CN101962682B - Method for detecting single nucleotide polymorphism of cattle TAS1R3 gene - Google Patents

Abstract

The invention discloses a method for detecting single nucleotide polymorphism (SNP) of a cattle TAS1R3 gene. The method comprises the following steps of: performing PCR amplification on the cattle TAS1R3 gene by taking TAS1R3 gene-containing cattle whole genome DNA to be detected as a template and a primer pair P as a primer; after a PCR amplification product is digested by restriction endonuclease HindIII, performing polyacrylamide gel electrophoresis on amplified fragments after enzyme cutting; and identifying the SNP of a 2663rd cattle TAS1R3 gene according to a result of the polyacrylamide gel electrophoresis. As the TAS1R3 gene function relates to birth weight, daily gain and weight growth traits, the detection method provided by the invention provides the foundation for establishing a relation between the SNP of the TAS1R3 gene and growth traits, and contributes to marker assistant selection (MAS) of the growth traits of Chinese beef cattle and quick establishment of cattle population with excellent genetic resources.

Description

A kind of method that detects ox TAS1R3 gene mononucleotide polymorphism

Technical field

The invention belongs to the molecular genetics field, relate to the detection of gene mononucleotide polymorphism (SNP), particularly a kind of method that detects the 2663rd SNP of ox TAS1R3 gene.

Background technology

SNP (SNP) just is meant in the genomic dna sequence polymorphum that the replacement owing to single Nucleotide (A/T/C/G) causes.Therefore, usually said SNPs comprises the variation of replacement, insertion, disappearance and the Tumor-necrosis factor glycoproteins copy number of base.A SNP is illustrated in the variation that a Nucleotide is arranged on certain site of genome, and mainly conversion or the transversion by single base causes; SNPs with conversion hysteria variation accounts for 2/3, and other several kinds of SNP are on similar level.The cytosine(Cyt) of CpG dinucletide is to be prone to the site of undergoing mutation in the genome most, and wherein great majority are methylated, spontaneously deaminize and form thymus pyrimidine.

In any known or unknown gene or near all possibly find quantity not wait SNPs, can be divided between gene coding region SNPs (cSNPs), gene periphery SNPs (pSNPs) and gene three types of SNPs (iSNPs) etc. according to their distribution position in genome.Generally speaking, cSNP is fewer, because the aberration rate in exon only accounts for 1/5 of sequence on every side, but therefore its tool significance in the research of inherited disease and breeding receives much attention.According to the influence to inherited character, cSNPs can be divided into two kinds again: a kind of is synonym cSNPs, and promptly the change of encoding sequence does not influence aminoacid sequence in its protein of translating due to the SNP, and mutating alkali yl is identical with " implication " of mutating alkali yl not; Another kind is non-synonym cSNPs, i.e. the change of base sequence will cause the change of coded amino acid, thereby produces the change of protein sequence, possibly finally have influence on proteinic function.Therefore, concerning the nonsynonymous mutation of coding region SNPs, they possibly have direct material impact to gene function.Moreover, in population genetic research, these SNPs are also significant in the research of population genetic and organic evolution as genetic marker.

Because SNPs is two equipotential gene molecule markers; So; In theory in a diplont colony; SNPs is made up of 2,3 or 4 allelotrope, but in fact 3 or 4 allelic SNPs are very rare, so SNPs is called two equipotential gene molecule markers usually simply.At present, mainly adopt several kinds of different routes to find SNPs: i.e. determined dna sequence method, PCR-SSCP and dna sequencing combined techniques, AS-PCR method, primer extension and oligonucleotide ligation etc.In these SNP detection techniques, the determined dna sequence method is a SNP detection method the most accurately, still; Its testing cost is extremely expensive; And need large-scale instruments such as dna sequencing appearance, simultaneously, in the order-checking process, need very those skilled in the art and experience; So the determined dna sequence method is not a kind of actual desirable SNP detection method that is applied to produce; Certainly, utilize PCR-SSCP and dna sequencing combined techniques to detect SNP and can suitably reduce testing cost, still; The experimentation of PCR-SSCP is long, operates more loaded down with trivial detailsly, and has the false positive problem in the experimentation; So, also also nonideal SNP detection means; The AS-PCR method has boundless prospect, still as a kind of novel SNP detection method in the Application Areas in future; This method need design special primer; And can only be directed against the special genes site, simultaneously, also have the probability of flase drop in the testing process; Therefore, the characteristics that do not have widespread usage at present; And primer extension and oligonucleotide ligation technology for detection SNP site need detection platform such as plate reader, gene chip, micro-sphere array technology and mass spectrograph, and exploitativeness is not strong for general molecule laboratory.

The PCR-RFLP method is the effective technology of a kind of SNP of detection, after finding the SNP site, uses restriction enzyme to cut, and carries out agarose, polyacrylate hydrogel electrophoretic analysis then, just can differentiate the SNP site exactly.The PCR-RFLP method not only has the accuracy of dna sequencing method, overcome expensive, troublesome operation, false-positive shortcoming again, and the sequence site of being detected does not have the singularity requirement.

The sense of taste provides the signal of relevant food nature and quality, impels its identification and selectivity to individuality are absorbed, and digests and assimilates, and plays control appetite, regulates the food ration effect.Form heterodimer between the T1Rs acceptor; The different different flavor matter of T1R series of combination identification, TAS1R3 and TAS1R1 form heterodimer and discern most L-type amino acid, and L type amino acid is used proteinic necessary composition; Protein is necessary as biosynthesizing, catalysis, biochemical reaction; Be as metabolic power, as enzyme or hormones, the most important effect of peptide class in metabolism is self-evident.When feeling that with the heterodimer identification sweet taste of TAS1R2 formation TAS1R3 itself finds that its correspondence is located at the Sac site of mouse in the time of the genescan mankind's GPCR.The Sac site is to control mouse to asccharin, the gene of the susceptibility of sucrose and other sweet ingredients

At present, many on the mouse and the mankind for the research of TAS1R3 gene, the specifically research aspect this gene function, and the single nucleotide mutation of this gene influences animal flavor threshold and changes, and influences the behavior of searching for food of animal.The domestic research of not seeing about the variation of animal TAS1R3 gene genetic.The research in Chinese Cattle TAS1R3 gene genetic variation field is deficient, and the functional study of this gene locus and heritable variation thereof are still blank with the related research of economic characters (as: proterties such as birth weight, day weight gain, body weight).Because the TAS1R3 gene function relates to weightening finish, body weight growth traits; Detection method provided by the invention is that the SNP of TAS1R3 gene and the foundation of growth traits relation are laid a good foundation; For use in the marker assisted selection (MAS) of Chinese Cattle growth traits, set up the good ox population of genetic resources fast.

Summary of the invention

The problem that the present invention solves is to utilize the PCR-RFLP method to detect the polymorphum of ox TAS1R3 gene; And itself and growth traits carried out association analysis; Verify whether it can be used as the molecule marker of assisted Selection in the ox molecular breeding, thereby accelerate fine-variety breeding speed.

The present invention realizes through following technical scheme:

A kind of method that detects ox TAS1R3 gene mononucleotide polymorphism is a template with the ox complete genome DNA to be measured that comprises the TAS1R3 gene, is primer with primer to P, pcr amplification ox TAS1R3 gene; After restriction enzyme HindIII digestion pcr amplification product, the amplified fragments after again enzyme being cut carries out polyacrylamide gel electrophoresis; Identify the SNP of the 2663rd of ox TAS1R3 gene according to the polyacrylamide gel electrophoresis result;

Described primer to P is:

Upstream primer: 5 '-GCCTGGCTGGTAGTGCTGCT 20nt

Downstream primer: 5 '-CCAGGAAGGTGCCCAGGAAG 20 Nt

Described pcr amplification reaction program is:

94 ℃ of preparatory sex change 5min; 30～35 circulations, 94 ℃ of sex change 30s, 63.5 ℃ of annealing 30s, 72 ℃ are extended 30s; 72 ℃ are extended 10min.

Described polyacrylamide gel electrophoresis is 10% polyacrylamide gel electrophoresis.

Saidly identify that according to the polyacrylamide gel electrophoresis result SNP of the 2663rd of ox TAS1R3 gene is: the CC genotype shows as 182bp and 29bp band; The TC genotype shows as 211bp, 182bp and 29bp band; The TT genotype shows as the 211bp band.The present invention is according to the sequences Design primer of TAS1R3 gene, and the genomic dna with 3 kinds of ox kinds is a template respectively, carries out pcr amplification, and the PCR product is checked order, and the order-checking back is in the partial sequence of the TAS1R3 gene that obtains ox.The sequence of announcing with NCBI compares discovery and has the SNP polymorphum at the 2663rd.

To above-mentioned the 2663rd SNP polymorphum; The invention also discloses its examination and detection method; Identify through designing the specific digestion with restriction enzyme of specific primer PCR amplification, can be simply, quick, cost is low, detect the polymorphum of its mononucleotide accurately.

The present invention has carried out detection and gene frequency analysis to the SNP genotype of 3 ox kinds; Association analysis is carried out in above-mentioned SNP site and ox part growth traits (birth weight, body weight and day weight gain), and the result shows that this site can be as the molecule marker that improves the ox body weight.

Description of drawings

Fig. 1 is an ox TAS1R3 gene PCR product electrophoresis

Fig. 2 comprises the HindIII restriction enzyme digestion and electrophoresis result of 211bp PCR product of the 2663rd polymorphic site for ox TAS1R3 gene;

Fig. 3 is the different genotype sequencer map of ox TAS1R3 gene SNP.

Fig. 4 is that HindIII PCR-RFLP method detects ox TAS1R3 gene the 6th exon SNP (NC_007314.3:g.2663C＞T) analyze;

Embodiment

The present invention utilizes the PCR-RFLP method that ox TAS1R3 gene the 2663rd site synonym is suddenlyd change to produce and transcribes back montage efficient; The SNP that translation speed and efficient etc. change detects; Below in conjunction with the present invention being done further detailed description, said is to explanation of the present invention rather than qualification.

A, ox TAS1R3 gene contain the 9th exon region PCR primer design

Ox (NC_007314.3) sequence so that NCBI was announced is reference, utilizes Primer 5.0 designs to increase and comprises the PCR primer of ox TAS1R3 gene the 6th exon region, and its primer sequence is following:

Upstream primer: 5GCCTGGCTGGTAGTGCTGCT 20;

Downstream primer: 5CCAGGAAGGTGCCCAGGAAG 20;

With above-mentioned primer to the ox genome amplification; The gene fragment of the 211bp that comprises ox TAS1R3 gene (NC_007314.3 sequence) the 6th exon region the 2481bp～2691bp can increase; The segmental electrophoresis detection in amplification back is as shown in Figure 1; Wherein, swimming lane 1～10 is for detecting fragment, and swimming lane M is Marker; To the fragment of amplification check order identify after, wherein, the sequence of the 2661bp～2663bp is as follows:

CGGAGTGGTGCATGCCACCAATGCCATGCTG? TTCCTCTGCTTCCTGGGCA；

Through analyzing; The position of finding the SNP that HindIII PCR-RFLP detects is as shown in Figure 4; When the C of 2663bp (being the 2160th in TAS1R3 gene C DS district) sports T; The 720th the codon of causing encoding sports GCT by GCC (sequence shown in the frame line), thereby forms the synonym sudden change, promptly sports 772Ala by 720Ala.

When 2663bp sports T by C; The 2660bp of pcr amplification TAS1R3 gene product～2663bp sequence is ggct; Restriction enzyme HindIII can not discern this site; When not undergoing mutation in 2663 sites, the 2660bp of pcr amplification TAS1R3 gene product～2663bp sequence is this restriction enzyme site of ggcc restriction enzyme HindIII identification, and then is cut into 182bp and 29bp fragment; So just can detect this site SNP polymorphum.

B, carry out the TAS1R3 gene fragment of pcr amplification ox to be measured with primer P

1, the collection of ox sample

The present invention specifically with the population of 3 place of china ox kinds as detected object, specifically gather sample and see table 1: Henan Nanyang Cattle (258), Qin Chuan, Shaanxi ox (178), the red ox in Jiaxian County, Pingdingshan City, Henan (143).

The collection of table 1 ox sample

2, the separation of blood sample genomic dna, extraction, purifying

1) freezing blood sample (being mainly hemocyte) room temperature is thawed, and transferase 45 00 μ L to 1.5mL Eppendorf centrifuge tube adds equal-volume PBS liquid; Abundant mixing; The centrifugal 10min of 12000r/min (4 ℃), abandoning supernatant, repetition above-mentioned steps to supernatant is transparent, deposition is faint yellow;

2) in centrifuge tube, add DNA extraction buffer 500 μ L, shake, make the hemocyte deposition break away from centrifuge tube tube wall, 37 ℃ of water-bath 1h;

3) add Proteinase K to 3 μ L (20mg/mL) and mixing, 55 ℃ are spent the night to clarification, and defecator not can add 1 μ L Proteinase K mixing and continue digestion until clarification as yet;

4) reaction solution is cooled to room temperature, adds the saturated phenol 500 μ L of Tris-, gentleness is shaken centrifuge tube 20min, makes its abundant mixing; 4 ℃, the centrifugal 10min of 12000r/min changes supernatant in another 1.5mL centrifuge tube over to, repeats once;

5) add chloroform 500 μ L, abundant mixing 20min, 4 ℃, the centrifugal 10min of 12000r/min changes supernatant in another 1.5mL centrifuge tube over to;

6) add chloroform, primary isoamyl alcohol mixed solution (24: 1) 500 μ L, abundant mixing 20min, 4 ℃, the centrifugal 10min of 12000r/min changes supernatant in another 1.5mL centrifuge tube over to;

7) add the NaAc damping fluid of 0.1 times of volume and the ice-cold absolute ethyl alcohol of 2 times of volumes, mix and rotate centrifuge tube, separate out, preserve 30～60min for-20 ℃ until the flocks of white;

8) 4 ℃, the centrifugal 10min of 12000r/min, abandoning supernatant precipitates 2 times with 70% ice-cold ethanol rinsing DNA;

9) 4 ℃, the centrifugal 10min of 12000r/min makes the ethanol volatilization clean under the abandoning supernatant, room temperature;

10) dried DNA is dissolved in the TE liquid of 80～100 μ L, and 4 ℃ of preservations are dissolved until DNA fully, and 0.8% agarose gel electrophoresis detects its quality ,-80 ℃ of preservations.

11) adding 10%SDS in the dna solution of 500 μ L, to make its final concentration be 0.1%, adds Proteinase K to final concentration and reach 50 μ g/mL;

12) 5 ℃ are incubated about 10h;

13) equal-volume phenol, chloroform, primary isoamyl alcohol (25: 24: 1) and the extracting of chloroform difference are once;

14) the centrifugal 5min phase-splitting of 12000r/min is drawn the upper strata water to another centrifuge tube;

15) add 1/10 volume 3mol/L sodium-acetate and the 2 times of ice-cold absolute ethyl alcohol deposit D of volume NA;

16) outwell liquid, dry after 70% washing with alcohol, add the dissolving of 60 μ L sterilization ultrapure water, 4 ℃ to be detected.

3, pcr amplification

The PCR reaction system adopts mixes the application of sample method; Promptly, calculate the total amount of various reactive components, join in 1 1.5mL centrifuge tube according to the number of the required PCR reaction of the quantity of the required various components of each reaction system and 1 secondary response; Fully instantaneous centrifugal behind the mixing; Divide again to install in each 0.2mLEppendorfPCR pipe, add template DNA then, instantaneous more centrifugal laggard performing PCR amplification;

The PCR reaction system is seen table 2:

Table 2PCR reaction system

25 μ L reaction systems comprise 0.625 U Taq archaeal dna polymerase (sky, Beijing root Science and Technology Ltd.), and 2 * Buffer, 12.5 μ L (include Mg ²⁺, dNTPs etc.) (Mix of sky, Beijing root Science and Technology Ltd.), 50ng/ μ L contains the ox genomic dna 0.45 μ L of TAS1R3 gene, each 0.5 μ L of 10pmol/ μ L upstream and downstream primer;

The PCR response procedures:

94 ℃ of preparatory sex change 5min;

72 ℃ are extended 10min;

Genomic dna to 579 samples of 3 ox kinds carries out pcr amplification, obtains to comprise in the ox TAS1R3 gene of 579 individuals the dna fragmentation of the 211bp in this SNP site.

C, HindIII enzyme are cut the TAS1R3 gene fragment of digestion pcr amplification

1, HindIII endonuclease reaction digestion system (25～30 μ L): 10～15 μ L PCR products, 10 * damping fluid (containing BSA), 2.5～3.0 μ L, HindIII (10U/ μ L) is 1.0～1.5 μ L, sterilization pure water (H ₂O) 11.5～16.5 μ L;

2, enzyme is cut digestion condition: digest 5～10h in 37 ℃ of constant incubators.

Polyacrylamide gel electrophoresis analysis behind d, the HindIII digestion PCR product

1) polyacrylamide gel (PAGE) of making 10%, 180V voltage electrophoresis 50min behind the point sample, electrophoresis finish back EB dyeing;

2) treat that the different dna fragmentation of molecular weight separates when clear, forms images at BIO-RAD Gel Doc 2000 gel imaging systems;

3) according to polyacrylamide gel electrophoresis interpretation of result SNP polymorphum:

Analyze with the photograph of BIO-RAD Gel Doc 2000 gel imaging systems, judge the polymorphum of SNP:

When the 2663bp of TAS1R3 gene sported T by C, the 2660bp of the TAS1R3 gene product of pcr amplification～266bp 3 sequences were ggct, can not discern, and not being limited property of amplified fragments restriction endonuclease HindIII identification, fragment length still is 211bp; And the 2663bp of TAS1R3 gene is not when undergoing mutation, and the 2660bp of product～2663bp sequence is ggc/c, and restriction enzyme HindIII can discern, and will the amplified fragments enzyme be cut, and fragment is cut to two sections of 182bp and 29bp;

Because ox is 2 times of bodies, so the polyacrylamide gel electrophoresis result of the polymorphum of the 2663rd SNP of the genomic TAS1R3 gene of ox is:

The TT genotype shows as 211bp one band; The TC genotype shows as 211bp, 182bp, three bands of 29bp; The CC genotype shows as 182bp and two bands of 29bp; Because 29bp is less, not clear in polyacrylamide gel electrophoresis is analyzed, but still can differentiate TT genotype, TC genotype and CC genotype accurately through 211bp and these two bands of 182bp: what do not comprise the 211bp band is that the CC genotype is individual; Not comprising the 182bp band is that the TT genotype is individual; Comprising 211bp and 182bp band simultaneously is that the TC genotype is individual.

As shown in Figure 2, wherein, swimming lane 5 comprises 182bp and 211bp band, and it is that the TC genotype is individual; Swimming lane 3 does not comprise the 182bp band, is that the TT genotype is individual, swimming lane 1, swimming lane 2, swimming lane 4, does not comprise the 211bp band, is that the CC genotype is individual; Swimming lane M is Marker I (2000bp, 1000bp, 750bp; 500bp, 250bp, 100bp).

4) sequence verification of the individual PCR product of different genotype

The individual PCR product of different genotype is carried out positive and negative two-way order-checking respectively; Simultaneously; Carry out the SNP position analysis; The result shows that individual its 2663 the sequencer map of the heterozygote TC genotype that comprises 182bp and 211bp band is expressed as T or C really, and shown in Fig. 3 a, the 6th peak is two peaks from left to right; And CC genotype, TT genotype are respectively C, T, shown in Fig. 3 b, c.

The frequency statistics analysis of e, ox TAS1R3 gene SNP site

1) gene and genotype frequency

Genotype frequency is meant that certain genotype number of individuals of a certain proterties in the colony accounts for the ratio of total individual number.P _AA=N _AA/ N, wherein P _AARepresent the AA genotype frequency in a certain site; N _AAHas the genotypic number of individuals of AA in the expression colony; N is for detecting the total quantity of colony.

Gene frequency is meant that a certain gene number is to the relative ratios of its allelotrope sum in the colony.The formula that calculates can be write as: P _A=(2N _AA+ N _Aa1+ N _Aa2+ N _Aa3+ N _Aa4+ ...+N _Aan)/2N

In the formula, P _AExpression allelotrope A frequency, N _AAHas the genotypic individual amount of AA, N in the expression colony _AaiHave Aai genotype individual amount in the expression colony, a1-an is n the mutually different multiple allelomorphos of allelotrope A.

The allelotrope that this institute relates to is T and C, so concrete gene frequency calculation formula is:

P _C＝(2N _CC+N _TC)/2N

P _T＝(2N _TT+N _TC)/2N

In the formula, P _T, P _CRepresent the allelic frequency of allelotrope T and C respectively, N _TT, N _TCAnd N _CCRepresent the genotypic individual amount of TT, TC and CC respectively, N representes the total group number.

C gene frequency rangeability in different ox kind TAS1R3 gene SNPs is 35.7%～62.6%, and T gene frequency rangeability is between 37.4%～64.3%, and is as shown in table 3.

The 2663rd SNP gene frequency distribution table of table 3 ox TAS1R3 gene

The association analysis of F, ox TAS1R3 gene SNP site genetic effect

The genotype (TT, TC and CC) of genotype data: HindIII identification

Production data: Nanyang Cattle birth weight, and the body weight and the day weight gain data in June, December, 18 months and 24 months.

The association analysis model:

Earlier data are carried out descriptive analysis, determine whether to exist outlier, utilize the least square analysis that data are proofreaied and correct again; According to data characteristics, in the GLM process analysis genotype of using SAS (9.1) software and the bottle to each behavioural effect., the genotype effect adopted fixed model when being analyzed:

Y _ijkl＝μ+BF _i+Month _j+G _k+e _ijkl

Wherein: Y _IjklBe the character observation value, μ is a population mean, BF _iBe the fixedly effect on i kind and farm, Month _jBe the fixed effect of observation in j month, G _kBe the fixed effect of k single SNP marker gene type, e _IjklBe random error.

The result shows (seeing table 4): in the 2663rd site, be higher than TC and CC genotype individuality and significant difference (P＜0.05) at 6 monthly ages and the genotypic individual's body weight average of 18 monthly age TT; And in birth heavy and 12,24 monthly ages, three kinds of genotypic individualities difference not remarkable (P＞0.05) on body weight and day weight gain proterties.Explain that the TT genotype can make the candidate molecules genetic marker that improves ox body weight and day weight gain as.

Variance analysis between table the 2663rd polymorphic site of 4TAS1R3 gene and each monthly age body weight of Nanyang Cattle and the day weight gain

Annotate: numerical value is MV ± standard error in the table; The colleague has the significant difference of different subscript letters, and level of signification 0.01＜P＜0.05 represented in small letter, and level of signification P＜0.01 is represented in capitalization

Claims (4)

1. a method that detects ox TAS1R3 gene mononucleotide polymorphism is characterized in that, is template with the ox complete genome DNA to be measured that comprises the TAS1R3 gene, is primer with primer to P, pcr amplification ox TAS1R3 gene; After restriction enzyme HindIII digestion pcr amplification product, the amplified fragments after again enzyme being cut carries out polyacrylamide gel electrophoresis; Identify the SNP of the 2663rd of ox TAS1R3 gene according to the polyacrylamide gel electrophoresis result.

Described primer to P is:

Upstream primer: 5 '-GCCTGGCTGGTAGTGCTGCT 20nt

Downstream primer: 5 '-CCAGGAAGGTGCCCAGGAAG 20 Nt

2. the method for detection ox TAS1R3 gene mononucleotide polymorphism as claimed in claim 1 is characterized in that described pcr amplification reaction program is:

94 ℃ of preparatory sex change 5min; 94 ℃ of sex change 30s of 30～35 circulations, 63.5 ℃ of annealing 30s, 72 ℃ are extended 30s; 72 ℃ are extended 10min.

3. the method for detection ox TAS1R3 gene mononucleotide polymorphism as claimed in claim 1 is characterized in that described polyacrylamide gel electrophoresis is 10% polyacrylamide gel electrophoresis.

4. the method for detection ox TAS1R3 gene mononucleotide polymorphism as claimed in claim 1; It is characterized in that identify that according to the polyacrylamide gel electrophoresis result SNP of the 2663rd of ox TAS1R3 gene is: the CC genotype shows as 182bp and 29bp band; The TC genotype shows as 211bp, 182bp and 29bp band; The TT genotype shows as the 211bp band.

Images