CN101993923A - In-situ hybridization detection kit of OPN (Osteopontin) gene as well as detection method and application thereof - Google Patents

Abstract

The invention relates to an in-situ hybridization detection kit of an OPN (Osteopontin) gene, comprising a hybridization probe and a marker, wherein the sequence of the hybridization probe is shown as SEQ ID NO.1. The invention also provides an in-situ hybridization detection of the OPN gene. Moreover, the invention also provides the application of the kit in preparing drugs for detecting cancer inchoate transfer and relapsing diseases. The invention has the advantages that the kit has the characteristics of high sensitivity and strong specificity. The detection method is convenient and simple to operate and can be generally used and popularized in district-level hospitals and up.

Description

A kind of hybridization in situ detection kit of OPN gene and detection method thereof and application

[technical field]

The present invention relates to a kind of test kit, specifically about a kind of hybridization in situ detection kit and detection method and application of OPN gene

[background technology]

An annual report has been done by how tame units such as U.S. sanitary research institute in 2005, cancer research institute, Disease Control and Prevention Center, " think that the mankind are failures in anticancer Great War ", that is to say that cancer mortality does not reduce, it lists and causes the Several Factors of anticancer Great War failure to be: 1, tumour cell heterogeneity; 2, tumor cell drug resistance; 3, cancer therapy drug mentality of designing imperfection etc.Simultaneously, also propose to examine closely again the measure of existing diagnosis and treatment cancer in this report.The inventor finds that under study for action two major reasons in addition that cause cancer mortality not fallen are: 1, can not accomplish real early diagnosis; 2, the pathomechanism of Zhuan Yiing is unclear.Come diagnosing cancer according to traditional medical image and with other biochemistry (as protein marker) index, think that occupancy cancer piece is the diagnosis (littler asymptomatic sometimes sign) that belongs to early-stage cancer under 2 centimeters, this clinical concept is worth conscientiously discussing.It is rigorous inadequately that 2 centimeters early stage these of following cancer pieces genus of medical imaging define science, from the cytology angle, 1 centimeter lump has 100,000,000 tumour cells approximately, its three-dimensional cell stack number of 2 centimeters lump is far above 200,000,000 tumour cells, produce and form 2 centimeters cancer piece to the mono-clonal cancer cells early stage from canceration, its pathology evolution process is quite long, may be more than 1 year or 2 years even 3 years, what be difficult to confirm is in this process, and lump is unique spot of cancer and independent focus.Confirm clinically: in case when forming lump, other cancer cells are moved to other position clonal growths by different approaches; In case behind the excision primary tumor, other organ recurrence kitchen ranges or multiple cancer piece kitchen range successively form or shift.Therefore, whether define in early days rigorous inadequately (some case clinically with the lump size below 2 centimeters, when finding primary lesion, find metastatic lesion simultaneously, not in the content of our statement), at this moment be late period, this is the true cause that causes cancer mortality not fallen.

(osteopontin OPN) is a kind of phosphorylation glycoprotein of secretion property to osteopontin, and people OPN gene is positioned at the 4q13 site.Tiniakos etc. discover that the positive expression rate of OPN in the ovarian tumor of companion's nethike embrane kind value, nodus lymphoideus transferring rate is lower.Employing immunohistochemical methodss such as Tuck and in-situ hybridization method have been studied in the primary breast cancer of lymphoglandula feminine gender osteopontin in intracellular distribution, the result shows that tumour cell osteopontin expression and survival rate are in close relations, breast cancer cell excretory osteopontin or the expression of bonded osteopontin and the height invasion and attack and the poor prognosis negative correlation of tumour from environment.Ue etc. have studied 40 routine cancer of the stomach, the expression of osteopontin is compared with normal mucous membrane tissue on every side in the 5 routine metastasis, 72.5% primary tumor, 60% nodus lymphoideus transferring rate kitchen range overexpression OPN mRNA, the increase of OPN mRNA level is relevant with the development in clinical pathology stage.Recently, national cancer institute is used the cDNA microarray technology, comparative studies 40 example companions and the variation of not accompanying 9180 gene expression profiles in the liver cancer of sending out, the osteopontin expression level significantly raises in the liver cancer that discovery is shifted in the companion liver, its antibody can shift by lung in the invasive ability of extracorporeal blocking high metastatic potential liver cancer cell and body, and prompting OPN can be used as the prognostic indicator and the potential treatment target spot of liver cancer.The OPN gene, NM_000582,1616bp, mRNA.4q21-q25 ", cds:166 ... 1068bp.

Along with molecular biotechnology is perfect day by day, functional genomics, the deep expansion of research such as cancer genomics, so far, we might do more accurate early diagnosis on gene level, just can accomplish the early prediction diagnosis in canceration early stage or cancer cells formation (during mono-clonal).It was that hybridization technique detects the prognosis that OPN expression of gene amount is diagnosed clinical all kinds of cancers originally that the present invention adopts nucleic acid, and very important clinical value is arranged.

Hybridization in situ technique (in situ hybridization) combines molecular biology and cytochemistry technology, is probe with the nucleic acid molecule of mark, in the technology of histocyte in situ detection specific nucleic acid molecule.Its principle is to make the nucleic acid strand (being probe) that contains distinguished sequence, process mark, under optimum conditions with histocyte in the complementary nucleic acid strand be that target nucleic acid is hybridized, with radioautograph or immunocytochemistry label probe is surveyed again, thereby shown special DNA or RNA molecule at cell in-situ.

[summary of the invention]

The objective of the invention is provides a kind of purposes of hybridization in situ detection kit of OPN gene at deficiency of the prior art.

One purpose more of the present invention is that a kind of hybridization in situ detection kit of OPN gene is provided.

Another purpose of the present invention is that a kind of in situ hybridization detection method of OPN gene is provided.

For achieving the above object, the technical scheme taked of the present invention is:

A kind of hybridization in situ detection kit of OPN gene detects cancer in preparation and shifts, recurs application in the disease medicament in early days, and described test kit comprises hybridization probe, marker, and described hybridization probe sequence is shown in SEQ ID NO.1.

Described cancer is a liver cancer.

The RNA sequence of described hybridization probe sequence shown in SEQ ID NO.1.

Described marker is selected from radionuclide or non-radioactive marker.

Described radionuclide is selected from ³H, ³⁵S, ¹²⁵I or ³²A kind of among the P.

Described non-radioactive marker is selected from a kind of in vitamin H, digoxin, alkaline phosphatase, horseradish peroxidase or the fluorescein.

Described non-radioactive marker is preferably from digoxin.

Described test kit also comprises synergistic agent, and described synergistic agent is the alkaline phosphatase enzyme antibody.

For realizing above-mentioned second purpose, the technical scheme that the present invention takes is:

A kind of hybridization in situ detection kit of OPN gene comprises hybridization probe, marker, and wherein said hybridization probe sequence is shown in SEQ ID NO.1, and described marker is selected from radionuclide or non-radioactive marker.

For realizing above-mentioned the 3rd purpose, the technical scheme that the present invention takes is:

A kind of in situ hybridization detection method of OPN gene, this method may further comprise the steps:

A, the hybridization probe in the test kit is contacted with RNA to be measured in the substrate, form hybridization complex;

The hybridization complex that b, detection a step obtain.

The component of diagnostic kit of the present invention is by hybridization probe, hybridization solution, developer, compositions such as synergistic agent.The nucleic acid hybridization principle of this test kit is that the molecular biology insider all knows, and the concrete operations step is to carry out quantitative analysis, result's report under sample disposal, prehybridization, hybridization, immunohistochemical staining, the mirror, and wherein Za Jiao concrete steps comprise:

Instrumentation:

1). sample to be measured is put into reactive tank;

2). instrument discards liquid automatically, adds Digestive system automatically;

3). instrument discards liquid automatically, and the back is fixing automatically;

4). instrument discards liquid automatically, automatically prehybridization (42 ℃);

5). instrument discards liquid automatically, cleans automatically;

6). instrument discards liquid automatically, automatically hybridization (42 ℃);

7). instrument discards liquid automatically, cleans automatically;

8). instrument discards liquid automatically, and automatic and DIG antibody is cultivated (room temperature);

9). instrument discards liquid automatically, cleans colour developing automatically;

10). take out the mounting microscopy.

The invention has the advantages that:

1, test kit provided by the invention has characteristics highly sensitive, high specificity.

2, detection method of the present invention is convenient and simple for operation, can be widely used and promoted in Municipal Hospitals.

3, diagnostic kit of the present invention and other detection oncofetal protein mark clinically, and the medical imaging inspection has remarkable difference.The present invention can detect the OPN gene unconventionality expression on gene level, before the recurrence of occupancy carninomatosis kitchen range is not found in the medical imaging inspection, before the cancer biochemical indicator does not produce unusually, also do not form before the tumour, can accomplish the information acquisition of above abnormal gene expression early, predict for real early diagnosis of clinical cancer sufferer and treatment back transfer and relapse early.So just might implement early diagnosis, early prevention, the early treatment of cancer, might from the source, thoroughly effect a radical cure the cancer foul disease.

[description of drawings]

Fig. 1 is a hepatoma Metastasis patient OPN genetic expression picture in the embodiment of the invention.

Fig. 2 is a normal people OPN genetic expression picture in the embodiment of the invention.

[embodiment]

Below in conjunction with accompanying drawing the specific embodiment of the invention is elaborated.

Embodiment 1

A kind of hybridization in situ detection kit of OPN gene comprises hybridization probe, marker, synergistic agent, and wherein, described hybridization probe sequence is shown in SEQ ID NO.1.The hybridization probe digoxigenin labeled.Other liquid and sample in the test kit are composed as follows:

Digestive system 100 μ l/ manage 1 pipe/box colourless transparent liquid

Protection liquid 100 μ l/ pipe 1 pipe/box colourless transparent liquid

Prehybridization solution 1300 μ l/ manage 2 pipe/box colourless transparent liquids

Justice hybridization solution 10 μ l/ pipe 1 pipe/box colourless transparent liquid

Antisense hybridization solution 10 μ l/ manage 1 pipe/box colourless transparent liquid

Confining liquid 1000 μ l/ manage 1 pipe/box colourless transparent liquid

Alkaline phosphatase enzyme antibody 1 μ l/ manages 1 pipe/box colourless transparent liquid

Developer A 175 μ l/ manage 1 pipe/box yellow liquid

Developer B 320 μ l/ manage 1 pipe/box colourless transparent liquid

Light yellow or the colourless transparent liquid of damping fluid I 10x 90ml/ bottle 1 bottle/box

Light yellow or the colourless transparent liquid of damping fluid II 10x 80ml/ bottle 1 bottle/box

Light yellow or the colourless transparent liquid of damping fluid III 10x 20m/ bottle 3 bottle/boxes

Light yellow or the colourless transparent liquid of damping fluid IV 10x 90ml/ bottle 1 bottle/box

Stationary liquid 90ml/ bottle 1 bottle/box colourless transparent liquid

6/box of positive control sample

Mentioned reagent composition explanation: (all reagent are available from SIGMA)

1, Digestive system: the 20mg/ml Proteinase K, the 100mg Proteinase K adds DEPC-H ₂O 5ml;

2, the glycine of protection liquid: 0.2g adds 1 * damping fluid I of 1ml;

3, prehybridization solution: 1 * damping fluid II7.5ml

50×D?3ml

10mg/ml?yest?t-RNA?750ul

11mg/ml?SALMON?TESTES?DNA?682ul

0.04M?EDTA?3ml

50％formamide?15ml

4, the bloking of confining liquid: 0.03g (buying from Roche Holding Ag) adds 1ml 1 * damping fluid III;

5,10x damping fluid I:(PH7.1-7.4)

NaCl?80g

Na ₂HPO ₄.12H ₂O 360g

KCl 2g

KH ₂PO ₄2g

Add tri-distilled water to 1l, and autoclaving;

6,10x damping fluid II:(PH7.0)

NaCl 175.3g

Trisodium Citrate 88.2g

Several of HCl

Add tri-distilled water to 1l, and autoclaving;

7, damping fluid III:(PH7.9)

Tris 121.1g

NaCl 87.66g

About HCl 60ml

Add tri-distilled water to 1l, and autoclaving;

8, damping fluid IV:

1M Tris-HCl (PH9.5): Tirs 121.1g adds about HCl 3ml, adds water 900ml, transfers PH to 9.5, adds water to 1l, and autoclaving;

1M NaCl:NaCl 58.44 adds water to 1l, and autoclaving;

0.5M MgCl ₂: 101.65g MgCl ₂.6H ₂O adds water to 1l, and autoclaving;

9, stationary liquid: Paraformaldehyde 96 40g adds 1 * damping fluid I to 1l, and heat (about 50-60 degree) is stirred to dissolving a little;

10, developer A:NBT 1g adds 70%DMF11.44ml;

11, developer B:BCIP 1g adds 100%DMF30ml.

Test kit of the present invention can many person-portions use or person-portion use.

Embodiment 2

A kind of OPN gene hybridization in situ detection method and test kit thereof are used

One, sample disposal

1, with the centrifuge tube of 10ml, dress 4.5ml lymphocyte separation medium, again the 3ml anticoagulation is slowly added contain lymphocyte separation medium (blood: in centrifuge tube lymphocyte separation medium=1: 1.5), the centrifugal 10min of 2000r/min;

2, draw the middle layer white corpuscle to another centrifuge tube, in this pipe, add 1 * damping fluid I of about twice again, mixing, the centrifugal 10min of 1500g/min;

3, abandon supernatant. precipitation adds 1 * damping fluid I of about twice, mixing, the centrifugal 10min of 1500g/min;

4, abandon supernatant, and test tube mouth excess liquid is gone with the tissue suction.Again precipitation is made suspension, drop in push jack on the slide, seasoning.(hospital with good conditionsi can use the pelleter film-making.) 3ml blood, can do 4 slice, thin pieces;

5, with 40ml 4% stationary liquid, in glass jar, fixedly 30min uses 1 * damping fluid I to wash 5min again.Every cylinder can be put 16;

6, sample can be kept at-20 ℃, or continues to do experiment.

Two, reagent in the test kit is mixed with working concentration

1, with 10 * damping fluid I with tri-distilled water by being diluted to 1 * damping fluid I at 1: 10;

2, with 20 * damping fluid II with tri-distilled water by being diluted to 2 * damping fluid II at 1: 10;

By being diluted to 0.2 * damping fluid II at 1: 100; By being diluted to 0.1 * damping fluid II at 1: 200;

3, with 10 * damping fluid III with tri-distilled water by being diluted to 1 * damping fluid III at 1: 10;

4,10 * damping fluid IV with tri-distilled water by be diluted at 1: 10 * damping fluid IV (get 1#, 2#, each 10ml of 3#, add water to 100ml both can).

Three, experimental procedure:

1, gets two of every person's samples to be checked, two of (other two give over to check with) and positive control samples (test at every turn and do a pair of positive control);

2, in glass jar, add Digestive system (Digestive system 100ul adds 1 * damping fluid 199.9ml, is working concentration) 20ml.37 ℃ of water-bath preheatings 10 minutes.Put 16 slides into, handle 12min, use 1 * damping fluid I to wash 5min again for 37 ℃;

3, wash 10min with 0.2% protection liquid (protection liquid 1ml adds 1 * damping fluid I99ml and is working concentration), tri-distilled water is washed 5min, and above process is all carried out at glass jar.The slide seasoning;

4, slide is put into the box of preserving moisture, add prehybridization solution 20ul/ sheet. covered, the lid box of tightly preserving moisture is placed in 42 ℃ of constant water bath box more than the 3h;

5, take out slide, discard cover glass, slide is put into glass jar, with 70%, 90%, 95% ethanol is respectively washed 2min, seasoning;

6, slide is put into the box of preserving moisture, two of every patient specimens, one adds just hybridization solution 20ul/ sheet, and another adds antisense hybridization solution 20ul/ sheet, covered, the lid box of tightly preserving moisture is placed on 16-24h in 42 ℃ of constant water bath box;

7, take out slide, discard cover glass, slide is put into glass jar

In 42 ℃ of constant water bath box, wash twice, each 15min with 2 * damping fluid II

In 42 ℃ of constant water bath box, wash once each 15min with 0.2 * damping fluid II

In 42 ℃ of constant water bath box, wash twice, each 15min with 0.1 * damping fluid II;

8, wash 30s with 1 * damping fluid III, take out slide, seasoning;

9, slide is put into the box of preserving moisture, add 0.5%l confining liquid (the 1ml confining liquid adds 5ml1 * damping fluid III) 100ul/ sheet, cover the box of tightly preserving moisture, at room temperature act on 30min;

10, take out slide, wash 30s, seasoning with 1 * damping fluid I II;

11, slide is put into the box of preserving moisture, add alkaline phosphatase enzyme antibody (adding 1.8ml 1 * damping fluid III) 100ul/ sheet, cover the box of tightly preserving moisture and at room temperature act on 30min;

12, take out slide, wash 3 times, each 15min with 1 * damping fluid III;

13,1 * damping fluid IV washes 2min, adds developer (developer A73.3ul, developer B157.5ul are added among 30ml 1 * damping fluid IV, mixing), more than the room temperature lucifuge 12h;

14, wash 5min with tri-distilled water, seasoning, (add with glycerine 10% 1 * damping fluid I mixing) mounting microscopy.

Four, the result judges

100-300 cell of counting calculates the per-cent of catching the purple cell under light microscopic.

What the positive control sample added the antisense hybridization solution should catch purple more than 80%.

All add the negative internal reference of just hybridization solution should be colourless.

The cDNA of digoxigenin labeled, RNA and oligonucleotide probe, not only probe has a biotin labeling advantage, also having overcome biotin labeled probe is organized the endogenous vitamin H to do shortcomings such as sorrow in the crossover process in position), this hybridization probe and the leukocytic RNA nucleic acid to be measured of blood of human body are hybridized, method with immunohistochemical methods develops the color again, under light microscopic, observe existence and the location of mRNA,, judge the expression amount of goal gene according to painted cell count.

The inventive method is a nucleic acid hybridization in situ technology at present commonly used, and this method is by detecting the OPN gene expression amount in the substrate cell, is used for determining whether cancer takes place and/or shift.

Clinical study shows that the OPN gene has broad spectrum, because the OPN gene is expressed low in the normal people or zero expression.If the OPN gene high expression illustrates that cancer recurs, shifts, spreads, thus the diagnostic message of acquisition cancer.When detecting the OPN expression of gene and be higher than normal control, to be that cancer is early stage shift or the cancer metastasis susceptible person then measurable experimenter, and these cancers comprise liver cancer.

The embodiment of the invention is sampled as: 5 of hepatoma Metastasis patients, 5 of normal control groups.Take out all people's to be checked peripheral blood 3-5 milliliter (separation white corpuscle) and do in situ hybridization.The result represents that all cancer metastasis patient OPN genes have overexpression, cell dyeing; Normal control group OPN gene is not expressed the cell dye-free.Concrete outcome is asked for an interview Fig. 1, Fig. 2.

Embodiment 3

Detect the hepatoma Metastasis disease and detect parallel laboratory test between the hepatoma Metastasis disease with the OPN kit gene with the CA125 kit gene.

Specificity, susceptibility, accuracy for each comfortable hepatoma Metastasis disease of scientific evaluation said gene.We use the method for parallel test, detect the mRNA of said gene simultaneously, detection technique adopts the nucleic acid hybridization in situ technology, with same routine hepatoma Metastasis disease peripheral blood of patients, detect OPN gene and CA125 (CA125 (tumor marker), NM-024690) mRNA of gene (carrying out same procedure and step and reagent that the hybridization in situ technique of embodiment 1 and embodiment 2 is all adopted in nucleic acid hybridization in situ, immunohistochemical staining, mirror numeration down, report as a result etc.) simultaneously.Find the OPN gene in hepatoma Metastasis disease patient expression amount than the expression amount height of CA125 gene same disease patient.The result shows that specificity, susceptibility, the accuracy of the medical diagnosis on disease of OPN gene pairs hepatoma Metastasis are better than CA125 gene, and in situ hybridization genetic expression figure shows that OPN expression of gene amount is 70%, and CA125 expression of gene amount is 50%.The index that test kit of the present invention is done in the hepatoma Metastasis medical diagnosis on disease has very important clinical meaning.

SEQUENCE?LISTING

＜110〉Rui bends biotechnology (Shanghai) Co., Ltd.

＜120〉a kind of hybridization in situ detection kit of 0PN gene and detection method thereof and application

<130>/

<160>1

<170>PatentIn?version?3.3

<210>1

<211>1616

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>1

ctccctgtgt?tggtggagga?tgtctgcagc?agcatttaaa?ttctgggagg?gcttggttgt 60

cagcagcagc?aggaggaggc?agagcacagc?atcgtcggga?ccagactcgt?ctcaggccag 120

ttgcagcctt?ctcagccaaa?cgccgaccaa?ggaaaactca?ctaccatgag?aattgcagtg 180

atttgctttt?gcctcctagg?catcacctgt?gccataccag?ttaaacaggc?tgattctgga 240

agttctgagg?aaaagcagct?ttacaacaaa?tacccagatg?ctgtggccac?atggctaaac 300

cctgacccat?ctcagaagca?gaatctccta?gccccacaga?cccttccaag?taagtccaac 360

gaaagccatg?accacatgga?tgatatggat?gatgaagatg?atgatgacca?tgtggacagc 420

caggactcca?ttgactcgaa?cgactctgat?gatgtagatg?acactgatga?ttctcaccag 480

tctgatgagt?ctcaccattc?tgatgaatct?gatgaactgg?tcactgattt?tcccacggac 540

ctgccagcaa?ccgaagtttt?cactccagtt?gtccccacag?tagacacata?tgatggccga 600

ggtgatagtg?tggtttatgg?actgaggtca?aaatctaaga?agtttcgcag?acctgacatc 660

cagtaccctg?atgctacaga?cgaggacatc?acctcacaca?tggaaagcga?ggagttgaat 720

ggtgcataca?aggccatccc?cgttgcccag?gacctgaacg?cgccttctga?ttgggacagc 780

cgtgggaagg?acagttatga?aacgagtcag?ctggatgacc?agagtgctga?aacccacagc 840

cacaagcagt?ccagattata?taagcggaaa?gccaatgatg?agagcaatga?gcattccgat 900

gtgattgata?gtcaggaact?ttccaaagtc?agccgtgaat?tccacagcca?tgaatttcac 960

agccatgaag?atatgctggt?tgtagacccc?aaaagtaagg?aagaagataa?acacctgaaa 1020

tttcgtattt?ctcatgaatt?agatagtgca?tcttctgagg?tcaattaaaa?ggagaaaaaa 1080

tacaatttct?cactttgcat?ttagtcaaaa?gaaaaaatgc?tttatagcaa?aatgaaagag 1140

aacatgaaat?gcttctttct?cagtttattg?gttgaatgtg?tatctatttg?agtctggaaa 1200

taactaatgt?gtttgataat?tagtttagtt?tgtggcttca?tggaaactcc?ctgtaaacta 1260

aaagcttcag?ggttatgtct?atgttcattc?tatagaagaa?atgcaaacta?tcactgtatt 1320

ttaatatttg?ttattctctc?atgaatagaa?atttatgtag?aagcaaacaa?aatactttta 1380

cccacttaaa?aagagaatat?aacattttat?gtcactataa?tcttttgttt?tttaagttag 1440

tgtatatttt?gttgtgatta?tctttttgtg?gtgtgaataa?atcttttatc?ttgaatgtaa 1500

taagaatttg?gtggtgtcaa?ttgcttattt?gttttcccac?ggttgtccag?caattaataa 1560

aacataaccttttttactgc?ctaaaaaaaa?aaaaaaaaaa?aaaaaaaaaa?aaaaaa 1616

Claims (11)

1. the hybridization in situ detection kit of an OPN gene detects cancer in preparation and shifts, recurs application in the disease medicament in early days, and described test kit comprises hybridization probe, marker, and described hybridization probe sequence is shown in SEQ ID NO.1.

2. application according to claim 1 is characterized in that: described cancer is a liver cancer.

3. application according to claim 1 is characterized in that: the RNA sequence of described hybridization probe sequence shown in SEQ ID NO.1.

4. according to the arbitrary described application of claim 1-3, it is characterized in that: described marker is selected from radionuclide or non-radioactive marker.

5. application according to claim 4 is characterized in that: described radionuclide is selected from ³H, ³⁵S, ¹²⁵I or ³²A kind of among the P.

6. application according to claim 4 is characterized in that: described non-radioactive marker is selected from a kind of in vitamin H, digoxin, alkaline phosphatase, horseradish peroxidase or the fluorescein.

7. application according to claim 6 is characterized in that: described non-radioactive marker is preferably from digoxin.

8. according to the arbitrary described application of claim 1-3, it is characterized in that: described test kit also comprises synergistic agent, and described synergistic agent is the alkaline phosphatase enzyme antibody.

9. the hybridization in situ detection kit of an OPN gene comprises hybridization probe, marker, it is characterized in that, described hybridization probe sequence is shown in SEQ ID NO.1, and described marker is selected from radionuclide or non-radioactive marker.

10. the in situ hybridization detection method of an OPN gene is characterized in that, this method may further comprise the steps:

A, the hybridization probe in the described test kit of claim 9 is contacted with RNA to be measured in the substrate, form hybridization complex;

The hybridization complex that b, detection a step obtain.

11. detection method according to claim 10 is characterized in that: the condition that forms hybridization complex in a step is: the temperature of nucleic acid hybridization is 42 ℃; The time of nucleic acid hybridization is 16-24 hour, and described substrate is selected blood cell sample or histocyte sample for use.

Images