CN101967492A - Simple and easy solubility expression and purifying method for recombinant human amyloid polypeptide A beta 42 - Google Patents

Abstract

The invention belongs to the field of biotechnology, and provides a simple and easy solubility expression and purifying method for recombinant human amyloid polypeptide A beta 42, which comprises the construction, inversion, sieving, expression and purifying of a recombinant vector. The method comprises the following specific steps of: (1) inserting a nucleotide coding sequence of a 6His-SUMO-A beta 42 fusion gene into a polyclonal locus of an expression vector to obtain the plasmid of recombinant expression vector; (2) transferring the plasmid of the recombinant expression vector obtained in the step (1) into a colon bacillus expression strain to obtain an A beta 42 pronucleus expression strain capable of performing coexpression with a molecular chaperone; and (3) inducing the expression of SUMO-A beta 42 fusion protein and the molecular chaperone, and purifying by using a column. The simple and easy solubility expression and purifying method realizes the solubility expression of hydrophobic A beta 42 polypeptide, has a simple purifying step, high production efficiency and low cost, and provides the excellent foundation for the study of the pathogenesis of AD diseases and corresponding medicament development.

Description

The simple and easy solubility expression purification process of recombinant human amyloid polypeptide A β 42

Technical field

The invention belongs to biological technical field, relate to technology such as the solubility expression of hydrophobicity polypeptide and purifying, be specifically related to the technology such as solubility expression, purifying and evaluation of recombinant human amyloid polypeptide A β 42.

Background technology

A Zihaimo disease (Alzheimer ' s disease is called for short AD) claims Alzheimer, the whole world that 2,400 ten thousand sufferers are arranged again, is a kind of persistence neurological dysfunction.The most significant early symptom is forgetful, is usually expressed as the short-term memory disappearance that increases gradually, and long-term memory then is not subjected to the influence of the state of an illness relatively.Along with increasing the weight of of the state of an illness, patient's language ability, spatial discrimination, cognitive ability can progressively fail.Along with improving constantly of people's living standard, society is tending towards aging, and Alzheimers has become the important cause of death.The origin cause of formation of disease is not bright, does not have the method for accurately diagnosis and effective treatment at present.At present, the cause of disease of this disease and methods of treatment have become the focus that the researchist pays close attention in the world wide.

The pathogenesis of senile dementia still imperfectly understands at present, but generally accepted viewpoint is, it and protein false folding and the amyloid aggregation precipitation that causes is closely related.Glenner at first successfully isolated the amyloid polypeptide that relative molecular weight is about 4.2kD from AD patient's cerebrospinal fluid in 1984, and measured its sequence, owing to contain a large amount of β-sheet lamella in its structure, so be called beta-amyloid polypeptide 1-(β-amyloid, A β).The principal character of senile dementia demonstrates the cerebral tissue atrophy on pathology, phenomenons such as senile plaque appear in pallium.Discover that senile plaque is that the deposition of A amyloid beta causes.Early stage research is thought, formation mechanism and influence factor according to the A amyloid beta, design prevents amyloid beta deposition, and remove established patch, just can reach prevention and treatment senile dementia, yet the clinical experiment data that nearest senile plaque is removed medicine show, what the removing of senile plaque did not have clear improvement that illness, prolongs life really play damaging action to neurocyte is a of oligomerization.

The A beta polypeptides derive from the amyloid-beta precursor protein (β-amyloid precursor protein, APP), APP through β-and the gamma-secretase enzyme cut a kind of little peptide of generation.This little peptide comprises 39-43 amino-acid residue, has very strong hydrophobicity, and the A β 42 that is made up of 42 residues is considered to the easiest to be folding, so A β 42 also is considered to produce the principal element of senile plaque.When A β 42 took place to assemble, oligomer and aggregate may cause the oxidation of biomacromolecules such as protein and lipid, finally cause apoptosis in neuronal.Therefore, A β 42 polypeptide become the focus of researchs such as senile dementia pathogenesis and corresponding treatment drug development.

Now, have many based on oxidation-resistance with remove metal ion and suppress a accumulative method and come the developing new drug thing, but whether these medicines effectively also unknown to improving symptom.Some natural drug is for a long time always as must the making up a prescription of Chinese traditional treatment senile dementia, as curcumine, catechol etc.Document announcement is arranged, and Indian's senile dementia sickness rate is on the low side than other areas, may be relevant for edible seasoning matter with turmeric for a long time with them.This class natural drug effective constituent mostly is the molecule with conjugation ketenes or phenolic ketone structure, and strong complex ability to metal ion is arranged.People explore possible paathogenic factor, seek possible medicine, so the research of relevant A β at first needs to obtain high purity A beta polypeptides as research object with a.

Owing to A β 42 peptide Cs end 33-42 amino acids residue has very high hydrophobicity, assemble easily the A β 42 polypeptide dissolving back that directly is dissolved in the aqueous solution, forms the throw out of insolubility, and this synthesizes to it and purifying has caused difficulty.At present, research and clinical in the high purity A β that uses normally adopt chemosynthesis with two kinds of gene recombination biosynthesizing, but the chemical synthesis process productive rate is lower, cost is expensive, and the method for dna recombinant expression then is difficult to the solubility expression target protein, efficient is lower.

Summary of the invention

The object of the present invention is to provide the solubility expression method of a kind of recombinant human amyloid polypeptide A β 42.

The invention provides the simple and easy solubility expression purification process of a kind of recombinant human amyloid polypeptide A β 42, comprise construction of recombinant vector, conversion and screening, expression and purification, step is as follows:

(1) nucleotide coding sequence of 6His-SUMO-A β 42 fusion genes is inserted the multiple clone site of expression vector, obtain the recombinant expression vector plasmid;

(2) the recombinant expression vector plasmid that (1) is obtained changes the escherichia coli expression bacterial strain over to, obtain can with the A β 42 prokaryotic expression bacterial strains of molecular chaperones coexpression;

(3) induce the expression of SUMO-A β 42 fusion roteins and molecular chaperones, cross column purification.

Among the present invention, 6His-SUMO-A β 42 fusion genes can obtain by chemical synthesis process, promptly follow according to its encoding sequence, obtain with artificial synthesis.For example, nucleic acid molecule is connected one by one, obtain the dna molecular of sequence such as SEQ ID NO 3 according to the sequence of SEQ ID NO 3.

6 histidine residues (His) can be simplified the purifying of SUMO-A β 42 fusion roteins, help the purification of target polypeptides A β 42.

SUMO is a yeast small molecules ubiquitin relevant modifications albumen.Because SUMO albumen has the function that helps the target protein solubility expression, so, utilize this expression vector can realize hydrophobicity polypeptide and proteinic solubility expression, the polypeptide and the proteinic gene recombination that can be used to be difficult to chemosynthesis are synthetic, the gene engineering polypeptide that also can be used for biologically active, has with native conformation and the production of pharmaceutical grade protein.In addition, the SUMO fusion rotein can seldom be contained an amino acid whose desired polypeptides after enzyme is cut, and can avoid traditional and add the shortcoming that the Thrombin restriction enzyme site can't seldom be contained an amino acid whose desired polypeptides with gst fusion protein.

Among the present invention, described expression vector is pET21b.Also can adopt similar coli expression carrier.

Among the present invention, described expression strain is E coli.BL21 (DE3)-groES-groEL-tig.

Among the present invention, described molecular chaperones is groES-groEL-tig.The molecular chaperones technology is to improve the conventional means of target protein solubility expression.In present method, we select this molecular chaperones system of groES-groEL-tig (Tf2) for use, have improved the solubility expression amount of SUMO-A β 42 fusion roteins greatly.

The present invention uses sec.-propyl-β-thiogalactoside (IPTG) to carry out abduction delivering.

Among the present invention, the described column purification of crossing was divided into for two steps: cross affinity column after the cytoclasis earlier and carry out purifying, and then be further purified and obtain desired polypeptides A β 42 with Superdex 200 molecular sieve columns.

Among the present invention, the recombinant human amyloid polypeptide A β 42 of gained can be identified by Tricine-SDS-PAGE electrophoresis or MALDI-TOF-TOF (substance assistant laser desorpted ionized time-of-flight mass spectrometry) method.

The present invention also provides the expression vector of a kind of recombinant human amyloid polypeptide A β 42, this expression vector is that the multiple clone site that the nucleotide coding sequence of 6His-SUMO-A β 42 fusion genes inserts expression vector pET21b is obtained, and is called pET21b-SUMO/A β 42.Its structural representation as shown in Figure 1.

Particularly, solubility expression and the purifying of recombinant human amyloid polypeptide A β 42 of the present invention, the structure that comprises solubility expression carrier, molecular chaperones is assisted soluble-expression, the prokaryotic expression and the purifying of SUMO-A β 42 fusion roteins, the enzyme of SUMO-A β 42 fusion roteins is cut, the purifying and the evaluation of A β 42 polypeptide.Be respectively described below:

Step 1: the structure of solubility expression carrier

(1) chemosynthesis 6His-SUMO-A β 42 fusion genes at first.Sequence is as follows:

ATGCACCATCATCATCATCATATGTCGGACTCAGAAGTCAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGATCTTCAGAGATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAAAAGACAGGGTAAGGAAATGGACTCCTTAAGATTCTTGTACGACGGTATTAGAATTCAAGCTGATCAGACCCCTGAAGATTTGGACATGGAGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGTGGCGATGCGGAATTTCGCCATGATTCTGGCTATGAAGTGCATCATCAGAAACTGGTGTTTTTTGCGGAAGATGTGGGCTCTAACAAAGGCGCGATTATTGGCCTGATGGTGGGCGGCGTGGTGATAGCATGA(SEQID?NO?3)

(2) design of primers and PCR: according to synthetic dna sequence dna design primer, institute's synthetic gene is cloned on the β ET21b expression vector, restriction enzyme site is selected NdeI and SacI, and primer sequence is as follows:

Forward primer SUMO/A β 42-F (NdeI): TTCCATATGCACCATCATCATCATCAAT (SEQ ID NO 1);

Reverse primer SUMO/A β 42-R (SacI): TACGAGCTCTCATGCTATCACCACGCCGC (SEQ IDNO 2).

DNA with chemosynthesis is that template is carried out pcr amplification, and the product fragment length is about 440bp.The PCR product is behind agarose gel electrophoresis, and glue purification reclaims the PCR product.The purpose fragment and the pET21b carrier that reclaim are used NdeI and SacI double digestion respectively, and behind agarose gel electrophoresis, glue purification recovery enzyme is cut product and carried out ligation, connect product and transform Top10 competent cell, ice bath 30min, 42 ℃, 1min, ice bath 2min adds 400 μ l LB liquid nutrient mediums, 250rpm cultivates 1h for 37 ℃, the LB flat board of coating Amp resistance, 37 ℃ of overnight incubation, picking list bacterium colony in the LB liquid nutrient medium of 5mL, 250rpm, 37 ℃ of incubated overnight.PCR checks order after identifying positive colony.Order-checking identifies that correct pET21b-SUMO positive colony extracting plasmid is standby.

(3) acquisition of A β 42 prokaryotic expression bacterial strains: will check order and identify correct pET21b-SUMO/A β 42 positive colony extracting plasmids, this recombinant plasmid is changed among expression strain E coli.BL21 (DE3)-groES-groEL-tig, obtain can with A β 42 prokaryotic expression bacterial strain BL21 (the DE3)-Tf2/A β 42 of molecular chaperones groES-groEL-tig (Tf2) coexpression

Step 2: the prokaryotic expression and the purifying of SUMO-A β 42 fusion roteins

(4) prokaryotic expression of SUMO-A β 42 fusion roteins: adopt sec.-propyl-β-thiogalactoside (IPTG) to induce Expression of Fusion Protein, simultaneously, can significantly increase the solubility expression amount of fusion rotein with the coexpression of molecular chaperones groES-groEL-tig (Tf2), low temperature induction is spent the night, colibacillary medium centrifugal is received bacterium, obtain containing the coli somatic of SUMO-A β 42 fusion roteins;

(5) purifying of SUMO-A β 42 fusion roteins: the gained coli somatic is resuspended in the buffered soln, and carrying out ultrasonic bacteria breaking in the ice bath is collected supernatant liquor; Supernatant liquor is crossed Ni-NTA (Qiagen) affinity column, behind buffered soln thorough washing pillar, wash 2 column volumes with the Buffer A that contains the 10mM imidazoles again, add a kind of SUMO specific protease YULP1 enzyme subsequently, carrying out on the post enzyme cuts and spends the night, carry out wash-out with buffered soln in second day, and collected elutriant, promptly obtain A β 42 polypeptide of preliminary purification;

(6) the molecular sieve column purifying of A β 42 polypeptide: will carry out further purifying through the Superdex200 post through A β 42 albumen that the Ni-NTA column purification obtains, and obtain purity at last and be about 42 polypeptide above 90%A β.

Step 3: the evaluation of A β 42 polypeptide

(7) the Tricine-SDS-PAGE electrophoresis is identified: A β 42 polypeptide that per step purifying obtains all carry out three layers of gel electrophoresis to determine purity and molecular weight, and electrophoresis result shows that the molecular weight of A β 42 polypeptide is near 5kDa;

(8) MALDI-TOF-TOF identifies: corresponding A β 42 polypeptide bands are cut down from the running gel and carry out mass spectroscopy, qualification result shows that we are A β 42 polypeptide by resulting purpose product really;

The reagent of above-mentioned use does not indicate the source especially, by commercially available acquisition.Operation steps and detailed description, all according to cold spring harbor laboratory's handbook---operate as " molecular cloning ", " antibody " and " cell ".

The invention provides can prokaryotic expression the construction process of prokaryotic expression plasmid of human amyloid polypeptide A β 42, and solubility expression carrier imported escherichia expression system, through abduction delivering, enzyme cut and purifying after obtained bioactive target A β 42 polypeptide.The escherichia expression system of present method has the expression efficiency height, and expression amount is big, easy handling, and characteristics such as cost is lower, expressed A β 42 peptide purification steps are simple, the productive rate advantages of higher.These A β 42 polypeptide can be used in the research of senile dementia pathogenesis and relative medicine exploitation.

Meaning of the present invention has been to realize the solubility expression of hydrophobicity A β 42 polypeptide, and the purification step of A β 42 polypeptide is simple, production efficiency is high, with low cost, for the research of AD disease pathogenesis and relative medicine exploitation provides good basis, promoter action has been played in the research of treatment of AD disease vaccine and drug screening.

Description of drawings

Fig. 1 pET21b-SUMO/A β 42 plasmid construction frame diagrams.

Embodiment

Embodiment 1:pET21b-SUMO/A β 42 plasmid constructions

(1) chemosynthesis 6His-SUMO-A β 42 fusion genes at first.

(2) design of primers and PCR: according to synthetic dna sequence dna design primer, institute's synthetic gene is cloned on the PET21B expression vector, restriction enzyme site is selected NdeI and SacI, and primer sequence is as follows:

Forward primer SUMO/A β 42-F (NdeI): TTCCATATGCACCATCATCATCATCAAT (SEQ ID NO1); Reverse primer SUMO/A β 42-R (SacI): TACGAGCTCTCATGCTATCACCACGCCGC (SEQ ID NO2).

DNA with chemosynthesis is that template is carried out pcr amplification, and the product fragment length is about 440bp.The PCR product is behind agarose gel electrophoresis, and glue purification reclaims the PCR product.The purpose fragment and the pET21b carrier that reclaim are used NdeI and SacI double digestion respectively, and behind agarose gel electrophoresis, glue purification recovery enzyme is cut product and carried out ligation, connect product and transform Top10 competent cell, ice bath 30min, 42 ℃, 1min, ice bath 2min adds 400 μ l LB liquid nutrient mediums, 250rpm cultivates 1h for 37 ℃, the LB flat board of coating Amp resistance, 37 ℃ of overnight incubation, picking list bacterium colony in the LB liquid nutrient medium of 5mL, 250rpm, 37 ℃ of incubated overnight.PCR checks order after identifying positive colony.After order-checking confirms that construction of recombinant expression plasmid is correct, the recombinant plasmid that builds transduceed protect kind into the amplification of DH5 α bacterial strain, it is standby to extract plasmid pET21b-SUMO/A β 42 then.

(3) acquisition of the prokaryotic expression bacterial strain of A β 42: the plasmid (pG-Tf2) that at first will contain molecular chaperones groES-groEL-tig changes E.coli BL21 (DE3) bacterial strain over to, obtain expression strain E coli.BL21 (DE3)-groES-groEL-tig (Tf2), then recombinant plasmid pET21b-SUMO/A β 42 transductions that build are gone among expression strain E coli.BL21 (DE3)-groES-groEL-tig (Tf2), promptly obtain prokaryotic expression bacterial strain pET21b-SUMO (pG-Tf2)/A β 42/BL21 of A β 42.

The prokaryotic expression and the purifying of embodiment 2:SUMO-A β 42 fusion roteins.

(4) the proteic expression of Target Fusion: express optimization expression condition (comprising selecting for use, express temperature, inductive condition, expression time of molecular chaperones) at first in advance, increase the proteic expression amount of solubility Target Fusion as far as possible, come great expression Target Fusion albumen according to the optimal expression condition then.The process that adopts during great expression is: the prokaryotic expression bacterial strain pET21b-SUMO (pG-Tf2) of A β 42 that will build and molecular chaperones groES-groEL-tig (Tf2)/A β 42/BL21 is respectively at 37 ℃ of cultivations, fresh bacterium was by inoculation in 1: 100, it is 0.8-1.0 that jolting is cultured to OD600, the incubator temperature is reduced to 16 ℃, the IPTG that adds 1mM then induces, and spend the night (15h) expresses, and be last, the centrifugal 1h of 3500rpm collects thalline.

(5) purifying of SUMO-A β 42 fusion roteins: with the gained coli somatic be resuspended in buffered soln (Buffer A:10mM pH7.2, Tris-HCl, 300mM NaCl, 5%Glycerol) in, carrying out ultrasonic bacteria breaking in the ice bath is collected supernatant liquor; Supernatant liquor is crossed Ni-NTA (Qiagen) affinity column, behind Buffer A thorough washing pillar, wash 2 column volumes with the BufferA that contains the 10mM imidazoles again, add a kind of SUMO specific protease YULP1 enzyme in about 1: 500 ratio subsequently, carrying out on the post enzyme under 4 ℃ cuts and spends the night, carry out wash-out with the Buffer A that contains the 5mM imidazoles in second day, and collected elutriant, promptly obtain A β 42 albumen of purity about 85%;

(6) the molecular sieve column purifying of A β 42 polypeptide: will carry out further purifying through the Superdex200 post through A β 42 albumen that the Ni-NTA column purification obtains, use 10mM pH7.2Tris-HCl in this step purifying, 300mMNaCl carries out purifying as purifying buffer, obtains purity at last and is about 42 polypeptide above 90%A β.

The evaluation of embodiment 3:A β 42 polypeptide

(A) the Tricine-SDS-PAGE electrophoresis is identified: the protein solution after enzyme is cut and A β 42 polypeptide of purification carry out the Tricine-SDS-PAGE electrophoresis, and the result shows that enzyme cuts fully substantially, and the molecular weight of A β 42 polypeptide is between 3.5-6.5kDa.

(B) MALDI-TOF-TOF: pure A β 42 polypeptide are carried out determined amino acid sequence, confirm that its sequence is consistent with human amyloid polypeptide A β 42.

The focusing experiment of embodiment 4A β 42 polypeptide

Known fluorescent substance thioflavin (ThT) can combine with amyloid β-sheet structure specificity and significantly strengthen the fluorescence intensity of ThT, getting pure A β 42 polypeptide of 30 μ M is dissolved in the Buffer A buffered soln, getting two samples places-20,37 ℃ to hatch respectively 7 days, each group is got 20 μ l Incubating Solutions and the 180 μ l ThT solution with the BufferA configuration then, after vibrations mix, under excitation wavelength 445nm, emission wavelength 486nm condition, measure fluorescence intensity.

The result shows: A β 42 polypeptide that purifying obtains form aggregate down at 37 ℃.Consistent from A β 42 polypeptide that another angle explanation the present invention obtains with human amyloid polypeptide A β 42.

Sequence table

<210>1

<211>28

<212>DNA

<213>Artificial

<400>1

ttccatatgc?accatcatca?tcatcaat 28

<210>2

<211>29

<212>DNA

<213>Artificial

<400>2

tacgagctct?catgctatca?ccacgccgc 29

<210>3

<211>444

<212>DNA

<213>Artificial

<400>3

atgcaccatc?atcatcatca?tatgtcggac?tcagaagtca?atcaagaagc?taagccagag 60

gtcaagccag?aagtcaagcc?tgagactcac?atcaatttaa?aggtgtccga?tggatcttca 120

gagatcttct?tcaagatcaa?aaagaccact?cctttaagaa?ggctgatgga?agcgttcgct 180

aaaagacagg?gtaaggaaat?ggactcctta?agattcttgt?acgacggtat?tagaattcaa 240

gctgatcaga?cccctgaaga?tttggacatg?gaggataacg?atattattga?ggctcacaga 300

gaacagattg?gtggcgatgc?ggaatttcgc?catgattctg?gctatgaagt?gcatcatcag 360

aaactggtgt?tttttgcgga?agatgtgggc?tctaacaaag?gcgcgattat?tggcctgatg 420

gtgggcggcg?tggtgatagc?atga 444

Claims (8)

1. the simple and easy solubility expression purification process of a recombinant human amyloid polypeptide A β 42 comprises construction of recombinant vector, conversion and screening, expression and purification, it is characterized in that this method comprises the steps:

(1) nucleotide coding sequence of 6His-SUMO-A β 42 fusion genes is inserted the multiple clone site of expression vector, obtain the recombinant expression vector plasmid;

(2) the recombinant expression vector plasmid that (1) is obtained changes the escherichia coli expression bacterial strain over to, obtain can with the A β 42 prokaryotic expression bacterial strains of molecular chaperones coexpression;

(3) induce the expression of SUMO-A β 42 fusion roteins and molecular chaperones, cross column purification.

2. the simple and easy solubility expression purification process of recombinant human amyloid polypeptide A β 42 as claimed in claim 1 is characterized in that 6His-SUMO-A β 42 fusion genes are to obtain by chemical synthesis process.

3. the simple and easy solubility expression purification process of recombinant human amyloid polypeptide A β 42 as claimed in claim 1 is characterized in that described expression vector is pET21b.

4. the simple and easy solubility expression purification process of recombinant human amyloid polypeptide A β 42 as claimed in claim 1 is characterized in that, described escherichia coli expression bacterial strain is E coli.BL21 (DE3)-groES-groEL-tig.

5. the simple and easy solubility expression purification process of recombinant human amyloid polypeptide A β 42 as claimed in claim 1 is characterized in that described molecular chaperones is groES-groEL-tig.

6. the simple and easy solubility expression purification process of recombinant human amyloid polypeptide A β 42 as claimed in claim 1 is characterized in that, uses sec.-propyl-β-thiogalactoside to carry out abduction delivering.

7. the simple and easy solubility expression purification process of recombinant human amyloid polypeptide A β 42 as claimed in claim 1, it is characterized in that, the described column purification of crossing was divided into for two steps: cross affinity column after the cytoclasis earlier and carry out purifying, and then be further purified and obtain desired polypeptides A β 42 with Superdex 200 molecular sieve columns.

8. the expression vector of a recombinant human amyloid polypeptide A β 42 is characterized in that, this expression vector is that the multiple clone site that the nucleotide coding sequence of 6His-SUMO-A β 42 fusion genes inserts expression vector pET21b is obtained.

Images