity inflammation disease process.Thereby the control that is applied to brain immune inflammation relevant diseases such as parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease for scutellarin provides direct strong experimental basis and theoretical basis, existing very strong science and novelty have very high development and application values again.
Description of drawings
Fig. 1 a: scutellarin (Scu) is the influence that BV-2 produces inflammatory mediator (NO, TNF α and IL-1 β) level to activating the mice microglia.The scutellarin of variable concentrations (2,10,50 μ mol/L) preincubate BV-2 cell 0.5h, adding LPS (0.1 μ g/mL) then stimulates.Collecting cell culture supernatant behind the cultivation 24h, the Greiss method detects the concentration of NO, and the Elisa method detects cytokine TNF alpha, IL-1 β content.Value is represented with mean+standard deviation (mean+SD), n=6.* p＜0.01 is compared with matched group; #p＜0.05, compare with model group ##p＜0.01.
Fig. 1 b: scutellarin (Scu) is to activating the influence that rat microglia of former generation produces inflammatory mediator (NO, TNF α) level.The scutellarin of variable concentrations (Scu, 2,10,50 μ mol/L) preincubate microglia 0.5h of former generation, adding LPS (0.1 μ g/mL) then stimulates.Collecting cell culture supernatant behind cultivation 8,12,16,20, the 24h, the Greiss method detects the concentration of NO, and the Elisa method detects the cytokine TNF alpha content.Value is represented with mean+standard deviation (mean+SD), n=6.* p＜0.01 is compared with matched group; Compare with model group ##p＜0.01.
Fig. 2: the influence that scutellarin (Scu) is expressed microglia iNOS, TNF α, IL-1 β mRNA.The mice microglia is BV-2 (a) and former generation rat microglia (b), adds scutellarin (50 μ mol/L) preincubate 0.5h, and adding LPS (0.1 μ g/mL) then stimulates 8h.Wash 1 time with PBS, extract cell total rna with Trizol reagent.Adopting TaqMan Reverse Transcription Reagents test kit is cDNA (10 μ l system) with total RNA (0.2 μ g) reverse transcription.Get the template of the cDNA product of 0.5 μ l as quantitative pcr amplification.House-keeping gene GAPDH is as confidential reference items.The data 2
-Δ Δ CTThe relative quantification method is analyzed.Value is represented with mean+standard deviation (mean+SD), n=3.* p＜0.01 is compared with matched group; #p＜0.05, compare with model group ##p＜0.01.
Fig. 3: scutellarin (Scu) is to the influence of microglia ROS.BV-2 cell kind is in 48 orifice plates or 24 holes (containing coverslip).Behind LPS and/or the scutellarin treatments B V-2 cell 4h, supernatant discarded is used the PBS washed cell.Every hole adds the DMEM culture medium that contains DCFH-DA (10 μ molL-1) probe and continues to cultivate 30min.Supernatant discarded does not enter the probe of cell with the PBS flush away, and every Kong Zhongzai adds 200 μ L PBS, reads fluorescent value (a) on microplate reader, or adopts laser confocal scanning microscope to observe (b).Excitation wavelength 488nm, emission wavelength 535nm.Value is represented with mean+standard deviation (mean+SD), n=6.* p＜0.01 is compared with matched group; #p＜0.05, compare with model group ##p＜0.01.Scale=100 μ m.
Fig. 4: scutellarin (Scu) is to the influence of microglial activation inducing cell death (AICD).The BV-2 cell adds scutellarin (2,10,50 μ mol/L) preincubate 0.5h, and adding LPS (0.1 μ g/mL) then stimulates.After cultivating 24h, abandon supernatant, add MTT (0.5g/L, PBS preparation), continue to hatch 4h, supernatant discarded, every hole adds 400 μ L DMSO, and concussion 10min measures absorbance in 570nm wavelength place.Value is represented with mean+standard deviation (mean+SD), n=6.* p＜0.01 is compared with matched group; Compare with model group ##p＜0.01.
Fig. 5 a: the influence that scutellarin (Scu) moves microglia NF-κ B consideration convey.The BV-2 cell inoculation adds scutellarin (50 μ mol/L) preincubate 0.5h in 24 well culture plates (containing coverslip), adding LPS (0.1 μ g/mL) then stimulates 45min.Absorb culture fluid in the hole, PBS washing 2 times.Add fixedly 15min of 4% paraformaldehyde, PBS washing 3 times, each 5min.Add 5% bovine serum albumin, room temperature sealing 1h.Add rabbit anti-NF-κ b p65 antibody (1: 100), 4 ℃ of overnight incubation.PBS washing 3 times, each 5min., the anti-rabbit igg of donkey of adding FITC labelling, incubated at room 1h.PBS washing 2 times, each 5min.Add nucleus dyeing liquid (DAPI), room temperature dyeing 5min.PBS washing 3 times, each 3min drips an amount of anti-fluorescent quenching mounting liquid, and laser scanning co-focusing microscope is observed down.The result shows that matched group p65 subunit mainly is distributed in cytoplasmic domain, and LPS group p65 enters nuclear area in a large number, and after scutellarin was handled, p65 obviously reduced in the endochylema, illustrates that scutellarin has moved remarkable inhibitory action to NF-κ B consideration convey.Scale=20 μ m.
Fig. 5 b: scutellarin (Scu) is to the influence of microglia NF-κ B dna binding activity.Scutellarin (50 μ mol/L) preincubate BV-2 cell 0.5h, adding LPS (0.1 μ g/mL) then stimulates 1h.Discard culture fluid, PBS washing 2 times.Adopt test kit to extract nucleoprotein.Get 10ug nucleoprotein, adopt test kit to detect DNA in conjunction with vigor.Value is represented with mean+standard deviation (mean+SD), n=3.* p＜0.01 is compared with matched group; Compare with model group #p＜0.05.
Fig. 6: the microglia conditioned medium that scutellarin (Scu) is handled is to the influence of neuronal cell vigor.The BV-2 cell inoculation adds scutellarin (50 μ mol/L) preincubate 0.5h in 48 well culture plates, adding LPS (0.1 μ g/mL) then stimulates.After cultivating 3h, DMEM culture medium washing 3 times after the adding fresh culture continues to hatch 16h, is got the centrifugal microglia conditioned medium that makes of supernatant.This conditioned medium added to cultivate to have in neuronic 96 orifice plates hatch 24h, abandon supernatant, add MTT (0.5g/L, PBS preparation), continue to hatch 4h, supernatant discarded, every hole adds 100 μ L DMSO, and concussion 10min measures absorbance in 570nm wavelength place.Value is represented with mean+standard deviation (mean+SD), n=3.* p＜0.01 is compared with matched group; Compare with model group ##p＜0.01.
The specific embodiment
Further specify the present invention below by specific embodiment/experimental example, still, should be understood to, these embodiment and experimental example are only used for the more detailed usefulness that specifically describes, and are used for limiting in any form the present invention and should not be construed as.
The present invention carries out generality and/or concrete description to the material and the test method that are used in the test.Though for realizing that employed many materials of the object of the invention and operational approach are well known in the art, the present invention still does to describe in detail as far as possible at this.It will be apparent to those skilled in the art that hereinafter, if do not specify that material therefor of the present invention and operational approach are well known in the art.
Embodiment 1: scutellarin is to the influence of microglia secretion inflammatory mediator
DMEM culture medium (containing 10% hyclone, 100U/mL penicillin and 100 μ g/mL streptomycins) cultivation mice microglia is BV-2 and former rat microglia of being commissioned to train foster fully.Adjusting cell concentration is 1 * 10
5/ mL is inoculated in 48 well culture plates and spends the night, and adds scutellarin (final concentration is 2,10,50 μ mol/L) the preincubate 0.5h of variable concentrations, and adding endotoxin (LPS, final concentration 0.1 μ g/mL) then stimulates.The experiment grouping: normal control group, LPS group and scutellarin add the LPS group.Cell adds cultivates 24h (or 8,12,16,20,24h) behind the LPS, collects each processed group cell culture supernatant, detects the concentration of NO with the Greiss method, and the Elisa method detects cytokine TNF alpha, IL-1 β content.Operating procedure is pressed test kit description (R﹠amp; D Systems company) finishes.
The result: under normal circumstances NO, TNF α and IL-1 β content are extremely low in the microglia BV-2 culture supernatant, and after stimulating with 0.1 μ g/mL LPS, the content of TNF-α and IL-1 β all extremely significantly increases.And the scutellarin intervention can obviously suppress NO, TNF α that LPS causes and the release of IL-1 β, and is dose dependent in 2-50 μ mol/L concentration range, sees accompanying drawing 1a.
The result who obtains on former generation microglia is similar to Fig. 1 a, and scutellarin can obviously suppress the release of the NO that LPS causes 16,20, during 24h, and is dose dependent.The inductive TNF-α of LPS also can be suppressed by scutellarin, and dose-effect relationship is good, sees accompanying drawing 1b.
Embodiment 2: scutellarin is expressed microglia iNOS, TNF α, IL-1 β mRNA
Influence
The mice microglia be BV-2 and former generation the rat microglia, plant in 12 well culture plates and spend the night, add scutellarin (50 μ mol/L) preincubate 0.5h, adding LPS (0.1 μ g/mL) then stimulates 8h.Wash 1 time with PBS, extract cell total rna with Trizol reagent.Sample thief carries out the ultraviolet detection that wavelength is 260nm and 280nm, and the purity of analyzing total RNA is also carried out quantitatively.Adopting TaqMan Reverse Transcription Reagents test kit (Applied Biosystems company) and oligod (T) 16 primers is cDNA (10 μ l system) with total RNA (0.2 μ g) reverse transcription.0.5 the cDNA product of μ l is as the template of quantitative pcr amplification.Pcr amplification reaction adopts SYBR Green PCR Master Mix reagent kits test kit (Applied Biosystems company) and corresponding special primer:
Mice-GAPDH
Forward: CTTCACCACCATGGAGAAGGC,
Oppositely: GGCATGGACTGTGGTCATGAG;
Mice-iNOS
Forward: GGCAGCCTGTGAGACCTTTG,
Oppositely: GCATTGGAAGTGAAGCGTTTC;
Mice-TNF-α
Forward: CGGGGTGATCGGTCCCCAAAG,
Oppositely: GGAGGGCGTTGGCGCGCTGG;
Mice-IL-1 β
Forward: CGCAGCAGCACATCAACAAGAGC,
Oppositely: TGTCCTCATCCTGGAAGGTCCACG;
Rat-GAPDH
Forward: CCCCCAATGTATCCGTTGTG,
Oppositely: TAGCCCAGGATGCCCTTTAGT;
Rat-iNOS
Forward: GACATCGACCAGAAGCTGTC,
Oppositely: GGGCTCTGTTGAGGTCTAAAG;
Rat-TNFa
Forward: GCTCCCTCTCATCAGTTCCA,
Oppositely: TTGGTGGTTTGCTACGACG;
Rat-IL1 β
Forward: GCTAGTGTG TGATGTTCCCATTAG,
Oppositely: CTTTTCCATCTTCTTCTTTGGGTA.
House-keeping gene GAPDH is as confidential reference items.The data 2
-Δ Δ CTThe relative quantification method is analyzed.
The result as shown in Figure 2, LPS can increase the expression of BV-2 and former generation rat microglia iNOS, TNF α, IL-1 β mRNA significantly, and scutellarin has significantly reduced the inductive iNOS of LPS, TNF α, IL-1 β mRNA expresses.
Embodiment 3: scutellarin is to the influence of microglia ROS
Adopt the fluorescent probe of DCFH-DA, the influence that the research scutellarin discharges mice BV-2 cell ROS as ROS level in the indicator cells.Itself does not fluoresce DCFH-DA, enter cell after, sent fluorescence after the intracellular ROS oxidation, thus indicator cells in the ROS level.BV-2 cell kind is in 48 orifice plates or 24 holes (containing coverslip).Behind LPS and/or the scutellarin treatments B V-2 cell 4h, supernatant discarded is used the PBS washed cell.Every hole adds the DMEM culture medium that contains DCFH-DA (10 μ molL-1) probe and continues to cultivate 30min.Supernatant discarded does not enter the probe of cell with the PBS flush away, and every Kong Zhongzai adds 200 μ L PBS, reads fluorescent value on microplate reader, or adopts laser confocal scanning microscope to take a picture excitation wavelength 488nm, emission wavelength 535nm.
Fig. 3 a result shows that LPS significantly induces ROS level in the BV-2 cell.Scutellarin can suppress the generation of ROS, and along with the increasing of scutellarin concentration, its inhibitory action to ROS level in the BV-2 cell strengthens gradually.Laser confocal microscope has confirmed this point (Fig. 3 b) more clearly.
Embodiment 4: scutellarin is to the influence of microglial activation inducing cell death (AICD)
The BV-2 cell adds scutellarin (2,10,50 μ mol/L) preincubate 0.5h, and adding LPS (0.1 μ g/mL) then stimulates.After cultivating 24h, abandon supernatant, add MTT (0.5gL-1, PBS preparation), continue to hatch 4h, supernatant discarded, every hole adds 400 μ L DMSO, and concussion 10min measures absorbance in 570nm wavelength place.
Fig. 4 result shows that LPS can cause the activation-inducing cell death, significantly reduces the BV-2 cell viability.Scutellarin can suppress the activation-inducing cell death that LPS causes, and is dose-dependence.
Embodiment 5: the influence that scutellarin moves microglia NF-κ B consideration convey
Cultivate the mice microglia and be BV-2 and former generation the rat microglia, adjusting cell concentration is 1 * 10
5/ mL is inoculated in 24 well culture plates (containing coverslip), and the back of spending the night adds scutellarin (50 μ mol/L) preincubate 0.5h, and adding LPS (0.1 μ g/mL) then stimulates 45min.Absorb culture fluid in the hole, PBS washing 2 times.Add fixedly 15min of 4% paraformaldehyde, PBS washing 3 times, each 5min.Add 5% bovine serum albumin, room temperature sealing 1h.Add rabbit anti-NF-κ b p65 antibody (1: 100), 4 ℃ of overnight incubation.PBS washing 3 times, each 5min., the anti-rabbit igg of donkey of adding FITC labelling, incubated at room 1h.PBS washing 2 times, each 5min.Add nucleus dyeing liquid (DAPI), room temperature dyeing 5min.PBS washing 3 times, each 3min drips an amount of anti-fluorescent quenching mounting liquid, and laser scanning co-focusing microscope is observed down.
The laser confocal microscope result shows that (Fig. 5 a), matched group p65 subunit mainly is distributed in cytoplasmic domain, and the nuclear district loses, and prompting NF-κ B mainly remains static; LPS group p65 enters nuclear area in a large number, and prompting NF-κ B consideration convey occurs and moves, and is state of activation.After scutellarin was handled, p65 obviously reduced in the nuclear district, illustrates that scutellarin has moved remarkable inhibitory action to NF-κ B consideration convey.
Embodiment 6: scutellarin is to the bonded influence of microglia NF-κ B DNA
Scutellarin (50 μ mol/L) preincubate BV-2 cell 0.5h, adding LPS (0.1 μ g/mL) then stimulates 1h.Discard culture fluid, PBS washing 2 times.Adopt Nuclear Extraction kit test kit (Millipore company) to extract nucleoprotein.Get 10 μ g nucleoprotein, adopt NF-κ B p65EZ-TFA transcription factor test kit (Millipore company) to detect DNA in conjunction with vigor, method is according to the test kit description.
Fig. 5 b result shows that LPS can activate BV-2 cell NFkB dna binding activity, and scutellarin is handled and then significantly suppressed its dna binding activity, and this and Fig. 5 a result match.
Embodiment 7: the microglia conditioned medium that scutellarin is handled is to the neuronal cell vigor
Influence
The BV-2 cell is inoculated in 48 well culture plates by 1 * 105/mL, and the back of spending the night adds scutellarin (50 μ mol/L) preincubate 0.5h, and adding LPS (0.1 μ g/mL) then stimulates.After cultivating 3h, DMEM culture medium washing 3 times after the adding fresh culture continues to hatch 16h, is got the centrifugal microglia conditioned medium that makes of supernatant.This conditioned medium added to cultivate to have in neuronic 96 orifice plates hatch 24h, abandon supernatant, add MTT (0.5gL-1, PBS preparation), continue to hatch 4h, supernatant discarded, every hole adds 100 μ L DMSO, and concussion 10min measures absorbance in 570nm wavelength place.
Fig. 6 result shows that the conditioned medium that derives from LPS activation microglia can significantly reduce the neurocyte vigor.And compare with LPS set condition culture medium, derive from the scutellarin group microglia conditioned medium neuronal cell vigor that can obviously raise.This explanation scutellarin can suppress to activate the neurotoxicity of microglia, suppresses the nerve cell death that neural inflammation causes.
Sequence table
＜110〉Tianjin University Of Traditional Chinese Medicine
＜120〉purposes of the disease of scutellarin treatment microglia mediation
<130>
<160>16
<170>PatentIn?version?3.5
<210>1
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mice-GAPDH forward primer
<400>1
cttcaccacc?atggagaagg?c 21
<210>2
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mice-GAPDH reverse primer
<400>2
ggcatggact?gtggtcatga?g 21
<210>3
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mice-iNOS forward primer
<400>3
ggcagcctgt?gagacctttg 20
<210>4
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mice-iNOS reverse primer
<400>4
gcattggaag?tgaagcgttt?c 21
<210>5
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mice-TNF-α forward primer
<400>5
cggggtgatc?ggtccccaaa?g 21
<210>6
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mice-TNF-α reverse primer
<400>6
ggagggcgtt?ggcgcgctgg 20
<210>7
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mice-IL-1 β forward primer
<400>7
cgcagcagca?catcaacaag?agc 23
<210>8
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mice-IL-1 β reverse primer
<400>8
tgtcctcatc?ctggaaggtc?cacg 24
<210>9
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉rat-GAPDH forward primer
<400>9
cccccaatgt?atccgttgtg 20
<210>10
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉rat-GAPDH reverse primer
<400>10
tagcccagga?tgccctttag?t 21
<210>11
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉rat-iNOS forward primer
<400>11
gacatcgacc?agaagctgtc 20
<210>12
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉rat-iNOS reverse primer
<400>12
gggctctgtt?gaggtctaaa?g 21
<210>13
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉rat-TNFa forward primer
<400>13
gctccctctc?atcagttcca 20
<210>14
<211>19
<212>DNA
＜213〉artificial sequence
<220>
＜223〉rat-TNFa reverse primer
<400>14
ttggtggttt?gctacgacg 19
<210>15
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉rat-IL1 β forward primer
<400>15
gctagtgtgt?gatgttccca?ttag 24
<210>16
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉rat-IL1 β reverse primer
<400>16
cttttccatc?ttcttctttg?ggta 24
Claims (10)
1. scutellarin treats and/or prevents purposes in the medicine of disease of microglia mediation in preparation.
2. scutellarin treats and/or prevents purposes in the medicine of the caused nerve immunity inflammatory diseases of neurotoxic effect of microglia mediation in preparation.
3. scutellarin treats and/or prevents purposes in the medicine that is selected from following disease in preparation: parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease etc.
4. according to each purposes of claim 1-3, wherein said medicine gives experimenter's's (for example mammal, as the people) dosage every day and counts 0.01～100mg/kg body weight with scutellarin.
5. according to each purposes of claim 1-3, wherein said scutellarin is to provide with the monomeric form of scutellarin, or provides with the form of the plant extract that comprises scutellarin.
6. according to the purposes of claim 5, wherein said plant is selected from: the leaf of high Radix Scutellariae (Scutellariaaltissima L.), stem, the leaf of Radix Scutellariae (S.baicalensis Georgi), and Herba Scutellariae Barbatae (S.Barbara D.Don) herb.
7. according to the purposes of claim 5, comprise the above scutellarin of 30% (w/w) in the wherein said plant extract.
8. be used for the treatment of and/or prevent the pharmaceutical composition of the disease of microglia mediation, wherein comprise scutellarin that prevents and/or treats effective dose or the plant extract that comprises scutellarin, and optional pharmaceutically acceptable carrier.
9. pharmaceutical composition according to Claim 8, it is the dosage form of unit dose, comprises the scutellarin of 0.001mg～5000mg in the dosage form of this unit dose.
10. pharmaceutical composition according to Claim 8, the disease of wherein said microglia mediation is the caused nerve immunity inflammatory diseases of neurotoxic effect of microglia mediation, and the disease of perhaps wherein said microglia mediation is selected from: parkinson disease, multiple sclerosis, Huntington's disease, encephalitis, ancient character used in proper names and in rendering some foreign names thunder disease etc.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010522879 CN102000101A (en) | 2010-10-28 | 2010-10-28 | Application of scutellarin to treatment of microglia-mediated diseases |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010522879 CN102000101A (en) | 2010-10-28 | 2010-10-28 | Application of scutellarin to treatment of microglia-mediated diseases |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102000101A true CN102000101A (en) | 2011-04-06 |
Family
ID=43807969
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010522879 Pending CN102000101A (en) | 2010-10-28 | 2010-10-28 | Application of scutellarin to treatment of microglia-mediated diseases |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102000101A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102755312A (en) * | 2012-07-16 | 2012-10-31 | 中国科学院大连化学物理研究所 | Application of compound with flavone skeleton structure as Parkinsonism treating medicine |
| CN107648248A (en) * | 2017-09-18 | 2018-02-02 | 暨南大学 | Lamp-dish flower acetic is preparing the application in treating NLRP3 relevant disease medicines |
| CN109908166A (en) * | 2019-04-30 | 2019-06-21 | 青岛大学附属医院 | Application of the scutellarin in preparation prevention/protection ischemia-reperfusion injury of kidney drug/pharmaceutical composition |
| CN109953996A (en) * | 2019-03-05 | 2019-07-02 | 澳门大学 | Application, drug and regulator of the scutellarin in the drug and regulator for preventing or treating disease |
| CN113069535A (en) * | 2021-04-12 | 2021-07-06 | 上海优祺生物医药科技有限公司 | Application of chemotactic factor Fractalkine in preparation of medicine for treating neuroinflammation |
| CN113398139A (en) * | 2021-07-01 | 2021-09-17 | 山东大学齐鲁医院 | Application of scutellarin in preparing medicine and health food for treating spine aging diseases |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1383818A (en) * | 2002-01-05 | 2002-12-11 | 承德医学院中药研究所 | Application of skullcap stem and leaf general flavone and wild baicalin in preparing dementia resisting medicine |
| CN101220065A (en) * | 2008-01-24 | 2008-07-16 | 沈阳药科大学 | Novel scutellarin compounds and uses thereof |
| CN101337956A (en) * | 2008-08-22 | 2009-01-07 | 四川大学 | Scutellarein carbamate derivates, preparation method and application thereof |
| CN101845034A (en) * | 2010-06-11 | 2010-09-29 | 贵阳医学院 | Preparation and application method of scutellarin |
-
2010
- 2010-10-28 CN CN 201010522879 patent/CN102000101A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1383818A (en) * | 2002-01-05 | 2002-12-11 | 承德医学院中药研究所 | Application of skullcap stem and leaf general flavone and wild baicalin in preparing dementia resisting medicine |
| CN101220065A (en) * | 2008-01-24 | 2008-07-16 | 沈阳药科大学 | Novel scutellarin compounds and uses thereof |
| CN101337956A (en) * | 2008-08-22 | 2009-01-07 | 四川大学 | Scutellarein carbamate derivates, preparation method and application thereof |
| CN101845034A (en) * | 2010-06-11 | 2010-09-29 | 贵阳医学院 | Preparation and application method of scutellarin |
Non-Patent Citations (3)
| Title |
|---|
| 《中国博士学位论文全文数据库(电子期刊)医药卫生科技辑》 20080415 陶云海 gamma-氨基丁酸(GABA)代谢酶抑制剂的研究 第69页、第73页 1-7，10 , 2 * |
| 《时珍国医国药》 20100731 高燕 等 黄芩素药理学研究新进展 全文 1-10 第21卷, 第7期 2 * |
| 《第十届全国心血管药理学术会议暨2010(重庆)国际心血管疾病与药物高峰论坛论文集》 20101025 毛峻琴 等 灯盏花中四种单体成分对LPS刺激BV-2细胞产生细胞因子的影响 第164页 1-7 , 2 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102755312A (en) * | 2012-07-16 | 2012-10-31 | 中国科学院大连化学物理研究所 | Application of compound with flavone skeleton structure as Parkinsonism treating medicine |
| CN107648248A (en) * | 2017-09-18 | 2018-02-02 | 暨南大学 | Lamp-dish flower acetic is preparing the application in treating NLRP3 relevant disease medicines |
| CN109953996A (en) * | 2019-03-05 | 2019-07-02 | 澳门大学 | Application, drug and regulator of the scutellarin in the drug and regulator for preventing or treating disease |
| CN109908166A (en) * | 2019-04-30 | 2019-06-21 | 青岛大学附属医院 | Application of the scutellarin in preparation prevention/protection ischemia-reperfusion injury of kidney drug/pharmaceutical composition |
| CN113069535A (en) * | 2021-04-12 | 2021-07-06 | 上海优祺生物医药科技有限公司 | Application of chemotactic factor Fractalkine in preparation of medicine for treating neuroinflammation |
| CN113398139A (en) * | 2021-07-01 | 2021-09-17 | 山东大学齐鲁医院 | Application of scutellarin in preparing medicine and health food for treating spine aging diseases |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gathirwa et al. | The in vitro anti-plasmodial and in vivo anti-malarial efficacy of combinations of some medicinal plants used traditionally for treatment of malaria by the Meru community in Kenya | |
| Kirira et al. | Anti-plasmodial activity and toxicity of extracts of plants used in traditional malaria therapy in Meru and Kilifi Districts of Kenya | |
| US11517604B2 (en) | Method for preparing Plectranthus amboinicus fraction having anti-arthritis activity | |
| US7455861B2 (en) | Angelicae sinensis extracts useful for treatment of cancers | |
| CN102000101A (en) | Application of scutellarin to treatment of microglia-mediated diseases | |
| CN101264122B (en) | Hypericum extract, its making method and medicinal composition and use for treating diabetes | |
| Kamei et al. | Anti-malarial activity of leaf-extract of Hydrangea macrophylla, a common Japanese plant | |
| CN111870568B (en) | Anti-allergy itching-relieving plant composition and preparation method and application thereof | |
| CN101791336B (en) | Extract from long pepper and preparation method and application thereof | |
| CN107737201B (en) | Application of radix tetrastigme extract in resisting virus | |
| US20070134711A1 (en) | Compositions of eleutherosides capable of modulating protein expresion | |
| CN102772393A (en) | Application of isobavachalcone in treating nerve inflammatory diseases | |
| CN102526170A (en) | Catechu extract composition for resisting tubercle bacillus, preparation method of catechu extract composition, pharmaceutical preparation containing catechu extract composition, and application of catechu extract composition | |
| Abadome et al. | Evaluation of the activity of Ambrosia maritima L. against Schistosoma mansoni infection in mice | |
| EP1395270B1 (en) | Use of phyllanthus components for preparation of a medicament for the prevention or treatment of infections caused by resistant hepatitis b virus | |
| CN108003099B (en) | Bisbenzyl tetrahydroisoquinoline compound and preparation method and application thereof | |
| CN102552236A (en) | Application of tanshinone I to treatment of microglia-mediated disease | |
| CN116747218B (en) | Patchouli alcohol and patchouli alcohol compound antimalarial composition and application thereof in preparation of antimalarial protozoon drugs | |
| JP2021505692A (en) | New pharmaceutical use of persimmon leaf extract and its preparation | |
| Ubulom et al. | In vivo antiplasmodial potential of aqueous seed extract of Ricinus communis | |
| KR101651948B1 (en) | Anti-Coronavirus Composition | |
| Ampa et al. | ANTIDIABETIC ACTIVITY AND CHEMICAL SCREENING OF THE AQUEOUS EXTRACT OF SEEDS OF STRYCHNOS CAMPTONEURA GILG & BUSSE (LOGANIACEAE) | |
| Francis et al. | Antidiabetic effect of polyherbal extract in streptozotocin induced diabetic rats | |
| Santiarworn et al. | Bioactivity screening of crude alkaloidal extracts from some rubiaceae | |
| Nkadimeng et al. | Cardioprotective Potential of the Ethanol and Water Extracts of Four Psilocybin Mushrooms on Angiotensin II-Induced Hypertrophy and Oxidative Stress on H9C2 Cardiomyocytes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20110406 |