CN101984074A - Method for detecting pathogen of sugarcane ratoon stunting disease - Google Patents
Method for detecting pathogen of sugarcane ratoon stunting disease Download PDFInfo
- Publication number
- CN101984074A CN101984074A CN2010105221924A CN201010522192A CN101984074A CN 101984074 A CN101984074 A CN 101984074A CN 2010105221924 A CN2010105221924 A CN 2010105221924A CN 201010522192 A CN201010522192 A CN 201010522192A CN 101984074 A CN101984074 A CN 101984074A
- Authority
- CN
- China
- Prior art keywords
- sugarcane
- centrifuge tube
- dwarfing
- concentration
- pathogenic bacteria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a rapid detection method of the pathogen of the sugarcane ratoon stunting disease. The method is characterized in that a sugarcane sample is frozen quickly with liquid nitrogen to perform grinding treatment, four specific primers are designed according to the ITS sequence of the pathogen of the sugarcane ratoon stunting disease, the loop-mediated isothermal amplification of the target fragment of the pathogen is performed; and the reaction product of the loop-mediated isothermal amplification is detected and identified, fluorescent dye GlodView is added in the reaction tube, and the judgement is made through visual inspection under the ultraviolet light of a money genuineness testing pencil. The detection method of the invention has reliability, high sensitivity, short detection time and low cost, and can diagnose the sugarcane ratoon stunting disease accurately and rapidly. The method does not require other special instruments, is convenient to operate and is particularly suitable for the field rapid and accurate detection of the sugarcane ratoon stunting disease.
Description
Technical field
The present invention belongs to biological technical field, is specifically related to the molecular biological method for quick of a kind of sugarcane dwarfing pathogenic bacteria.
Background technology
The sugarcane dwarfing is one of important disease that influences sugarcane yield, and its pathogenic bacteria is
Leifsonia xyli subsp.xyli(Lxx), its pathogenesis be since pathogenic bacteria Lxx parasitize sugarcane (
Saccharum officinale) xylem in, secretion produces gelatinoid, stops up the xylem vessel of sugarcane, causes nutrient upwards not transport, and causes the sugarcane dwarfing, dysplasia, the sugarcane production process often is mistaken as the soil fertility deficiency, manages reasons such as bad, causes erroneous judgement.The dwarfing pathogenic bacterial infection rate that perennial root grows cane can reach 30%, causes the significantly underproduction of sugarcane.
For pathogenic bacteria
Leifsonia xyli subsp.xyliClassical detection method mainly contain the anatomic observation method, separate the germ method, serological detection method etc., these detection methods operations are loaded down with trivial details, detection sensitivity is not high yet, length all consuming time and false positive rate are very high.Popular polymerase chain reaction (PCR) detection technique needs special instrument at present, and exist sample room to pollute mutually easily, reasons such as complex operation, fluorescence real-time quantitative polymerase chain reaction (real time PCR) is though can solve the mutual pollution problem of sample room, but need accurate instrument, the cost of check is very high, is difficult in field detection large-scale promotion.
LAMP(loop-mediated isothermal amplification) technology promptly is the gene amplification technology of the alternative PCR that succeeded in developing alone in 1998 of Japanese Eiken Chemical.6 sequence areas that are characterized as at target gene design 4 Auele Specific Primers, utilize strand replacement reaction, carry out amplified reaction under constant temperature.It is the gene amplification method of a kind of " simple and easy, quick, accurate, at a low price ".Along with scientific technological advance, the LAMP technology is as a kind of quick, easy gene diagnosis method.
The genome research of the dwarfing pathogenic bacteria Lxx of sugarcane shows: sugarcane dwarfing pathogenic bacteria
Leifsonia xyli subsp.xyli16 S and the intergenic region (ITS) of 23S RNA obvious with the ITS sequence difference of other bacteriums.Therefore, design Auele Specific Primer with the ITS sequence and carry out ring mediated isothermal amplification, detect the dwarfing pathogenic bacteria of sugarcane
Leifsonia xyli subsp.xyli
Summary of the invention
The present invention seeks to solve the complex operation of present sugarcane dwarfing pathogenic bacteria detection technique, the defective of specificity low consumption duration, develop a kind of quick accurate detecting method of molecular biology that detects sugarcane ratoon stunting disease.
The step that detects the method for sugarcane dwarfing pathogenic bacteria is:
1, chooses the cane stalk of detected sugarcane, clean surface impurity, peeling from root the 3rd joint.70% ethanol wiping sterilization.
2, will be cut into small pieces through the sterilization sugarcane, put into mortar, and add the 100ml liquid nitrogen flash freezer and be ground to Powdered.
3,, among the 50ml centrifuge tube A that packs into, add 20ml TE damping fluid, 80 ℃ of water-bath heating 60min with powder 10g.Centrifugal 10min.Supernatant liquor is moved among the 50ml centrifuge tube B.
4, in centrifuge tube B, add isopyknic β mercaptoethanol chloroformic solution, centrifugal 10min.Getting supernatant liquor 15ml moves among the 50ml centrifuge tube C.
5, in centrifuge tube C, add isopyknic chloroformic solution.Centrifugal 10min.Get among supernatant liquor 10ml to the 50ml centrifuge tube D.
6, in supernatant liquor centrifuge tube D is housed, add the dehydrated alcohol of 20ml and the sodium-acetate of 1ml respectively ,-20 ℃ leave standstill 30min.
7, centrifugal 30min removes supernatant liquor, and throw out contains the powder thing of DNA with 5ml 70% washing with alcohol twice, at room temperature dry acquisition..
8, in the centrifuge tube E of 1.5ml, the powder thing 1mg that the dry acquisition of adding contains DNA injects 100 μ l deionized waters, concussion dissolved powders thing, the template DNA preparation liquid when increasing as LAMP.
9, LAMP amplification: in the centrifuge tube of 0.2ml, primers F 3, the 0.25 μ l concentration that successively adds 1 μ l template DNA preparation liquid, 1 μ l Bst polysaccharase, 0.25 μ l concentration and be 20 μ mol/L is that the primer B3 of 20 μ mol/L, the primers F IP that 1 μ l concentration is 20 μ mol/L, the primer BIP that 1 μ l concentration is 20 μ mol/L, triphosphoric acid dezyribonucleoside (dNTP), the 4 μ l concentration that 3 μ l concentration are 2.5 mmol/L are the MgCl of 25 mmol/L
2, 2.5 μ l, 10 * isothermal duplication damping fluid (ThermoPol Buffer) and 11 μ l deionized water.Behind the mixing, place water-bath 60-65 ℃ heating to carry out constant-temperature amplification, proliferation time is 60-70min.
10, detecting product identifies: the fluorescence dye GlodView solution that adds 1000 times of the pre-dilutions of 1 μ l in the centrifuge tube that amplification finishes.Visual inspection is judged under the paper money genuineness testing pencil UV-irradiation.
Centrifuge tube of the present invention is the centrifuge tube of sterilizing, and sterilising conditions is 121 ℃ of sterilization 20min.
TE solution composition of the present invention is 10mmol/l Tris-Cl and 1mmol/l EDTA.
Centrifugal condition of the present invention is in the normal temperature whizzer, and centrifugal force is 12000 * g.
β mercaptoethanol chloroformic solution composition of the present invention is β mercaptoethanol: chloroformic solution=1:24.
Sodium-acetate concentration of the present invention is 3mol/L, 121 ℃ of sterilization 20min.
Bst polysaccharase of the present invention and isothermal duplication damping fluid (ThermoPol Buffer) are purchased the company in U.S. New England Biolabs (NEB).
4 Auele Specific Primers of the present invention are synthetic by gene (reagent) company, are respectively:
Primers F 3 sequences are AACGGCTCGAACTTAGTACG;
Primer B3 sequence is TCGCGTCCACTGTGTAGT;
Primers F IP sequence is
GGACCCAACAGCGTGCATGTCCTGCTTGCAGGAAGGAAC；
Primer BIP sequence is
TCTGGACCTTTTTTGGTCGGCCTCTCAAAGTACGGGCGGTA。
GlodView dyes concentration of the present invention is purchased the company in Suo Laibao for 1000 times of GlodView mother liquor dilutions.
The present invention has designed 4 Auele Specific Primers according to sugarcane dwarfing pathogenic bacterium ITS sequence, carries out replacement(metathesis)reaction under the effect of Bst polysaccharase, so the specificity height.Needed instrument is a whizzer simultaneously, water-bath, and more much lower than real-time PCR for the requirement of instrument, Jian Yan the cost method of inspection more in the past is low, simple to operate simultaneously.Operant level requirement for the testing staff is not very high, and popularity rate is wide, particularly is suitable for the quick accurate detecting method that sugarcane ratoon stunting disease is detected in the field.
Embodiment
Embodiment 1
1, chooses perennial root cultivation sugarcane and be suspected to be the sugarcane strain 1 that contains the dwarfing pathogenic bacteria, get its cane stalk, clean surface impurity, peeling from root the 3rd joint.70% ethanol wiping sterilization.
2, will be cut into small pieces through the sterilization sugarcane, put into mortar, and add the 100ml liquid nitrogen flash freezer and be ground to Powdered.
3,, in the sterilized 50ml centrifuge tube of packing into, add 20ml TE damping fluid, 80 ℃ of water-bath heating 60min with powder 10 grams.In the normal temperature whizzer, with the centrifugal 10min of the centrifugal force of 12000 * g.Getting supernatant liquor 20ml manages in the sterilized 50ml centrifuge tube to another.
4, the β mercaptoethanol chloroformic solution that adds 20ml is in the normal temperature whizzer, with the centrifugal 10min of the centrifugal force of 12000 * g.Get supernatant liquor 15ml to the sterilized 50ml centrifuge tube of another pipe.
5, the chloroformic solution that adds 15ml is in the normal temperature whizzer, with the centrifugal 10min of the centrifugal force of 12000 * g.Getting supernatant liquor 10ml moves in the sterilized 50ml centrifuge tube of another pipe.
6, be equipped with in the supernatant liquor centrifuge tube in the last step, add the dehydrated alcohol of 20ml and the sodium-acetate of 1ml ,-20 ℃ leave standstill 30min.
7, in the normal temperature whizzer, with the centrifugal 30min of the centrifugal force of 12000 * g, remove supernatant liquor, throw out contains the powder thing of DNA with 5ml70% washing with alcohol twice, at room temperature dry acquisition.
8, in sterilized 1.5ml centrifuge tube, add the powder thing that the sterilized deionized water dissolving of 100 μ l contains DNA.As the template DNA that goes on foot the LAMP amplification down.
9, LAMP amplification: the LAMP amplification system is that primers F 3, the 0.25 μ l concentration of 20 μ mol/L is that the primer B3, the primers F IP that 1 μ l concentration is 20 μ mol/L, the primer BIP that 1 μ l concentration is 20 μ mol/L, triphosphoric acid dezyribonucleoside (dNTP), the 4 μ l concentration that 3 μ l concentration are 2.5mmol/L of 20 μ mol/L is the MgCl of 25mmol/L by 1 μ l template DNA, 1 μ l Bst polysaccharase, 0.25 μ l concentration
2, the sterilized deionized water of 2.5 μ l, 10 * isothermal duplication damping fluid (ThermoPol Buffer), 11 μ l forms.
Prepare the LAMP amplification system in sterilized 0.2ml centrifuge tube after, heated constant temperature is 60 ℃ in water-bath, amplification 60min.
10, identify: the fluorescence dye GlodView that in the centrifuge tube that amplification finishes, adds 1000 times of 1 μ l dilutions.Visual inspection under the paper money genuineness testing pencil UV-irradiation, its solution become existing tangible yellowish green fluorescence, illustrate detected sugarcane sample contain the dwarfing pathogenic bacteria (
Leifsonia xyli subsp.xyli).
Embodiment 2
1, chooses and be suspected to be the perennial root sugarcane strain 2 that contains the dwarfing pathogenic bacteria, get its cane stalk, clean surface impurity, peeling from root the 3rd joint.70% ethanol wiping sterilization.
2, will be cut into small pieces through the sterilization sugarcane, put into mortar, and add the 100ml liquid nitrogen flash freezer and be ground to Powdered.
3,, in the sterilized 50ml centrifuge tube of packing into, add 20ml TE damping fluid, 80 ℃ of water-bath heating 60min with powder 10 grams.In the normal temperature whizzer, with the centrifugal 10min of the centrifugal force of 12000 * g.Getting supernatant liquor 20ml manages in the sterilized 50ml centrifuge tube to another.
4, the β mercaptoethanol chloroformic solution that adds 20ml is in the normal temperature whizzer, with the centrifugal 10min of the centrifugal force of 12000 * g.Get supernatant liquor 15ml to the sterilized 50ml centrifuge tube of another pipe.
5, the chloroformic solution that adds 15ml is in the normal temperature whizzer, with the centrifugal 10min of the centrifugal force of 12000 * g.Get supernatant liquor 10ml to the sterilized 50ml centrifuge tube of another pipe.
6, be equipped with in the supernatant liquor centrifuge tube in the last step, add the dehydrated alcohol of 20ml and the sodium-acetate of 1ml ,-20 ℃ leave standstill 30min.
7, in the normal temperature whizzer, with the centrifugal 30min of the centrifugal force of 12000 * g, remove supernatant liquor, throw out contains the powder thing of DNA with 5ml70% washing with alcohol twice, at room temperature dry acquisition.
8, in sterilized 1.5ml centrifuge tube, add the powder thing that the sterilized deionized water dissolving of 100 μ l contains DNA.As the template DNA that goes on foot the LAMP amplification down.
9, LAMP amplification: the LAMP amplification system is that primers F 3, the 0.25 μ l concentration of 20 μ mol/L is that the primer B3, the primers F IP that 1 μ l concentration is 20 μ mol/L, the primer BIP that 1 μ l concentration is 20 μ mol/L, triphosphoric acid dezyribonucleoside (dNTP), the 4 μ l concentration that 3 μ l concentration are 2.5mmol/L of 20 μ mol/L is the MgCl of 25mmol/L by 1 μ l template DNA, 1 μ l Bst polysaccharase, 0.25 μ l concentration
2, the sterilized deionized water of 2.5 μ l, 10 * isothermal duplication damping fluid (ThermoPol Buffer), 11 μ l forms.
Prepare the LAMP amplification system in sterilized 0.2ml centrifuge tube after, heated constant temperature is 65 ℃ in water-bath, amplification 70min.
10, identify: the fluorescence dye GlodView that in the centrifuge tube that amplification finishes, adds 1000 times of 1 μ l dilutions.Visual inspection under the paper money genuineness testing pencil UV-irradiation, its solution no change is the water white transparency shape, illustrate detected sugarcane sample do not contain the dwarfing pathogenic bacteria (
Leifsonia xyli subsp.xyli).
Embodiment 3
1, chooses and be suspected to be the perennial root sugarcane strain 3 that contains the dwarfing pathogenic bacteria, get its cane stalk, clean surface impurity, peeling from root the 3rd joint.70% ethanol wiping sterilization.
2, will be cut into small pieces through the sterilization sugarcane, put into mortar, and add the 100ml liquid nitrogen flash freezer and be ground to Powdered.
3,, in the sterilized 50ml centrifuge tube of packing into, add 20ml TE damping fluid, 80 ℃ of water-bath heating 60min with powder 10 grams.In the normal temperature whizzer, with the centrifugal 10min of the centrifugal force of 12000 * g.Getting supernatant liquor 20ml manages in the sterilized 50ml centrifuge tube to another.
4, the β mercaptoethanol chloroformic solution that adds 20ml is in the normal temperature whizzer, with the centrifugal 10min of the centrifugal force of 12000 * g.Get supernatant liquor 15ml to the sterilized 50ml centrifuge tube of another pipe.
5, the chloroformic solution that adds 15ml is in the normal temperature whizzer, with the centrifugal 10min of the centrifugal force of 12000 * g.Get supernatant liquor 10ml to the sterilized 50ml centrifuge tube of another pipe.
6, be equipped with in the supernatant liquor centrifuge tube in the last step, add the dehydrated alcohol of 20ml and the sodium-acetate of 1ml ,-20 ℃ leave standstill 30min.
7, in the normal temperature whizzer, with the centrifugal 30min of the centrifugal force of 12000 * g, remove supernatant liquor, throw out contains the powder thing of DNA with 5ml70% washing with alcohol twice, at room temperature dry acquisition.
8, in sterilized 1.5ml centrifuge tube, add the powder thing that the sterilized deionized water dissolving of 100 μ l contains DNA.As the template DNA that goes on foot the LAMP amplification down.
9, LAMP amplification: the LAMP amplification system is that primers F 3, the 0.25 μ l concentration of 20 μ mol/L is that the primer B3, the primers F IP that 1 μ l concentration is 20 μ mol/L, the primer BIP that 1 μ l concentration is 20 μ mol/L, triphosphoric acid dezyribonucleoside (dNTP), the 4 μ l concentration that 3 μ l concentration are 2.5mmol/L of 20 μ mol/L is the MgCl of 25mmol/L by 1 μ l template DNA, 1 μ l Bst polysaccharase, 0.25 μ l concentration
2, the sterilized deionized water of 2.5 μ l, 10 * isothermal duplication damping fluid (ThermoPol Buffer), 11 μ l forms.
Prepare the LAMP amplification system in sterilized 0.2ml centrifuge tube after, heated constant temperature is 65 ℃ in water-bath, amplification 70min.
10, identify: the fluorescence dye GlodView that in the centrifuge tube that amplification finishes, adds 1000 times of 1 μ l dilutions.Visual inspection under the paper money genuineness testing pencil UV-irradiation, its solution present tangible yellowish green fluorescence, illustrate detected sugarcane sample contain the dwarfing pathogenic bacteria (
Leifsonia xyli subsp.xyli).
Claims (7)
1. method that detects sugarcane dwarfing pathogenic bacteria is characterized in that:
1) chooses the cane stalk of detected sugarcane, clean surface impurity, peeling, 70% ethanol wiping sterilization from root the 3rd joint;
2) will be cut into small pieces through the sterilization sugarcane, put into mortar, and add the 100ml liquid nitrogen flash freezer and be ground to Powdered;
3) with powder 10g, among the 50ml centrifuge tube A that packs into, add 20ml TE damping fluid, 80 ℃ of water-baths heat 60 min, and centrifugal 10min moves to supernatant liquor among the 50ml centrifuge tube B;
4) in centrifuge tube B, add isopyknic β mercaptoethanol chloroformic solution, centrifugal 10min.Getting supernatant liquor 15ml moves among the 50ml centrifuge tube C;
5) add isopyknic chloroformic solution in centrifuge tube C, centrifugal 10min gets supernatant liquor 10ml and moves among the 50ml centrifuge tube D;
6) be equipped with among the supernatant liquor centrifuge tube D in the last step, add the dehydrated alcohol of 20ml and the sodium-acetate of 1ml respectively ,-20 ℃ leave standstill 30min;
7) centrifugal 30min removes supernatant liquor, and throw out contains the powder thing of DNA with washing with alcohol twice, at room temperature dry acquisition;
8) in 1.5ml centrifuge tube E, add the dry powder thing 1mg that obtains to contain DNA, inject the sterilized deionized water of 100 μ l, concussion dissolved powders thing, the template DNA when increasing as LAMP;
9) LAMP amplification: in the 0.2ml centrifuge tube of LAMP amplification system is housed, add 1 μ l template DNA, behind the mixing, place 60 ℃ of-65 ℃ of thermostatically heating of water-bath to increase, proliferation time is 60-70min;
10) detecting product identifies: the fluorescence dye GlodView solution that adds 1000 times of the pre-dilutions of 1 μ l in the centrifuge tube that amplification finishes.
2. a kind of method that detects sugarcane dwarfing pathogenic bacteria according to claim 1 is characterized in that described LAMP amplification system is by 1 μ l Bst polysaccharase, 0.25 μ l concentration is the primers F 3 of 20 μ mol/L, 0.25 μ l concentration is the primer B3 of 20 μ mol/L, 1 μ l concentration is the primers F IP of 20 μ mol/L, 1 μ l concentration is the primer BIP of 20 μ mol/L, 3 μ l concentration are the triphosphoric acid dezyribonucleoside of 2.5 mmol/L, 4 μ l concentration are the MgCl2 of 25 mmol/L, 2.5 μ l 10 * isothermal duplication damping fluid and 11 μ l deionized waters are formed.
3. a kind of method that detects sugarcane dwarfing pathogenic bacteria according to claim 2 is characterized in that described primers F 3 sequences are AACGGCTCGAACTTAGTACG.
4. a kind of method that detects sugarcane dwarfing pathogenic bacteria according to claim 2 is characterized in that described
Primer B3 sequence is TCGCGTCCACTGTGTAGT.
5. a kind of method that detects sugarcane dwarfing pathogenic bacteria according to claim 2 is characterized in that described
Primers F IP sequence is GGACCCAACAGCGTGCATGTCCTGCTTGCAGGAAGGAAC.
6. a kind of method that detects sugarcane dwarfing pathogenic bacteria according to claim 2 is characterized in that described
Primer BIP sequence is TCTGGACCTTTTTTGGTCGGCCTCTCAAAGTACGGGCGGTA.
7. a kind of method that detects sugarcane dwarfing pathogenic bacteria according to claim 1 is characterized in that described β mercaptoethanol chloroformic solution composition is β mercaptoethanol: chloroformic solution=1:24.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105221924A CN101984074A (en) | 2010-10-28 | 2010-10-28 | Method for detecting pathogen of sugarcane ratoon stunting disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105221924A CN101984074A (en) | 2010-10-28 | 2010-10-28 | Method for detecting pathogen of sugarcane ratoon stunting disease |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101984074A true CN101984074A (en) | 2011-03-09 |
Family
ID=43641244
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105221924A Pending CN101984074A (en) | 2010-10-28 | 2010-10-28 | Method for detecting pathogen of sugarcane ratoon stunting disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101984074A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102312016A (en) * | 2011-10-18 | 2012-01-11 | 福建农林大学 | Real-time fluorescence quantitative PCR method for detecting sugarcane ratoon stunning disease |
| CN102965436A (en) * | 2012-11-16 | 2013-03-13 | 福建农林大学 | Isothermal amplification method for detecting cry1Ac-transfected sugarcane |
| CN103088115A (en) * | 2011-11-01 | 2013-05-08 | 台湾糖业股份有限公司 | Method for detecting pathogen and kit |
| WO2014066481A1 (en) * | 2012-10-24 | 2014-05-01 | Syngenta Participations Ag | Methods and kits for detection of a pathogen in sugarcane |
| CN106676184A (en) * | 2017-02-14 | 2017-05-17 | 福建省亚热带植物研究所 | Method for detecting and locating leifsonia xyli subsp.xyli LXX |
-
2010
- 2010-10-28 CN CN2010105221924A patent/CN101984074A/en active Pending
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102312016A (en) * | 2011-10-18 | 2012-01-11 | 福建农林大学 | Real-time fluorescence quantitative PCR method for detecting sugarcane ratoon stunning disease |
| CN102312016B (en) * | 2011-10-18 | 2013-01-02 | 福建农林大学 | Real-time fluorescence quantitative PCR method for detecting sugarcane ratoon stunning disease |
| CN103088115A (en) * | 2011-11-01 | 2013-05-08 | 台湾糖业股份有限公司 | Method for detecting pathogen and kit |
| CN103088115B (en) * | 2011-11-01 | 2016-06-08 | 台湾糖业股份有限公司 | The method of detection cause of disease and test kit |
| WO2014066481A1 (en) * | 2012-10-24 | 2014-05-01 | Syngenta Participations Ag | Methods and kits for detection of a pathogen in sugarcane |
| CN102965436A (en) * | 2012-11-16 | 2013-03-13 | 福建农林大学 | Isothermal amplification method for detecting cry1Ac-transfected sugarcane |
| CN106676184A (en) * | 2017-02-14 | 2017-05-17 | 福建省亚热带植物研究所 | Method for detecting and locating leifsonia xyli subsp.xyli LXX |
| CN106676184B (en) * | 2017-02-14 | 2019-08-16 | 福建省亚热带植物研究所 | A method of it detects and positions sugarcane ratoon stunting disease pathogenic bacteria LXX |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101984074A (en) | Method for detecting pathogen of sugarcane ratoon stunting disease | |
| CN105331714B (en) | A kind of peronophythora litchi LAMP primer and its rapid detection method | |
| CN108060257A (en) | It is a kind of that strong male rotten mould Primer composition and its detection method are detected based on loop-mediated isothermal amplification technique | |
| CN104630388A (en) | Dengue virus rapid classification identification detection kit | |
| CN104726581A (en) | Vibrio parahaemolyticus constant-temperature detection primer set, detection kit and detection method capable of avoiding false negative detection result | |
| CN103627818B (en) | The LAMP kit of detection Main Subtype avian leukosis virus | |
| CN103436602A (en) | Kit and method for simultaneous detection of Staphylococcus aureus gene and Escherichia coli gene by using dual molecular beacon-LAMP process | |
| CN102899416B (en) | Cucumber phytophthora LAMP (Loop-mediated Isothermal Amplification) primer and rapid detection method thereof | |
| CN106119408A (en) | A kind of authentication method of Herba Dendrobii | |
| CN105177179A (en) | RT-LAMP primer group and kit for detecting porcine epidemic diarrhea virus and application thereof | |
| CN104988246A (en) | Eriocheir sinensis white spot syndrome virus specificity PCR detection kit and method | |
| CN103320435A (en) | Listeria monocytogenes LAMP (loop-mediated isothermal amplification) detection kit containing internal standard | |
| CN102676664A (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| CN104531885A (en) | Aeromonas veronii rapid detection primer, kit and application | |
| CN101974644A (en) | Staphylococcus aureus enterotoxin gene PCR (Polymerase Chain Reaction) parting detection kit and method | |
| CN104328175A (en) | Loop-mediated isothermal amplification (LAMP) primers, kit and method for detecting mouse Klebsiella pneumoniae | |
| CN102108402B (en) | Kit and detection method for detecting vibrio harveyi | |
| CN103571943A (en) | Nucleic acid detection method for salmonella typhimurium | |
| CN103451310B (en) | Gene chip capable of simultaneously detecting various vibrios and method for detecting vibrios | |
| CN102312016B (en) | Real-time fluorescence quantitative PCR method for detecting sugarcane ratoon stunning disease | |
| CN104531860B (en) | A kind of molecular detecting method of Shigella and its application | |
| CN103215358A (en) | Diarrheogenic escherichia coli detection kit and detection and typing method thereof | |
| CN105603091A (en) | Vibrio cholerae multiplex fluorescence PCR detection kit as well as preparation and application thereof | |
| CN100386442C (en) | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus | |
| CN105648054A (en) | Vibrio cholerae fluorescence PCR detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110309 |