CN101967481A - PCR (Polymerase Chain Reaction) primer for amplifying Rhodococcus and method for detecting Rhodococcus - Google Patents
PCR (Polymerase Chain Reaction) primer for amplifying Rhodococcus and method for detecting Rhodococcus Download PDFInfo
- Publication number
- CN101967481A CN101967481A CN 201010538254 CN201010538254A CN101967481A CN 101967481 A CN101967481 A CN 101967481A CN 201010538254 CN201010538254 CN 201010538254 CN 201010538254 A CN201010538254 A CN 201010538254A CN 101967481 A CN101967481 A CN 101967481A
- Authority
- CN
- China
- Prior art keywords
- rhodococcus
- primer
- pcr
- dna
- amplifying
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a PCR primer for amplifying Rhodococcus DNA (deoxyribonucleic acid), belonging to the field of microorganisms. The forward primer sequence of the PCR primer is shown as SEQ ID No.1, and the reverse primer sequence of the PCR primer is shown as SEQ ID No.2. The invention also provides a method of the primer for detecting the Rhodococcus. The primer is suitable for amplifying the purified Rhodococcus DNA and is also suitable for amplifying the Rhodococcus DNA from mixed flora, can be used for safely, accurately, rapidly and stably amplifying the Rhodococcus and has strong specificity and high sensitivity.
Description
Technical field
The present invention relates to microorganism field, the PCR primer of the rhodococcus that is specifically related to be used to increase and detect the method for rhodococcus.
Background technology
The Rhod bacterium belongs to actinomycetales rod bacillus suborder Nocardiaceae, is that a class is aerobic, asporogenic gram-positive microorganism, and minority may be caused a disease.Main member in the Rhod comprises: Rhodococcus coprophilus, Rhodococcus equi, the yellow rhodococcus of Teng, rhodococcus erythropolis etc.Rhodococcus has a quick relatively and simple growth cycle, can be used as experimental system and carries out scientific research.Most of rhodococcus can be growing in the environment widely, such as the desert, and water body etc.
Rhodococcus has important use and is worth, and a vital role of rhodococcus is bio-transformation.Rhodococcus can utilize the biosystem of self that raw material is carried out bio-transformation, if can utilize a lot of organism to generate steroid, acrylamide and vinylformic acid etc.Some environmental pollutant and organism such as alkane can be degraded and utilize to rhodococcus in addition, and rhodococcus can the deleterious environmental pollutant of metabolism, for example toluene, naphthalene etc., and relevant with the biological desulphurization effect of fossil oil.Its some kinds are all influential to people, animal or plant simultaneously.Therefore, rhodococcus is more and more paid close attention to by people.
In the prior art, following two kinds of methods that rhodococcus is identified commonly used are arranged:
1, physiological and biochemical index is identified.This method is present many Biochemical Labs method commonly used, and this method need obtain the pure growth of bacterial strain, and experimental period is long, and it is bigger that experimental result is subjected to artificially to observe influence factor, and accuracy is not high.
2, extracting bacterial strain DNA checks order.Be to carry out pcr amplification at present, the dna fragmentation that amplifies is checked order with the 16SrRNA gene primer.This method result is more accurate.But still need obtain the pure growth of bacterial strain, can't from biased sample, Rapid identification whether contain rhodococcus.
Therefore this area presses for a kind of method that can fast, accurately judge rhodococcus of developing.
Summary of the invention
The technical problem that will solve required for the present invention is to identify the deficiency of long, narrow application range of rhodococcus test period at prior art, provide a kind of can be fast, accurately, make things convenient for, can to whether containing the method that rhodococcus is judged fast in the biased sample.
For achieving the above object, the present inventor has designed a pair of PCR primer at conservative membranin (the conserved hypothetical membrane protein) gene fragment of rhodococcus imagination, its upstream primer: AATCCTCCTGAACGTGATCTG, its sequence is shown in SEQID No.1;
Downstream primer: CTATGCATAATTGACGCGGT, its sequence is shown in SEQ ID No.2.
Term of the present invention " primer " refers to the single stranded oligonucleotide sequence as the initiation site of synthetic primer extension products, itself and nucleic acid chains complementation to be duplicated, and length and sequence must be suitable for the synthetic of extension products.Primer is the single stranded RNA or the dna fragmentation of one section weak point, can be combined on the nucleic acid chains complementary zone with it, and its function is the starting point as the Nucleotide polymerization, and nucleic acid polymerase can begin synthetic new nucleic acid chains by its 3 ' end.It is synthetic etc. that the primer of external artificial design is widely used in polymerase chain reaction, order-checking and probe.
The conservative memebrane protein conserved hypothetical membrane protein gene of imagination is that one " imagination " that red coccus genome sequence carries out inferring according to bioinformatics after the sequence analysis guarded membrane protein gene sequence; This fragment sequence is conservative; Position in red coccus genome is 5076659-5077076, and its sequence is aa tcctcctgaa cgtgatctgg ctggtgttcggcggcttctg gctggcgttg ggttacttcg ccgcaggcat catctgctgc atcctcatca tcacgattcccttcggaatc gcggcattcc gcatcggcat ctacgcactg tggccgttcg gtaagaccgtcgtcgacaag ccgaccgctg gtgtcggttc gatgatcggc aatgtcatct gggtgatcatcgccggtatc tggttggcga tcggacacat cgtcaccgcc gtcgcgatgg cgatcacgatcatcggaatt ccgctcgcgg tcgcgaacct gaagatgatt ccgatctcgc tgatgccactcggcaaggag atcgtcgacg tggaccgcgt caattatgca tagccgtgga ccgcgtcaattacgcatagc cgtggaccgc gtcaattacg cgtaa (shown in SEQ ID No.3)
Discover through information biology, the primer of selecting the stencil design of nearly all small segment of other Rhod to go out does not possess specificity, lytic enzyme (putativehydrolase) such as inference, oxydo-reductase (oxygenase reductase) etc., and have only the primer of selecting this section stencil design to go out, have specificity preferably.
The present invention also provides a kind of method that detects rhodococcus, comprises following steps:
Step 1: prepare reaction system in following ratio:
PCR?buffer：10μL
dNTP：4μL
Upstream primer: 1 μ L
Downstream primer: 1 μ L
Sample DNA: 5 μ L
Taq：0.5μL
ddH
2O：28.5μL
Wherein, sample DNA concentration is 100-200ng/ μ L, and upstream primer and downstream primer concentration are 10-20pmol/ μ L, and described upstream primer sequence is shown in SEQ ID No.1, and the downstream primer sequence is shown in SEQ ID No.2;
30 PCR circulations were carried out in step 2:94 ℃ of pre-sex change in 10 minutes, and circulation finishes back 72 ℃ and extended 10 minutes;
Step 3: agarose electrophoresis detects amplification.
The loop parameter of PCR described in the step 2 is: 94 ℃ of sex change 1 minute, and 51 ℃ of renaturation 5 seconds, 72 ℃ were extended 25 seconds.
The described detection of step 3 occurs for detecting the band whether 440bp and 200bp are arranged.
With this primer is carried out pcr amplification to the genomic dna of rhodococcus pure growth extraction or total DNA of pedotheque, whether but can electrophoresis detection according to amplifying 440 and the target stripe of 200bp, can judge in pure growth or the pedotheque to be or not contain rhodococcus.Method is quick, and qualification result is stable, and specificity is good, and is highly sensitive, is 200 * 10 at dna profiling content
-2During ng, primer of the present invention still can accurately amplify rhodococcus DNA, not only is suitable for purifying rhodococcus DNA amplification, also is suitable for from mixed bacterial amplification rhodococcus DNA.
Description of drawings:
Fig. 1 shows that primer of the present invention is the amplified production gel electrophoresis figure of template with rhodococcus DNA; Swimming lane M is marker, and swimming lane 1-3 is a pedotheque, and swimming lane 4 is a saccharothrix DNA sample, and swimming lane 5-6 is a rhodococcus DNA sample.
Embodiment:
The invention discloses the method for the PCR primer and the detection rhodococcus of rhodococcus, those skilled in the art can use for reference this paper content, suitably improve processing parameter and realize.Special needs to be pointed out is that all similarly replace and change apparent to those skilled in the art, they all are regarded as being included in the present invention.Method of the present invention and application are described by preferred embodiment, the related personnel obviously can change or suitably change and combination methods and applications as herein described in not breaking away from content of the present invention, spirit and scope, realizes and use the technology of the present invention.
Below in conjunction with specific embodiment, further set forth the present invention.
Embodiment 1: with the pure growth genomic dna is that template is carried out pcr amplification with primer of the present invention
Step 1: choose rhodococcus, the bacterial strain pure growth that saccharothrix etc. are different extracts its genomic dna.Extracting method is with reference to the bacterial genomes DNA extraction test kit of TAKARA company.Obtain the genomic dna solution of different strains respectively.
Step 2: the DNA that obtains with step 1 is a template, is formulated as the DNA sample of 100-200ng/ μ L, is made into following 50 μ L reaction systems with the PCR primer of 10-20pmol/ μ L, carries out pcr amplification reaction:
PCR?buffer：10μL
dNTP：4μL
Primer F upstream primer: 1 μ L
Primer R downstream primer: 1 μ L
DNA：5μL
Taq：0.5μL
ddH
2O：28.5μL
Step 3: after above-mentioned system mixing, the PCR pipe is put into the PCR instrument increase.The PCR program is as follows:
94 ℃ of 1 pre-sex change 10 minutes
94 ℃ of 2 sex change 1 minute
50.5 ℃ of 3 renaturation 5 seconds
4 extend 72 ℃ 25 seconds
2 to 4 circulations 30 times
5 extend 72 ℃ 10 minutes
That the PCR enzyme adopts is PrimeSTAR
TMHS DNA Polymerase (TAKARA)
Step 4: electrophoresis observation.Take out PCR end product 5 μ L and mix 100V, 1% agarose gel electrophoresis 30 minutes, ultraviolet visualization under the gel electrophoresis imager with sample-loading buffer.The results are shown in shown in Figure 1ly, wherein, swimming lane M is marker, and swimming lane 4 is a saccharothrix DNA sample, and swimming lane 5-6 is a rhodococcus DNA sample, and visible swimming lane 5-6 specific amplification goes out 440 and the band of 200bp, and swimming lane 4 does not have target stripe to occur.To check order after the band recovery that amplify.Sequencing result shows, the target gene fragment of Rhod when the 440bp band that is increased is design of primers, and its sequence is shown in SEQ ID No.3; The 200bp band is the segmental part of target gene, and the position of its sequence in the rhodococcus genome is 5076659-5076864.
Embodiment 2: with the soil bacteria genomic dna is that template is carried out pcr amplification
Step 1: get 1 to 2 gram pedotheque, extract its microorganism total DNA.Extracting method obtains the total dna solution of soil with reference to DNA Recovery from Soils of Diverse Composition (JIZHONGZHOU, 1996).
Step 2: the DNA that obtains with step 1 is a template, is formulated as the DNA sample of 100-200ng/ μ L, is made into following 50 μ L reaction systems with the PCR primer of 10-20pmol/ μ L, carries out pcr amplification reaction:
PCR?buffer：10μL
dNTP：4μL
Primer F upstream primer: 1 μ L
Primer R downstream primer: 1 μ L
DNA：5μL
Taq：0.5μL
ddH
2O：28.5μL
Step 3: after above-mentioned system mixing, the PCR pipe is put into the PCR instrument increase.The PCR program is as follows:
94 ℃ of 1 pre-sex change 10 minutes
94 ℃ of 2 sex change 1 minute
50.5 ℃ of 3 renaturation 5 seconds
4 extend 72 ℃ 25 seconds
2 to 4 circulations 30 times
5 extend 72 ℃ 10 minutes
That the PCR enzyme adopts is PrimeSTAR
TMHS DNA Polymerase (TAKARA)
Step 4: electrophoresis observation.Take out PCR end product 5 μ L and mix with sample-loading buffer, 100V, 2% agarose gel electrophoresis 30 minutes, ultraviolet visualization under the gel electrophoresis imager the results are shown in shown in Figure 1ly, and wherein, swimming lane M is marker, and swimming lane 1-3 is a pedotheque.But as seen swimming lane 1 also specific amplification go out 440 and the band of 200bp, swimming lane 2-3 does not have target stripe to occur.To check order after the band recovery that amplify.Sequencing result shows that the target gene fragment of Rhod when the 440bp band that is increased is design of primers, its sequence are rhodococcus DNA cloning product shown in SEQID No.3; The 200bp band is the segmental part of target gene, and the position of its sequence in the rhodococcus genome is 5076659-5076864.Judge in view of the above that then swimming lane 1 pedotheque contains rhodococcus, swimming lane 2-3 pedotheque does not then contain rhodococcus.
Sample to swimming lane 1-3 carries out culture identification, and is consistent with the qualification result that carries out pcr amplification with primer of the present invention.
Embodiment 3: the stability test of primer amplification rhodococcus DNA of the present invention
With reference to embodiment 1 and embodiment 2, choose different bacterial strain pure growths such as rhodococcus, saccharothrix, extract its genomic dna.Or get 1 to 2 gram pedotheque, extract its microorganism total DNA.
Step 2: the DNA that obtains with step 1 is a template, is formulated as the DNA sample of 100-200ng/ μ L, is made into following 50 μ L reaction systems with the PCR primer of 10-20pmol/ μ L, carries out pcr amplification reaction:
PCR?buffer：10μL
dNTP：4μL
Primer F upstream primer: 1 μ L
Primer R downstream primer: 1 μ L
DNA：5μL
Taq：0.5μL
ddH
2O：28.5μL
Step 3: after above-mentioned system mixing, the PCR pipe is put into the PCR instrument increase.The PCR program is as follows:
94 ℃ of 1 pre-sex change 10 minutes
94 ℃ of 2 sex change 1 minute
50.5 ℃ of 3 renaturation 5 seconds
4 extend 72 ℃ 25 seconds
2 to 4 circulations 30 times
5 extend 72 ℃ 10 minutes
That the PCR enzyme adopts is PrimeSTAR
TMHS DNA Polymerase (TAKARA)
Step 4: electrophoresis observation.Take out PCR end product 5 μ L and mix 100V, 1% agarose gel electrophoresis 30 minutes, ultraviolet visualization under the gel electrophoresis imager with sample-loading buffer.Check order after the 440bp that amplifies and 200bp band reclaimed.Sequencing result shows, the target gene fragment of Rhod when the 440bp band that is increased is design of primers, its sequence are rhodococcus DNA cloning product shown in SEQ ID No.3; The 200bp band is the segmental part of target gene, and the position of its sequence in the rhodococcus genome is 5076659-5076864.Sample is carried out culture identification, consistent with the qualification result that carries out pcr amplification with primer of the present invention.Primer amplification rhodococcus DNA good reproducibility of the present invention is described, the result is stable.
Embodiment 4: the sensitivity test of primer amplification rhodococcus DNA of the present invention
Get the dna solution of the rhodococcus genomic dna preparation gradient concentration of purifying, the contained DNA of stoste is 200ng, and dilution is 10 for DNA concentration successively
-1Ng, 10
-2Ng, 10
-3Ng, 10
-4Ng, 10
-5Ng carries out pcr amplification with reference to embodiment 1 described method, get amplified production and carry out gel electrophoresis, the result as seen at dna content 10
-2The place still can amplify 440bp purpose band and 200bp band, and dna content is 10
-3The place does not have any band and occurs, and illustrates that at dna profiling content be 200 * 10
-2During ng, primer still can accurately amplify rhodococcus DNA, and is highly sensitive.
The above only is a preferred implementation of the present invention; should be pointed out that for those skilled in the art, under the prerequisite that does not break away from the principle of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.
Claims (4)
1. the PCR primer of a pair of amplification rhodococcus DNA is characterized in that, its upstream primer sequence is shown in SEQ ID No.1, and the downstream primer sequence is shown in SEQ ID No.2.
2. method that detects rhodococcus comprises following steps:
Step 1: prepare reaction system in following ratio:
PCR?buffer：10μL
dNTP：4μL
Upstream primer: 1 μ L
Downstream primer: 1 μ L
Sample DNA: 5 μ L
Taq：0.5μL
ddH
2O：28.5μL
Wherein, sample DNA concentration is 100-200ng/ μ L, and upstream primer and downstream primer concentration are 10-20pmol/ μ L, and described upstream primer sequence is shown in SEQ ID No.1, and the downstream primer sequence is shown in SEQID No.2;
30 PCR circulations were carried out in step 2:94 ℃ of pre-sex change in 10 minutes, and circulation finishes back 72 ℃ and extended 10 minutes;
Step 3: agarose electrophoresis detects amplification.
3. according to the method for claim 2, it is characterized in that the loop parameter of PCR described in the step 2 is: 94 ℃ of sex change 1 minute, 51 ℃ of renaturation 5 seconds, 72 ℃ were extended 25 seconds.
4. according to the method for claim 2, it is characterized in that the described detection of step 3 occurs for the band that detects 440bp and 200bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105382540A CN101967481B (en) | 2010-11-09 | 2010-11-09 | PCR (Polymerase Chain Reaction) primer for amplifying Rhodococcus and method for detecting Rhodococcus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105382540A CN101967481B (en) | 2010-11-09 | 2010-11-09 | PCR (Polymerase Chain Reaction) primer for amplifying Rhodococcus and method for detecting Rhodococcus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101967481A true CN101967481A (en) | 2011-02-09 |
| CN101967481B CN101967481B (en) | 2012-05-30 |
Family
ID=43546704
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105382540A Active CN101967481B (en) | 2010-11-09 | 2010-11-09 | PCR (Polymerase Chain Reaction) primer for amplifying Rhodococcus and method for detecting Rhodococcus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101967481B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571968A (en) * | 2013-11-25 | 2014-02-12 | 盎亿泰地质微生物技术（北京）有限公司 | PCR primer for amplifying rhodococcus and method and kit for detecting rhodococcus |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1834229A (en) * | 2006-02-15 | 2006-09-20 | 山东大学 | One strain of gene recombinant Rhodocoddus erythropolis and its use for removing harmful substance-sulphur and nitrogen in crude oil |
-
2010
- 2010-11-09 CN CN2010105382540A patent/CN101967481B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1834229A (en) * | 2006-02-15 | 2006-09-20 | 山东大学 | One strain of gene recombinant Rhodocoddus erythropolis and its use for removing harmful substance-sulphur and nitrogen in crude oil |
Non-Patent Citations (2)
| Title |
|---|
| 《Appl Environ Microbiol》 20011231 Matsubara T等人 Purification ,characterization , and overexpression of flavin reductase involved in dibenzothiophene desulfurization by Rhodococcus erythropolis D-1 1179-1184 1-4 第67卷, 2 * |
| 《微生物学报》 20050831 佟明友等人 红球菌SDUZAWQ对有机硫和无机硫的耐受性研究及脱硫基因的克隆 576-579 1-4 第45卷, 第4期 2 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571968A (en) * | 2013-11-25 | 2014-02-12 | 盎亿泰地质微生物技术（北京）有限公司 | PCR primer for amplifying rhodococcus and method and kit for detecting rhodococcus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101967481B (en) | 2012-05-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Applications of real-time polymerase chain reaction for quantification of microorganisms in environmental samples | |
| Haugland et al. | Evaluation of genetic markers from the 16S rRNA gene V2 region for use in quantitative detection of selected Bacteroidales species and human fecal waste by qPCR | |
| LaPara et al. | Phylogenetic analysis of bacterial communities in mesophilic and thermophilic bioreactors treating pharmaceutical wastewater | |
| CN112543812A (en) | Amplification methods, systems and diagnostics based on CRISPR effector systems | |
| Bergmann et al. | Influence of DNA isolation on Q-PCR-based quantification of methanogenic Archaea in biogas fermenters | |
| Vedler et al. | Limnobacter spp. as newly detected phenol-degraders among Baltic Sea surface water bacteria characterised by comparative analysis of catabolic genes | |
| Zul et al. | Effects of plant biomass, plant diversity, and water content on bacterial communities in soil lysimeters: implications for the determinants of bacterial diversity | |
| CN113801917B (en) | Method for detecting multiple nucleic acids based on CRISPR technology | |
| Chandler et al. | Affinity purification of DNA and RNA from environmental samples with peptide nucleic acid clamps | |
| Kondo et al. | Rapid enumeration of sulphate-reducing bacteria from aquatic environments using real-time PCR | |
| CN105986044B (en) | Avian influenza virus nucleic acid General rapid detection method | |
| CN113755619A (en) | Digital PCR detection kit for Burkholderia | |
| Kumar Gothwal et al. | Extraction of bulk DNA from Thar Desert soils for optimization of PCR-DGGE based microbial community analysis | |
| CN101967481B (en) | PCR (Polymerase Chain Reaction) primer for amplifying Rhodococcus and method for detecting Rhodococcus | |
| WO2020021010A1 (en) | Method for assessing fecal pollution in water | |
| CN101768633B (en) | Composition for detecting O139 group vibrio cholerae, kit and detection method for food | |
| CN102936621B (en) | Bacillus cereus detection method and kit | |
| CN110684854A (en) | Primer and probe set for detecting helicobacter pylori drug-resistant mutation site and application | |
| Prithiviraj et al. | Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay | |
| CN103571967A (en) | PCR primer for amplifying pseudomonas and method and kit for detecting pseudomonas | |
| CN103667461B (en) | The PCR primer of a kind of streptomycete of increasing and detect method and the test kit of streptomycete | |
| CN103614488B (en) | A kind of method of PCR primer for saccharothrix and detection saccharothrix and test kit | |
| CN110499380A (en) | A kind of primer pair and detection method detecting Flavobacterium | |
| CN105463103B (en) | The method for identifying the general bacterium in Beijing | |
| CN104032000A (en) | Method and kit for detecting bacillus cereus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: PCR (Polymerase Chain Reaction) primer for amplifying Rhodococcus and method for detecting Rhodococcus Effective date of registration: 20121123 Granted publication date: 20120530 Pledgee: Industrial Commercial Bank of China Ltd Beijing Changping branch Pledgor: Qiang & Thai geological Microorganism Technology (Beijing) Co., Ltd. Registration number: 2012990000722 |
|
| PLDC | Enforcement, change and cancellation of contracts on pledge of patent right or utility model | ||
| PC01 | Cancellation of the registration of the contract for pledge of patent right |
Date of cancellation: 20140926 Granted publication date: 20120530 Pledgee: Industrial Commercial Bank of China Ltd Beijing Changping branch Pledgor: Qiang & Thai geological Microorganism Technology (Beijing) Co., Ltd. Registration number: 2012990000722 |
|
| PLDC | Enforcement, change and cancellation of contracts on pledge of patent right or utility model |