CN101991844A - Edwardsiella tarda recombinant subunit vaccine and application thereof - Google Patents
Edwardsiella tarda recombinant subunit vaccine and application thereof Download PDFInfo
- Publication number
- CN101991844A CN101991844A CN2009100179561A CN200910017956A CN101991844A CN 101991844 A CN101991844 A CN 101991844A CN 2009100179561 A CN2009100179561 A CN 2009100179561A CN 200910017956 A CN200910017956 A CN 200910017956A CN 101991844 A CN101991844 A CN 101991844A
- Authority
- CN
- China
- Prior art keywords
- leu
- ala
- vaccine
- gln
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to the field of molecular biology and immunology and particularly discloses an Edwardsiella tarda recombinant subunit vaccine as well as a preparation method and application thereof. The vaccine has a base sequence in a sequence table SEQ ID No.1. The preparation method of the Edwardsiella tarda recombinant subunit vaccine comprises the following steps of constructing a vaccine antigen expression plasmid pETXV21, converting the vaccine antigen expression plasmid pETXV21 into escherichia coli BL21 (DE3), recovering a recombinant protein after induced expression, mixing the recombinant protein with a strain B187, and dissolving the mixture in PBS (Phosphate Buffer Saline) to obtain a vaccine mixed liquor which has the function of immune protection to Edwardsiella tarda. The vaccine mixed liquor is intraperitoneally injected to fishes to achieve the purpose of immune protection.
Description
Technical field
The present invention relates to molecular biology and field of immunology, a kind of specifically Edwardsiella tarda (Edwardsiella tarda) recombinant subunit vaccine and preparation and application.
Background technology
Edwardsiella tarda (Edwardsiella tarda) is a kind of Gram-negative pathogen, and tool wide spectrum host range comprises people, animal and Fish etc.In China, Edwardsiella tarda is the important cause of disease of multiple cultured fishes (turbot, Paralichthys olivaceus and Anguillar japonica etc.), and the sick annual Aquatic product aquaculture of giving of the tarda that it brought out causes enormous economic loss.The control of Edwardsiella tarda disease at present mainly depends on uses antibiotic and vaccine, and the latter is confined to the fraction country /region.Because the well-known harm of antibiotic, it uses receives restriction gradually.Opposite with antibiotic, vaccine is one of best prevention of damage by disease measure of comprehensive effect by generally acknowledging.Common vaccine comprises inactivated vaccine, subunit vaccine and nucleic acid vaccine etc.With regard to Edwardsiella tarda, business-like vaccine has only inactivated vaccine.Compare to inactivated vaccine, have advantages such as the strong and repeatability of immunologic opsonin is better based on proteinic recombinant subunit vaccine.Yet though several routine Edwardsiella tarda recombinant subunit vaccine antigens reports are arranged at present, wherein protective effect (relative survival rate) reaches 70% above person and has only an example (Japanese scientific research person reports).Thereby the recombinant subunit vaccine of the high protective effect of tool still remains to be researched and developed.
Summary of the invention
The object of the invention is to provide a kind of slow Edwardsiella vaccine and methods for making and using same thereof.
For achieving the above object, the technical solution used in the present invention is:
A kind of immune protective recombinant subunit vaccine, the base sequence among the tool sequence table SEQ ID No.1.
The preparation of described recombinant subunit vaccine:
1) structure of plasmid pETXV21:, reclaim the 5.3kb fragment with plasmid pET28 NdeI/XhoI enzyme action; With Edwardsiella tarda TX1 is template, carry out pcr amplification with primer XVF and XVR, use the NdeI/XhoI enzyme action behind the product purification, reclaim the 1.4kb fragment, it is connected with above-mentioned 5.3kb fragment, connect behind the liquid transformed into escherichia coli DH5 α containing on the LB solid medium of kanamycin and cultivate, and the screening transformant extracts plasmid, be plasmid pETXV21;
2) abduction delivering of vaccine protein and purification:, get transformant BL21/pETXV21 with plasmid pETXV21 transformed into escherichia coli BL21 (DE3); With BL21/pETXV21 incubated overnight in the LB fluid medium that contains Kn; The culture fluid of getting after spending the night adds in the fresh LB fluid medium, is cultured to OD in 37 ℃
600Be 0.5, add final concentration and be the IPTG of 1mM and continue to cultivate 4-5h in 37 ℃, in the bacterium liquid of centrifugal back, add lysate then, shook 1-2 hour in room temperature; Bacterium liquid is centrifugal, reclaim supernatant; Supernatant is reclaimed with gel column, i.e. the coded recombinant subunit vaccine albumen of base sequence among the calling sequence table SEQ ID No.1.
The recombinant subunit vaccine albumen of above-mentioned gained is mixed in PBS with bacterial strain B187, and the obtained vaccine mixed liquor is to Edwardsiella tarda tool immanoprotection action.
With described vaccine mixed liquor lumbar injection Paralichthys olivaceus, booster immunization once can make Paralichthys olivaceus that Edwardsiella tarda is infected the tool resistant function after 21 days.
The present invention has following advantage:
1. high protective rate.Recombinant subunit vaccine XV21 of the present invention reaches 72% to the immunoprotection efficient of Edwardsiella tarda.
2. use simply, need not the commercialization adjuvant.
Description of drawings
Fig. 1: His Trap HP Columns reclaims the SDS-polyacrylamide gel electrophoresis result (swimming lane 2) of product.Swimming lane 1, molecular weight standard.
The specific embodiment
The invention will be further described below in conjunction with embodiment.Embodiment is intended to the description of giving an example to the present invention, but not limits the invention in any form.
Involved in embodiments of the present invention experimental technique routinely all adopts following method:
1. plasmid extraction, DNA (PCR) product purification all use the corresponding reagent box of " TIANGEN Biotech (Beijing) Co., Ltd. ".
2. plasmid, the conversion of DNA connection liquid enter escherichia coli and all use Hanahan method (Sambrook and Russell:Molecular Cloning:A Laboratory Mannual.Cold Spring Harbor Laboratory Press 2001);
3. all restricted enzyme and ligase are all available from " Beijing, Niu Yinglun Bioisystech Co., Ltd ";
4.SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting are all undertaken by Sambrook and Russell:Molecular Cloning:A Laboratory Mannual.Cold Spring Harbor Laboratory Press (2001).
Vaccine XV21 is by shown in the base sequence among the sequence table SEQ ID No.1.
The preparation method of vaccine XV21:
1) structure of plasmid pETXV21
Plasmid pET28 (purchasing the Novagen in the U.S.) is used the NdeI/XhoI enzyme action, reclaim the 5.3kb fragment.TX1 (is stored in CGMCC with Edwardsiella tarda, deposit number is: CGMCC No.2330, the preservation proof is submitted in application case 200810016124.3 slow Edwardsiella vaccine antigens and preparation method thereof in 20080509) be template, with primer XVF (5 '-GCG
CATATGCAATACACCAAATTGCGTT-3 ', the line base is the NdeI site) and XVR (5 '-
CTCGAGCACCCGGTTATACTCCT-3 ', the line base is the XhoI site) carry out the PCR:94 ℃ of pre-degeneration template DNA of 60s by following condition, 94 ℃ of 40s then, 53 ℃ of 60s, 72 ℃ of 60s change 94 ℃ of 40s into, 61 ℃ of 60s after 5 circulations, 72 ℃ of 60s, after 25 circulations again at 72 ℃ of extension 7-10min.Use the NdeI/XhoI enzyme action behind the PCR product purification, reclaim the 1.4kb fragment, be connected with above-mentioned 5.3kb fragment, containing kanamycin (Kn after connecting liquid transformed into escherichia coli DH5 α, cultivated 18-24 hour on LB solid medium 50ug/ml), the screening transformant is extracted plasmid, is plasmid pETXV21;
The constituent of described LB solid medium is by weight percentage: 1.0% peptone, 0.5% yeast powder, 1.0% sodium chloride, agar 1.5%, 96% distilled water;
2) abduction delivering of vaccine antigen XV21 and purification
With above-mentioned steps 1) plasmid pETXV21 transformed into escherichia coli BL21 (DE3) (available from " day root biochemical technology company limited ", Beijing), cultivated 18-24 hour on the LB solid medium that contains Kn (50ug/ml), bacterium colony of picking is with its called after BL21/pETXV21.With BL21/pETXV21 incubated overnight in the LB fluid medium that contains Kn (50ug/ml); Culture fluid after getting 1ml and spending the night adds it in fresh LB fluid medium that contains Kn (50ug/ml) of 100ml, in 37 ℃ of following rotating speed 200rpm wave and culture to OD
600Be 0.6, adding final concentration is isopropyl-β-D-thiogalactopyranoside of 1mM, and 37 ℃ of continuation are with rotating speed 160rpm wave and culture 4-5h, and then centrifugal (5000g, 10min), collects bacterium liquid, adding 5ml lysate (10mM NaH by 4 ℃
2PO
4, 10mM Tris, 8M carbamide, pH 8.0), on shaking table, slowly shook 1-2 hour in room temperature, till bacteria suspension becomes clarification.With bacterium liquid centrifugal (10000g, 30min, 4 ℃), reclaim supernatant.Supernatant is reclaimed with His Trap HP Columns (purchasing the Healthcare in GE), to reclaim product and carry out SDS-polyacrylamide gel electrophoresis (concentration of polyacrylamide is 12%), discovery has only a kind of albumen (Fig. 1), and the molecular weight of its molecular weight and vaccine antigen protein XV21 coincide; Owing to have the His label on the XV21, detect so further use His antibody (purchasing) to carry out immunoblotting in " TIANGEN Biotech (Beijing) Co., Ltd. ", find that the albumen that reclaims can combine with the His antibody specificity, illustrates that it has the His label.These results show that the albumen that obtains that reclaims is the protectiveness vaccine antigen protein XV21 of the base sequence among the tool sequence table SEQ ID No1.
Sequence table SEQ ID No1
ATGCAATACACCAAATTGCGTCTGATGGTTGGTGGGCTGGCGCTGGCCATGGTCGGTACCAGCGTGCATTCTGAAACGCTACAGCCCGATCCGGCCTGGCAGGAGGGCAAGCTGCCGAACGGTTTTTCTTGGCAGATCCTGGCGACGCCGCAGCGTCCATCCGATCGTATTGAGCTACGTATGATCGTCAACACCGGCTCGCTGTCGGAGTCTCCTCAGCAGGTGGGGTATGCCCACCTGCTGCCGCGCCTGGCTCTGGCGCAGGGCAAGGGGCTTGACGCGACCGCCCTGCAGTCGTTTTGGCAGCAGGCAATCGATCCCGTGCGTCCGATGCCGGCGGCGATCACCTCGTATGATTACACCAGCTATAACCTGAGCCTGCCCAATAACCGCCCCGATCTGATGAAGGATGCCCTGCGCTGGCTGGCCAATACCGCCGGCGATCTGCAGGTGAATGCCGAGACGGTCGGTGAGGCGCTGAAAGGCAGCGACAGCCGCGTGATGGCGCTGCCCGGCGAAGCCGGCGATCCCTGGTGGCGCTACCGTCTGAAGGGCTCCAACCTGCTGGGCCATGAGCCTGGACGAACGGCGGCGGTTCCGCTGGCGCCGGCGCAGCTGAAGGCCTTTTATCATCAGTGGTATACCCCCGATGCGATAACGCTGTACGTGGTCGGCAACGTGGATGCCCGGGCGCTGAGCGAACAGATCAATCAGACCTTCGGCCCCCTGAGCGGCAAGCGGGAGACGCCGGCCACGGTGCCGGCGCTGCCGGCGCTGGCCGCGGCGCCGGTGAGCCTGATCGCCGATGGCGCCAAGCAGGATATTCTGTCGCTGGTCTGGGATACGCCGTGGCAGCCGATCCGTGACTCTCAGATGCTGCTGCGCTATTGGCGTAGCGACTTGGCGCGCGAGGCGCTGTTCTGGCATCTACAGCAGGTGCTGGCCAACAGCGCGCTGAAGGGCAGCGTGAACCTGAGCTTTAACTGCCAGGTGCAGTATCAGCGCTCGCAGTGCGCGATCCATTTAGAGACGGCTCAGGCGTCATTGAGCAAGACGCTGGCGTTTATCGCCGATGAGATGTCCGCGCTGCGCGATGATGGGATTACCCAGCCGGAGTTTGACACCCTGCTGGGGCAGAAGAACGATCAGCTGAGTCACCTGTTCGCCACCTATGCGCGAACCAATACCGACATCCTGATGAGTCAACGCCTGCGCTCACAGCAAAGCGGCGTGGTGGACATCGCTCCGGAGGCGTATCAGAAGCTGCGCCAGACGTTCCTGAGCGCGCTGACGCTGGACGATATTAACCAAGAGCTGCATATCATGCTGTCGCGGGAGCCCGCCGTGGTGCTGCGTCAGCCGCGCGGTGAGGCCGAGGAGAACGTGGGCCGCCTGCTGGAGGAGTATAACCGGGTG
(a) sequence signature:
● length: 1416bp
● type: base sequence
● chain: two strands
● topological structure: linearity
(b) molecule type: double-stranded DNA
(c) suppose: not
(d) antisense: not
(e) initial source: Edwardsiella tarda TX1
(f) specificity title: XV21
The immunity of recombinant subunit vaccine XV21 is used
The preparation of step 1) vaccine mixed liquor.
B187 (is stored in CGMCC with bacterial strain; deposit number is: CGMCC No.2331, the preservation proof is submitted in 200810014711.9 1 kinds of intersecting protective vaccine antigen its preparation methods of application case with in using in 20080229) in the LB culture medium, be cultured to OD in 30 ℃
600Be 0.8, centrifugal then (5000g, 4 ℃) 10min.Collect thalline, with its be suspended among the PBS to final concentration be 2x10
8Cfu/ml is B187-PBS.The vaccine antigen XV21 that then in every milliliter of B187-PBS mixed liquor, adds 0.2mg the foregoing description 1 step 2 purification;
Described PBS constituent is by weight percentage: 0.8%NaCl, 0.02%KCl, 0.358%Na
2HPO
4.12H
2O, 0.024%NaH
2PO
4, all the other are water.
Step 2) immunity of recombinant subunit vaccine XV21 is used.(every heavily about 10g) is divided into 2 groups, 30 every group at random with 60 Paralichthys olivaceuss.With these 2 groups difference called after A and B group.Every fish difference lumbar injection 100ul above-mentioned steps 1 with the A group) vaccine mixed liquor.Every fish difference lumbar injection 100ul above-mentioned steps 1 with B group (matched group)) B187-PBS.Every fish after 21 days A being organized is lumbar injection 100ul vaccine mixed liquor respectively; Every fish difference lumbar injection 100ul PBS with the B group.
The preparation of step 3) Edwardsiella tarda suspension.In the LB culture medium, cultivate Edwardsiella tarda TX1 to OD
600Be 0.6, centrifugal then (5000g, 4 ℃) 10min.Collect thalline, with its be suspended among the PBS to final concentration be 5x10
7Cfu/ml.
Step 4) recombinant subunit vaccine XV21 is at the immunoprotection effect detection of Edwardsiella tarda.In step 2) after the inoculation for the first time the 34th day, with the Edwardsiella tarda suspension lumbar injection step 2 of above-mentioned step 3)) two groups of fishes, the injection volume of every fish is 100ul.In afterwards 14 days, observe and write down the death condition of respectively organizing fish every day.After 14 days, statistics is respectively organized total mortality of fish: A group, 7; The B group, 25.Utilize following formula to calculate relative survival rate (RPS):
RPS=100x (the total dead percentage ratio of total dead percentage ratio/matched group fish of 1-immune group fish)
Drawing recombinant subunit vaccine XV21 thus is 72% at the immunoprotection efficient (in RPS) of Edwardsiella tarda.This result shows that XV21 purified as stated above and that use is a kind of protective antigen efficiently, can significantly improve the infection ability of Paralichthys olivaceus to Edwardsiella tarda.
Vaccine
SEQUENCE?LISTING
＜110〉Institute of Oceanology of the Chinese Academy of Sciences
＜120〉a kind of Edwardsiella tarda recombinant subunit vaccine and application thereof
<130>
<160>2
<170>PatentIn?version?3.1
<210>1
<211>1416
<212>DNA
＜213〉Edwardsiella tarda TX1
<220>
<221>CDS
<222>(1)..(1416)
<223>
<400>1
atg?caa?tac?acc?aaa?ttg?cgt?ctg?atg?gtt?ggt?ggg?ctg?gcg?ctg?gcc 48
Met?Gln?Tyr?Thr?Lys?Leu?Arg?Leu?Met?Val?Gly?Gly?Leu?Ala?Leu?Ala
1 5 10 15
atg?gtc?ggt?acc?agc?gtg?cat?tct?gaa?acg?cta?cag?ccc?gat?ccg?gcc 96
Met?Val?Gly?Thr?Ser?Val?His?Ser?Glu?Thr?Leu?Gln?Pro?Asp?Pro?Ala
20 25 30
tgg?cag?gag?ggc?aag?ctg?ccg?aac?ggt?ttt?tct?tgg?cag?atc?ctg?gcg 144
Trp?Gln?Glu?Gly?Lys?Leu?Pro?Asn?Gly?Phe?Ser?Trp?Gln?Ile?Leu?Ala
35 40 45
acg?ccg?cag?cgt?cca?tcc?gat?cgt?att?gag?cta?cgt?atg?atc?gtc?aac 192
Thr?Pro?Gln?Arg?Pro?Ser?Asp?Arg?Ile?Glu?Leu?Arg?Met?Ile?Val?Asn
50 55 60
acc?ggc?tcg?ctg?tcg?gag?tct?cct?cag?cag?gtg?ggg?tat?gcc?cac?ctg 240
Thr?Gly?Ser?Leu?Ser?Glu?Ser?Pro?Gln?Gln?Val?Gly?Tyr?Ala?His?Leu
65 70 75 80
ctg?ccg?cgc?ctg?gct?ctg?gcg?cag?ggc?aag?ggg?ctt?gac?gcg?acc?gcc 288
Leu?Pro?Arg?Leu?Ala?Leu?Ala?Gln?Gly?Lys?Gly?Leu?Asp?Ala?Thr?Ala
85 90 95
ctg?cag?tcg?ttt?tgg?cag?cag?gca?atc?gat?ccc?gtg?cgt?ccg?atg?ccg 336
Leu?Gln?Ser?Phe?Trp?Gln?Gln?Ala?Ile?Asp?Pro?Val?Arg?Pro?Met?Pro
100 105 110
gcg?gcg?atc?acc?tcg?tat?gat?tac?acc?agc?tat?aac?ctg?agc?ctg?ccc 384
Ala?Ala?Ile?Thr?Ser?Tyr?Asp?Tyr?Thr?Ser?Tyr?Asn?Leu?Ser?Leu?Pro
115 120 125
aat?aac?cgc?ccc?gat?ctg?atg?aag?gat?gcc?ctg?cgc?tgg?ctg?gcc?aat 432
Asn?Asn?Arg?Pro?Asp?Leu?Met?Lys?Asp?Ala?Leu?Arg?Trp?Leu?Ala?Asn
130 135 140
acc?gcc?ggc?gat?ctg?cag?gtg?aat?gcc?gag?acg?gtc?ggt?gag?gcg?ctg 480
Thr?Ala?Gly?Asp?Leu?Gln?Val?Asn?Ala?Glu?Thr?Val?Gly?Glu?Ala?Leu
145 150 155 160
aaa?ggc?agc?gac?agc?cgc?gtg?atg?gcg?ctg?ccc?ggc?gaa?gcc?ggc?gat 528
Lys?Gly?Ser?Asp?Ser?Arg?Val?Met?Ala?Leu?Pro?Gly?Glu?Ala?Gly?Asp
165 170 175
ccc?tgg?tgg?cgc?tac?cgt?ctg?aag?ggc?tcc?aac?ctg?ctg?ggc?cat?gag 576
Pro?Trp?Trp?Arg?Tyr?Arg?Leu?Lys?Gly?Ser?Asn?Leu?Leu?Gly?His?Glu
180 185 190
cct?gga?cga?acg?gcg?gcg?gtt?ccg?ctg?gcg?ccg?gcg?cag?ctg?aag?gcc 624
Pro?Gly?Arg?Thr?Ala?Ala?Val?Pro?Leu?Ala?Pro?Ala?Gln?Leu?Lys?Ala
195 200 205
ttt?tat?cat?cag?tgg?tat?acc?ccc?gat?gcg?ata?acg?ctg?tac?gtg?gtc 672
Phe?Tyr?His?Gln?Trp?Tyr?Thr?Pro?Asp?Ala?Ile?Thr?Leu?Tyr?Val?Val
210 215 220
ggc?aac?gtg?gat?gcc?cgg?gcg?ctg?agc?gaa?cag?atc?aat?cag?acc?ttc 720
Gly?Asn?Val?Asp?Ala?Arg?Ala?Leu?Ser?Glu?Gln?Ile?Asn?Gln?Thr?Phe
225 230 235 240
ggc?ccc?ctg?agc?ggc?aag?cgg?gag?acg?ccg?gcc?acg?gtg?ccg?gcg?ctg 768
Gly?Pro?Leu?Ser?Gly?Lys?Arg?Glu?Thr?Pro?Ala?Thr?Val?Pro?Ala?Leu
245 250 255
ccg?gcg?ctg?gcc?gcg?gcg?ccg?gtg?agc?ctg?atc?gcc?gat?ggc?gcc?aag 816
Pro?Ala?Leu?Ala?Ala?Ala?Pro?Val?Ser?Leu?Ile?Ala?Asp?Gly?Ala?Lys
260 265 270
cag?gat?att?ctg?tcg?ctg?gtc?tgg?gat?acg?ccg?tgg?cag?ccg?atc?cgt 864
Gln?Asp?Ile?Leu?Ser?Leu?Val?Trp?Asp?Thr?Pro?Trp?Gln?Pro?Ile?Arg
275 280 285
gac?tct?cag?atg?ctg?ctg?cgc?tat?tgg?cgt?agc?gac?ttg?gcg?cgc?gag 912
Asp?Ser?Gln?Met?Leu?Leu?Arg?Tyr?Trp?Arg?Ser?Asp?Leu?Ala?Arg?Glu
290 295 300
gcg?ctg?ttc?tgg?cat?cta?cag?cag?gtg?ctg?gcc?aac?agc?gcg?ctg?aag 960
Ala?Leu?Phe?Trp?His?Leu?Gln?Gln?Val?Leu?Ala?Asn?Ser?Ala?Leu?Lys
305 310 315 320
ggc?agc?gtg?aac?ctg?agc?ttt?aac?tgc?cag?gtg?cag?tat?cag?cgc?tcg 1008
Gly?Ser?Val?Asn?Leu?Ser?Phe?Asn?Cys?Gln?Val?Gln?Tyr?Gln?Arg?Ser
325 330 335
cag?tgc?gcg?atc?cat?tta?gag?acg?gct?cag?gcg?tca?ttg?agc?aag?acg 1056
Gln?Cys?Ala?Ile?His?Leu?Glu?Thr?Ala?Gln?Ala?Ser?Leu?Ser?Lys?Thr
340 345 350
ctg?gcg?ttt?atc?gcc?gat?gag?atg?tcc?gcg?ctg?cgc?gat?gat?ggg?att 1104
Leu?Ala?Phe?Ile?Ala?Asp?Glu?Met?Ser?Ala?Leu?Arg?Asp?Asp?Gly?Ile
355 360 365
acc?cag?ccg?gag?ttt?gac?acc?ctg?ctg?ggg?cag?aag?aac?gat?cag?ctg 1152
Thr?Gln?Pro?Glu?Phe?Asp?Thr?Leu?Leu?Gly?Gln?Lys?Asn?Asp?Gln?Leu
370 375 380
agt?cac?ctg?ttc?gcc?acc?tat?gcg?cga?acc?aat?acc?gac?atc?ctg?atg 1200
Ser?His?Leu?Phe?Ala?Thr?Tyr?Ala?Arg?Thr?Asn?Thr?Asp?Ile?Leu?Met
385 390 395 400
agt?caa?cgc?ctg?cgc?tca?cag?caa?agc?ggc?gtg?gtg?gac?atc?gct?ccg 1248
Ser?Gln?Arg?Leu?Arg?Ser?Gln?Gln?Ser?Gly?Val?Val?Asp?Ile?Ala?Pro
405 410 415
gag?gcg?tat?cag?aag?ctg?cgc?cag?acg?ttc?ctg?agc?gcg?ctg?acg?ctg 1296
Glu?Ala?Tyr?Gln?Lys?Leu?Arg?Gln?Thr?Phe?Leu?Ser?Ala?Leu?Thr?Leu
420 425 430
gac?gat?att?aac?caa?gag?ctg?cat?atc?atg?ctg?tcg?cgg?gag?ccc?gcc 1344
Asp?Asp?Ile?Asn?Gln?Glu?Leu?His?Ile?Met?Leu?Ser?Arg?Glu?Pro?Ala
435 440 445
gtg?gtg?ctg?cgt?cag?ccg?cgc?ggt?gag?gcc?gag?gag?aac?gtg?ggc?cgc 1392
Val?Val?Leu?Arg?Gln?Pro?Arg?Gly?Glu?Ala?Glu?Glu?Asn?Val?Gly?Arg
450 455 460
ctg?ctg?gag?gag?tat?aac?cgg?gtg 1416
Leu?Leu?Glu?Glu?Tyr?Asn?Arg?Val
465 470
<210>2
<211>472
<212>PRT
＜213〉Edwardsiella tarda TX1
<400>2
Met?Gln?Tyr?Thr?Lys?Leu?Arg?Leu?Met?Val?Gly?Gly?Leu?Ala?Leu?Ala
1 5 10 15
Met?Val?Gly?Thr?Ser?Val?His?Ser?Glu?Thr?Leu?Gln?Pro?Asp?Pro?Ala
20 25 30
Trp?Gln?Glu?Gly?Lys?Leu?Pro?Asn?Gly?Phe?Ser?Trp?Gln?Ile?Leu?Ala
35 40 45
Thr?Pro?Gln?Arg?Pro?Ser?Asp?Arg?Ile?Glu?Leu?Arg?Met?Ile?Val?Asn
50 55 60
Thr?Gly?Ser?Leu?Ser?Glu?Ser?Pro?Gln?Gln?Val?Gly?Tyr?Ala?His?Leu
65 70 75 80
Leu?Pro?Arg?Leu?Ala?Leu?Ala?Gln?Gly?Lys?Gly?Leu?Asp?Ala?Thr?Ala
85 90 95
Leu?Gln?Ser?Phe?Trp?Gln?Gln?Ala?Ile?Asp?Pro?Val?Arg?Pro?Met?Pro
100 105 110
Ala?Ala?Ile?Thr?Ser?Tyr?Asp?Tyr?Thr?Ser?Tyr?Asn?Leu?Ser?Leu?Pro
115 120 125
Asn?Asn?Arg?Pro?Asp?Leu?Met?Lys?Asp?Ala?Leu?Arg?Trp?Leu?Ala?Asn
130 135 140
Thr?Ala?Gly?Asp?Leu?Gln?Val?Asn?Ala?Glu?Thr?Val?Gly?Glu?Ala?Leu
145 150 155 160
Lys?Gly?Ser?Asp?Ser?Arg?Val?Met?Ala?Leu?Pro?Gly?Glu?Ala?Gly?Asp
165 170 175
Pro?Trp?Trp?Arg?Tyr?Arg?Leu?Lys?Gly?Ser?Asn?Leu?Leu?Gly?His?Glu
180 185 190
Pro?Gly?Arg?Thr?Ala?Ala?Val?Pro?Leu?Ala?Pro?Ala?Gln?Leu?Lys?Ala
195 200 205
Phe?Tyr?His?Gln?Trp?Tyr?Thr?Pro?Asp?Ala?Ile?Thr?Leu?Tyr?Val?Val
210 215 220
Gly?Asn?Val?Asp?Ala?Arg?Ala?Leu?Ser?Glu?Gln?Ile?Asn?Gln?Thr?Phe
225 230 235 240
Gly?Pro?Leu?Ser?Gly?Lys?Arg?Glu?Thr?Pro?Ala?Thr?Val?Pro?Ala?Leu
245 250 255
Pro?Ala?Leu?Ala?Ala?Ala?Pro?Val?Ser?Leu?Ile?Ala?Asp?Gly?Ala?Lys
260 265 270
Gln?Asp?Ile?Leu?Ser?Leu?Val?Trp?Asp?Thr?Pro?Trp?Gln?Pro?Ile?Arg
275 280 285
Asp?Ser?Gln?Met?Leu?Leu?Arg?Tyr?Trp?Arg?Ser?Asp?Leu?Ala?Arg?Glu
290 295 300
Ala?Leu?Phe?Trp?His?Leu?Gln?Gln?Val?Leu?Ala?Asn?Ser?Ala?Leu?Lys
305 310 315 320
Gly?Ser?Val?Asn?Leu?Ser?Phe?Asn?Cys?Gln?Val?Gln?Tyr?Gln?Arg?Ser
325 330 335
Gln?Cys?Ala?Ile?His?Leu?Glu?Thr?Ala?Gln?Ala?Ser?Leu?Ser?Lys?Thr
340 345 350
Leu?Ala?Phe?Ile?Ala?Asp?Glu?Met?Ser?Ala?Leu?Arg?Asp?Asp?Gly?Ile
355 360 365
Thr?Gln?Pro?Glu?Phe?Asp?Thr?Leu?Leu?Gly?Gln?Lys?Asn?Asp?Gln?Leu
370 375 380
Ser?His?Leu?Phe?Ala?Thr?Tyr?Ala?Arg?Thr?Asn?Thr?Asp?Ile?Leu?Met
385 390 395 400
Ser?Gln?Arg?Leu?Arg?Ser?Gln?Gln?Ser?Gly?Val?Val?Asp?Ile?Ala?Pro
405 410 415
Glu?Ala?Tyr?Gln?Lys?Leu?Arg?Gln?Thr?Phe?Leu?Ser?Ala?Leu?Thr?Leu
420 425 430
Asp?Asp?Ile?Asn?Gln?Glu?Leu?His?Ile?Met?Leu?Ser?Arg?Glu?Pro?Ala
435 440 445
Val?Val?Leu?Arg?Gln?Pro?Arg?Gly?Glu?Ala?Glu?Glu?Asn?Val?Gly?Arg
450 455 460
Leu?Leu?Glu?Glu?Tyr?Asn?Arg?Val
465 470
Claims (4)
1. an immune protective recombinant subunit vaccine is characterized in that: the base sequence among the tool sequence table SEQ ID No.1.
2. the preparation of the described recombinant subunit vaccine of claim 1 is characterized in that:
1) structure of plasmid pETXV21:, reclaim the 5.3kb fragment with plasmid pET28 NdeI/XhoI enzyme action; With Edwardsiella tarda TX1 is template, carry out pcr amplification with primer XVF and XVR, use the NdeI/XhoI enzyme action behind the product purification, reclaim the 1.4kb fragment, it is connected with above-mentioned 5.3kb fragment, connect behind the liquid transformed into escherichia coli DH5 α containing on the LB solid medium of kanamycin and cultivate, and the screening transformant extracts plasmid, be plasmid pETXV21;
2) abduction delivering of vaccine protein and purification:, get transformant BL21/pETXV21 with plasmid pETXV21 transformed into escherichia coli BL21 (DE3); With BL21/pETXV21 incubated overnight in the LB fluid medium that contains Kn; The culture fluid of getting after spending the night adds in the fresh LB fluid medium, is cultured to OD in 37 ℃
600Be 0.5, add final concentration and be the IPTG of 1mM and continue to cultivate 4-5h in 37 ℃, in the bacterium liquid of centrifugal back, add lysate then, shook 1-2 hour in room temperature; Bacterium liquid is centrifugal, reclaim supernatant; Supernatant is reclaimed with gel column, i.e. the coded recombinant subunit vaccine albumen of base sequence among the calling sequence table SEQ ID No.1.
3. application by the described recombinant subunit vaccine of claim 1, it is characterized in that: the recombinant subunit vaccine albumen of above-mentioned gained is mixed in PBS with bacterial strain B187, and the obtained vaccine mixed liquor is to Edwardsiella tarda tool immanoprotection action.
4. by the application of the described recombinant subunit vaccine of claim 1, it is characterized in that: with described vaccine mixed liquor lumbar injection Paralichthys olivaceus, booster immunization once can make Paralichthys olivaceus that Edwardsiella tarda is infected the tool resistant function after 21 days.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910017956 CN101991844B (en) | 2009-08-21 | 2009-08-21 | Edwardsiella tarda recombinant subunit vaccine and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910017956 CN101991844B (en) | 2009-08-21 | 2009-08-21 | Edwardsiella tarda recombinant subunit vaccine and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101991844A true CN101991844A (en) | 2011-03-30 |
| CN101991844B CN101991844B (en) | 2013-01-30 |
Family
ID=43782921
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910017956 Expired - Fee Related CN101991844B (en) | 2009-08-21 | 2009-08-21 | Edwardsiella tarda recombinant subunit vaccine and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101991844B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102240398A (en) * | 2011-04-02 | 2011-11-16 | 中国科学院海洋研究所 | Edwardsiella tarda subunit vaccine and preparation method thereof |
| CN102614503A (en) * | 2012-03-13 | 2012-08-01 | 中国科学院海洋研究所 | Edwardsiella tarda recombinant protein vaccines, and preparation and application thereof |
| CN107496916A (en) * | 2017-10-11 | 2017-12-22 | 浙江海洋大学 | A kind of Ya Maximus molecular vaccine adjuvants |
| CN113332418A (en) * | 2021-05-14 | 2021-09-03 | 中国科学院海洋研究所 | Application of fish GCSF3 |
| CN114164159A (en) * | 2021-06-21 | 2022-03-11 | 湖南师范大学 | Bivalent vaccine for preventing and treating fish salmon gas killing and Edwardsiella tarda infection and preparation method and application thereof |
| CN116574166A (en) * | 2023-05-04 | 2023-08-11 | 中国海洋大学 | Bicistronic DNA vaccine of fish beta defensin and outer membrane protein C |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101342367B (en) * | 2007-07-11 | 2012-08-22 | 中国科学院海洋研究所 | Edwardsiella tarda attenuated live vaccine |
| CN101319009A (en) * | 2008-05-09 | 2008-12-10 | 中国科学院海洋研究所 | Slow Edwardsiella vaccine antigen and preparation method thereof |
-
2009
- 2009-08-21 CN CN 200910017956 patent/CN101991844B/en not_active Expired - Fee Related
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102240398A (en) * | 2011-04-02 | 2011-11-16 | 中国科学院海洋研究所 | Edwardsiella tarda subunit vaccine and preparation method thereof |
| CN102614503A (en) * | 2012-03-13 | 2012-08-01 | 中国科学院海洋研究所 | Edwardsiella tarda recombinant protein vaccines, and preparation and application thereof |
| CN102614503B (en) * | 2012-03-13 | 2014-06-04 | 中国科学院海洋研究所 | Edwardsiella tarda recombinant protein vaccines, and preparation and application thereof |
| CN107496916A (en) * | 2017-10-11 | 2017-12-22 | 浙江海洋大学 | A kind of Ya Maximus molecular vaccine adjuvants |
| CN113332418A (en) * | 2021-05-14 | 2021-09-03 | 中国科学院海洋研究所 | Application of fish GCSF3 |
| CN114164159A (en) * | 2021-06-21 | 2022-03-11 | 湖南师范大学 | Bivalent vaccine for preventing and treating fish salmon gas killing and Edwardsiella tarda infection and preparation method and application thereof |
| CN114164159B (en) * | 2021-06-21 | 2023-10-03 | 湖南师范大学 | Bivalent vaccine for preventing and treating salmonicida and Edwardsiella tarda infection of fish, and preparation method and application thereof |
| CN116574166A (en) * | 2023-05-04 | 2023-08-11 | 中国海洋大学 | Bicistronic DNA vaccine of fish beta defensin and outer membrane protein C |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101991844B (en) | 2013-01-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101974072B (en) | Escherichia coli TolC antigen as well as antibody and application thereof | |
| CN101991844B (en) | Edwardsiella tarda recombinant subunit vaccine and application thereof | |
| CN102988968B (en) | Vaccine utilizing vibrio anguillarum flagellin and application thereof | |
| Wang et al. | Molecular characterization, phylogenetic, expression, and protective immunity analysis of OmpF, a promising candidate immunogen against Yersinia ruckeri infection in channel catfish | |
| CN101780273B (en) | Vibrio harveyi secretory type vaccine and construction method thereof | |
| CN101491671B (en) | Cross-protection vaccine and building method thereof | |
| CN101869705A (en) | Streptococcus iniae vaccine and preparation and application thereof | |
| CN102614503B (en) | Edwardsiella tarda recombinant protein vaccines, and preparation and application thereof | |
| CN106117365B (en) | Anti-streptococcus suis is sick and with the active fusion protein of autoimmunity and its preparation and application | |
| CN102614504B (en) | Pseudomonas fluorescens recombinant protein vaccine and preparation method thereof | |
| CN106047783A (en) | Pseudomonas plecoglossicida ExoU gene knockout mutant strain and application thereof | |
| CN101816784B (en) | Immunoprotective subunit vaccine, preparation method thereof and application method thereof | |
| CN103041386B (en) | Application of vibrio anguillarum recombinant protein | |
| CN101703767B (en) | Preparation method of nibrio parahaemolyticus outer membrane protein VP2850and application of immunity protective function thereof | |
| CN101632836B (en) | DNA vaccine for Edwardsiella tarda and construction and application thereof | |
| CN101519440B (en) | Intersecting protective vaccine antigen, preparation method and application thereof | |
| CN102268444B (en) | Expression of truncated SasA protein of staphylococcus aureus in escherichia coli and application thereof | |
| CN103408642A (en) | Vibrio harveyi outer membrane protein and application thereof | |
| CN102716499A (en) | Streptococcus iniae trivalent DNA vaccine and construction method thereof | |
| CN101837133B (en) | Gram positive microbes DNA vaccine and construction and application thereof | |
| CN102240398A (en) | Edwardsiella tarda subunit vaccine and preparation method thereof | |
| CN103550765B (en) | Streptococcus iniae DNA (Deoxyribonucleic Acid) vaccine as well as application thereof | |
| CN101703768B (en) | Preparation method of vibrio parahaemolyticus outer membrane protein VP1061 and application of immunity protective function thereof | |
| CN102028940A (en) | Edwardsiella tarda surface display type vaccine and preparation and application thereof | |
| CN111732641A (en) | Recombinant vibrio anguillarum TolC protein and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130130 Termination date: 20210821 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |