CN101962404A - Protein used for treating hemangioma - Google Patents

Protein used for treating hemangioma Download PDF

Info

Publication number
CN101962404A
CN101962404A CN 201010214720 CN201010214720A CN101962404A CN 101962404 A CN101962404 A CN 101962404A CN 201010214720 CN201010214720 CN 201010214720 CN 201010214720 A CN201010214720 A CN 201010214720A CN 101962404 A CN101962404 A CN 101962404A
Authority
CN
China
Prior art keywords
protein
canstatin
leu
ser
ctg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 201010214720
Other languages
Chinese (zh)
Inventor
张爱联
罗进贤
张添元
潘英文
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Tropical Bioscience and Biotechnology Chinese Academy of Tropical Agricultural Sciences
Original Assignee
Institute of Tropical Bioscience and Biotechnology Chinese Academy of Tropical Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Tropical Bioscience and Biotechnology Chinese Academy of Tropical Agricultural Sciences filed Critical Institute of Tropical Bioscience and Biotechnology Chinese Academy of Tropical Agricultural Sciences
Priority to CN 201010214720 priority Critical patent/CN101962404A/en
Publication of CN101962404A publication Critical patent/CN101962404A/en
Pending legal-status Critical Current

Links

Landscapes

  • Peptides Or Proteins (AREA)

Abstract

The invention relates to a protein used for treating hemangioma. Human umbilical cord vein genome DNA is taken as a template to design a gene fragment peculiar primer; a 1-89 amino acid gene fragment at the N end of blood vessel canstatin is augmented by a reverse transcription PRC method; a his purification tag is added on the C end of the sequence thereof; the treated canst is recombined in a pichia pastoris gene group; a Canstatin-N protein is expressed in the pichia pastoris; and the Canstatin-N protein is purified by an ion exchange method and an affinity chromatography method; and the obtained protein has the sequence of (400) 1 item in a sequence table. In the invention, the human umbilical cord vein genome DNA is taken as the template to be augmented to obtain the Canstatin-N protein; and the protein of the invention can effectively inhibit human vascular endothelial cells, effectively inhibits and treats the hemangioma, and creates a necessary condition for studying and developing a specific drug capable of inhibiting the hemangioma, and has important theoretical and practical significance.

Description

A kind ofly be used for the treatment of angiomatous protein
Technical field
The present invention relates to a kind of protein, be specifically related to a kind of angiomatous protein that is used for the treatment of.
Background technology
Vascular tumor (hemangioma) is to be the tumour of feature with the vascular endothelial proliferation, it is one of human common innocent tumour, be found in any position of health, with the vascular tumor of appearance soft tissue for seeing more, usually invade in organs such as facial area skin, eye, nose, lip, tongue, pharynx, soft palates, cause face deformity and dysfunction.Neonatal sickness rate is 1%-2%, and the vascular tumor that is grown in appearance is destroyed surrounding tissue, and some vascular tumor is infiltrative growth, thereby causes children's cosmetic defect.So far still effectively do not treat angiomatous chemicals.
Be applied to treat angiomatous method at present operation, radiation and hormonotherapy etc. are arranged.Wherein, operative therapy is the most frequently used method, but operation causes wound bigger, often needs the tissue transplantation reparation, often stays scar, and the Hazard Factor of bleeding profusely are arranged; Radiotherapy and hormonotherapy have stronger toxic action and negative interaction to body, and radiotherapy may cause radioepidermitis, the possibility of osseous tissue damage and the pernicious transformation of irradiation back secondary; The concurrent hypercortisolism of hormonotherapy possibility influences children's upgrowth and development.Through following up a case by regular visits to long term, confirm that operation, radiation and hormonotherapy capillary hemangioma have the back to lose infringement, cosmetic result is undesirable, and complication can reach 50%, and 30% recurrence rate is arranged approximately.
Summary of the invention
The purpose of this invention is to provide a kind of angiomatous protein that is used for the treatment of.
The technical solution adopted in the present invention is: a kind of angiomatous protein (Canstatin-N) that is used for the treatment of has following gene order:
ATG?GTC?AGC?ATC?GGC?TAC?CTC?CTG?GTG?AAG?CAC?AGC?CAG?ACG?GAC
CAG?GAG?CCC?ATG?TGC?CCG?GTG?GGC?ATG?AAC?AAA?CTC?TGG?AGT?GGA?TAC
AGC?CTG?CTG?TAC?TTC?GAG?GGC?CAG?GAG?AAG?GCG?CAC?AAC?CAG?GAC
CTG?GGG?CTG?GCG?GGC?TCC?TGC?CTG?GCG?CGG?TTC?AGC?ACC?ATG?CCC?TTC
CTG?TAC?TGC?AAC?CCT?GGT?GAT?GTC?TGC?TAC?TAT?GCC?AGC?CGG?AAC?GAC
AAG?TCC?TAC?TGG?CTC?TCT?ACC?ACT?GCG?CCG?CTG?CCC?CAT?CAT?CAT?CAT
CAT?CAT?TAG
Above-mentioned protein (Canstatin-N) is composed as follows by the gene order amino acids coding:
Met?Val?Ser?Ile?Gly?Tyr?Leu?Leu?Val?Lys?His?Ser?Gln?Thr?Asp?Gln?Glu?Pro?Met?Cys
Pro?Val?Gly?Met?Asn?Lys?Leu?Trp?Ser?Gly?Tyr?Ser?Leu?Leu?Tyr?Phe?Glu?Gly?Gln?Glu
Lys?Ala?His?Asn?Gln?Asp?Leu?Gly?Leu?Ala?Gly?Ser?Cys?Leu?Ala?Arg?Phe?Ser?Thr?Met
Pro?Phe?Leu?Tyr?Cys?Asn?Pro?Gly?Asp?Val?Cys?Tyr?Tyr?Ala?Ser?Arg?Asn?Asp?Lys?Ser
Tyr?Trp?Leu?Ser?Thr?Thr?Ala?Pro?Leu?Pro?His?His?His?His?His?His。
The preparation method of protein provided by the present invention (Canstatin-N) is: extract human umbilical vein's genomic dna as template, hold the sequence synthetic gene fragment special primer of 1～89 amino acid gene fragment (canstatin-N) according to the N of blood vessel energy chalone (canstatin):
Upstream primer: 5 ' CCGCGAATTCATGGTCAGCATCGGCTACCT 3 ';
Downstream primer: 5 '
CAAGCGGCCGCCTAATGATGATGATGATGATGGGGCAGCGGCGCAGT
GGTAGAGAGCCA?3’；
With the reverse transcription PCR method from the people's gene group, increase blood vessel can chalone N end 1～89 amino acid gene fragment canstatin-N of (canstatin), and add his purification tag (justifying) through dna sequence analysis at the C-terminal of its sequence; Then this gene fragment is reconstituted in Pichia pastoris genome, in Pichia pastoris, expresses Canstatin-N albumen; Use ion-exchange techniques and affinity chromatography method purifying Canstatin-N albumen again.Target protein by protein electrophoresis (molecular weight that presents the target protein of purifying on SDS-PAGE meets the molecular weight of Canstatin-N) and protein blot experiment proof purifying correct (target protein of purifying can with the proteic antibody generation of Canstatin-N specific combination); Has the activity that suppresses the new vessel generation by the Canstatin-N albumen that suppresses chick chorioallantoic membrane new vessel generation evidence purifying.
Utilize above-mentioned protein to prepare pharmaceutical products, can treat the especially vascular tumor of appearance soft tissue of vascular tumor effectively.
Canstatin-N albumen provided by the present invention is a kind of Angiostatin, suppress the test of human capillary vessel's oncocyte with Canstatin-N albumen, proof Canstatin-N albumen causes human capillary vessel's knurl endothelial cell apoptosis, and apoptosis rate reaches 92%; The capillary hemangioma cell inoculation of human body being set up human capillary vessel's knurl model in nude mice, treat proof Canstatin-N albumen with Canstatin-N albumen then and can treat capillary hemangioma effectively, is a kind of medicine of the human capillary vessel's of treatment knurl.
The present invention is that template increases and obtains the canstatin-N gene with human umbilical vein's genomic dna, the canstatin-N gene recombination is expressed the Canstatin-N albumen of acquisition in Pichia pastoris genome, can improve human capillary vessel's endothelial cell apoptosis rate effectively, suppress human capillary vessel's endotheliocyte, suppress effectively and treat human capillary vessel's knurl, suppress the research and development of the medicine of human capillary vessel's knurl for the production specific and created necessary condition, have important theory and practice significance.
Embodiment
Below the present invention will be further described.
The proteic preparation of Canstatin-N
1, extract human umbilical vein's genomic dna as template, amino acid based because of fragments sequence synthetic gene fragment special primer according to the N end 1～89 of blood vessel energy chalone:
Upstream primer: 5 ' CCGCGAATTCATGGTCAGCATCGGCTACCT 3 ';
Downstream primer: 5 '
CAAGCGGCCGCCTAATGATGATGATGATGATGGGGCAGCGGCGCAGT
GGTAGAGAGCCA?3’：
With the reverse transcription PCR method from the people's gene group, increase blood vessel can chalone N end 1～89 amino acid gene fragment canstatin-N of (canstatin), and add the his purification tag at the C-terminal of its sequence.
2, amplification pGAP promotor (glyceraldehyde 3-phosphate dehydrogenase promotor) (pGAP is the composing type strong promoter of Pichia pastoris) from Pichia pastoris;
3, cut and ligation by the enzyme of DNA, the fusion that step 1 is obtained the canstatin-N DNA of his purification tag insert Pichia pastoris expression vector (pGAP be a promotor, the G418 resistant gene is as selection markers, do not contain pilot protein excretory signal peptide) multiple clone site, this carrier is transformed Pichia pastoris genome, and conversion product is coated the G418-YPD flat board: contain the YPD flat board of G418 for 〉=300 μ g/mL.
4, selecting Pichia pastoris recon as engineering strain from the G418-YPD flat board of step 3;
5, engineering strain bacterium liquid is inoculated in the [prescription (every liter) of liquid nutrient medium: 85% phosphoric acid 26.7ml, CaSO in the liquid nutrient medium 42H 2O 0.93g, K 2SO 418.2g, MgSO 47H 2O 14.9g, KOH 4.13g, glucose 40g, peptone 20g, Yeast extract 10g, PTM4 trace element 4ml] (PTM4 (every liter): the CuSO that fills a prescription 45H 2O 2.0g, NaI2H 2O 0.1g, MnSO 4H 2O 3.0g, Na 2MoO 42H 2O 0.2g, H 3BO 30.02g, CoCl 26H 2O 1.05g, ZnCl 27.0g, Fe 2(SO 4) 37H 2O 22g, vitamin H 0.2g, sulfuric acid 1ml), in bio-reactor, carry out fermentation expression Canstatin-N albumen.Its fermentation parameter is: 28～30 ℃ of temperature, pH5.0, mixing speed 200-900r/min.Centrifugal cell harvesting behind fermentation 1～2d.With helicase (6mg/mL is with the sorbyl alcohol configuration of 1mol/L) lysing cell, centrifugal results supernatant.Earlier carry out purifying, be further purified Canstatin-N albumen with Ni-Agarose His label protein purification kit then with ion-exchanger (SP-Sepharose FastFlow).Prove that by protein electrophoresis (molecular weight that presents the target protein of purifying on SDS-PAGE meets the molecular weight of Canstatin-N) and protein blot experiment (target protein of purifying can with the proteic antiserum(antisera) specific combination of Canstatin-N) target protein of purifying is correct; Prove that by suppressing chick chorioallantoic membrane new vessel generation test (target protein of purifying can suppress the generation of the new vessel of 6 days instar chicken embryo chorioallantoic membranes) the Canstatin-N albumen of purifying has the activity that suppresses the new vessel generation.
Practical example one, get Canstatin-N albumen 1mg and be dissolved in 0.2ml physiological saline (0.85%NaCl), then with its adding can be in percutaneous drug delivery be treated the special Canstatin-N albumen releasing device of local capillary hemangioma (Canstatin-N albumen releasing device: by bowl-shape vinyon and and the platinum electrode sheet form, fill the hydrophilic gel of making by 0.01mol/L citrate buffer solution (pH3.6) and polyethylene pyrroles gastral cavity ketone in the electrode, in add Canstatin-N albumen (0.05～1mg), the surface coated with polymeric membrane.Accepting electrode is made up of electrode slice and conductive resin and leads.The main component of electricity glue is Xylo-Mucine and 0.01mol/L phosphoric acid buffer, pH7.4.), can carry out local percutaneous dosing at the vascular tumor of skin appearance.
Practical example two, get Canstatin-N albumen 1mg and be dissolved in 0.2ml PBS solution, then with its adding can be in percutaneous drug delivery be treated the special Canstatin-N albumen releasing device of local capillary hemangioma (Canstatin-N albumen releasing device: by bowl-shape vinyon and and the platinum electrode sheet form, fill the hydrophilic gel of making by 0.01mol/L citrate buffer solution (pH3.6) and polyethylene pyrroles gastral cavity ketone in the electrode, in add Canstatin-N albumen (0.05～1mg), the surface coated with polymeric membrane.Accepting electrode is made up of electrode slice and conductive resin and leads.The main component of electricity glue is Xylo-Mucine and 0.01mol/L phosphoric acid buffer, pH7.4.), can carry out local percutaneous dosing at the vascular tumor of skin appearance.
Curative effect of medication detects:
At 40 female nude mouses of the BALB/C subcutaneous injection in back human capillary vessel knurl endotheliocyte (1.5 * 10 in (4-6 age in week) 6Individual/only) rise to 100mm when gross tumor volume 3During the left and right sides, mouse is divided into 4 groups at random, 10 every group (A, C group is test group, and B, D group is control group).With same condition 4 groups of vascular tumor models are carried out percutaneous dosing, the pulsed current intensity that treatment is used is 0.4mA/cm 2, frequency is 20 minutes for 2000Hz treatment time.In the doser that the A group is used, add Canstatin-N albumen with the 0.5mg/L of NaCl preparation, in the doser that the C group is used, add Canstatin-N albumen with the 0.5mg/L of PBS preparation, in the doser that the B group is used, add isopyknic NaCl solution, in the doser that the D group is used, add isopyknic PBS solution.Treatment time was three weeks.Treatment result is calculated two groups of angiomatous areas in mouse treatment back, and (calculating formula: tumour is wide 2* long * 0.52) (seeing Table 1).Interpretation of result (table 2) shows with control group (B, D group) and compares that the vascular tumor area of test group (A, C group) is significance and reduces (P＜0.01).Conclusion: Canstatin-N albumen has therapeutic action to people's capillary hemangioma.
Table 1. Canstatin-N protein for treatment people vascular tumor result (knurl volume mm 3)
Figure BSA00000164358800071
The analysis of table 2 curative effect of medication
Figure BSA00000164358800072
The gene order table
＜110〉China tropic Agriculture Academy Sciences tropic Biotechnology Research Institute
＜120〉a kind ofly be used for the treatment of angiomatous protein
<160>1
<210>1
<211>291
<212>DNA
＜213〉people (human)
<400>1
ATGGTCAGCA?TCGGCTACCT?CCTGGTGAAG?CACAGCCAGA?CGGACCAGGA?GCCCATGTGC
CCGGTGGGCA?TGAACAAACT?CTGGAGTGGA?TACAGCCTGC?TGTACTTCGA?GGGCCAGGAG
AAGGCGCACA?ACCAGGACCT?GGGGCTGGCG?GGCTCCTGCC?TGGCGCGGTT?CAGCACCATG
CCCTTCCTGT?ACTGCAACCC?TGGTGATGTC?TGCTACTATG?CCAGCCGGAA?CGACAAGTCC
TACTGGCTCT?CTACCACTGC?GCCGCTGCCC?CATCATCATC?ATCATCATTA?G

Claims (4)

1. one kind is used for the treatment of angiomatous protein, it is characterized in that, has following gene order:
ATG?GTC?AGC?ATC?GGC?TAC?CTC?CTG?GTG?AAG?CAC?AGC?CAG?ACG?GAC
CAG?GAG?CCC?ATG?TGC?CCG?GTG?GGC?ATG?AAC?AAA?CTC?TGG?AGT?GGA?TAC
AGC?CTG?CTG?TAC?TTC?GAG?GGC?CAG?GAG?AAG?GCG?CAC?AAC?CAG?GAC
CTG?GGG?CTG?GCG?GGC?TCC?TGC?CTG?GCG?CGG?TTC?AGC?ACC?ATG?CCC?TTC
CTG?TAC?TGC?AAC?CCT?GGT?GAT?GTC?TGC?TAC?TAT?GCC?AGC?CGG?AAC?GAC
AAG?TCC?TAC?TGG?CTC?TCT?ACC?ACT?GCG?CCG?CTG?CCC?CAT?CAT?CAT?CAT
CAT?CAT?TAG。
2. according to claim 1ly be used for the treatment of angiomatous protein, it is characterized in that described protein is composed as follows by the gene order amino acids coding:
Met?Val?Ser?Ile?Gly?Tyr?Leu?Leu?Val?Lys?His?Ser?Gln?Thr?Asp?Gln?Glu?Pro?Met?Cys
Pro?Val?Gly?Met?Asn?Lys?Leu?Trp?Ser?Gly?Tyr?Ser?Leu?Leu?Tyr?Phe?Glu?Gly?Gln?Glu
Lys?Ala?His?Asn?Gln?Asp?Leu?Gly?Leu?Ala?Gly?Ser?Cys?Leu?Ala?Arg?Phe?Ser?Thr?Met
Pro?Phe?Leu?Tyr?Cys?Asn?Pro?Gly?Asp?Val?Cys?Tyr?Tyr?Ala?Ser?Arg?Asn?Asp?Lys?Ser
Tyr?Trp?Leu?Ser?Thr?ThrAla?Pro?Leu?Pro?His?His?His?His?His?His。
3. a claim 1 is described is used for the treatment of angiomatous proteinic preparation method, it is characterized in that: be to extract human umbilical vein's genomic dna as template, amino acid based because of fragments sequence synthetic gene fragment special primer according to the N end 1～89 of blood vessel energy chalone:
Upstream primer: 5 ' CCGCGAATTCATGGTCAGCATCGGCTACCT 3 ';
Downstream primer: 5 '
CAAGCGGCCGCCTAATGATGATGATGATGATGGGGCAGCGGCGCAGT
GGTAGAGAGCCA?3’；
With reverse transcription PCR method N end 1～89 amino acid gene fragment canstatin-N that blood vessel can chalone that from the people's gene group, increases, and add the his purification tag at the C-terminal of its sequence; Then this gene fragment is reconstituted in Pichia pastoris genome, in Pichia pastoris, expresses Canstatin-N albumen; Use ion-exchange techniques and affinity chromatography method purifying Canstatin-N albumen again.
4. according to claim 1ly be used for the treatment of angiomatous protein, it is characterized in that: the pharmaceutical products that utilizes described protein preparation treatment people vascular tumor.
CN 201010214720 2010-06-17 2010-06-17 Protein used for treating hemangioma Pending CN101962404A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 201010214720 CN101962404A (en) 2010-06-17 2010-06-17 Protein used for treating hemangioma

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 201010214720 CN101962404A (en) 2010-06-17 2010-06-17 Protein used for treating hemangioma

Publications (1)

Publication Number Publication Date
CN101962404A true CN101962404A (en) 2011-02-02

Family

ID=43515466

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 201010214720 Pending CN101962404A (en) 2010-06-17 2010-06-17 Protein used for treating hemangioma

Country Status (1)

Country Link
CN (1) CN101962404A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102352361A (en) * 2011-07-16 2012-02-15 中国热带农业科学院热带生物技术研究所 Related gene sequence for inhibiting angiogenesis
CN103889416A (en) * 2011-10-19 2014-06-25 高德美国际公司 Method for treating capillary hemangiomas

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1174063A (en) * 1997-07-18 1998-02-25 迟经惠 Hemangioma eliminating ointment
CN1309663A (en) * 1998-06-17 2001-08-22 贝斯以色列护理医疗中心 Anti-angiogenic proteins and methods of use thereof
CN1524879A (en) * 2003-09-17 2004-09-01 中山大学 Anti endothelial cell element, genes encoding same and pharmaceutical uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1174063A (en) * 1997-07-18 1998-02-25 迟经惠 Hemangioma eliminating ointment
CN1309663A (en) * 1998-06-17 2001-08-22 贝斯以色列护理医疗中心 Anti-angiogenic proteins and methods of use thereof
CN1524879A (en) * 2003-09-17 2004-09-01 中山大学 Anti endothelial cell element, genes encoding same and pharmaceutical uses thereof

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102352361A (en) * 2011-07-16 2012-02-15 中国热带农业科学院热带生物技术研究所 Related gene sequence for inhibiting angiogenesis
CN103889416A (en) * 2011-10-19 2014-06-25 高德美国际公司 Method for treating capillary hemangiomas

Similar Documents

Publication Publication Date Title
EP4134084A3 (en) Tissue-specifically expressed circular rna molecule and application thereof
CN102153653B (en) Fusion protein of tumor blood vessel targeted polypeptide and tissue factor and preparation method thereof
CN101649311B (en) Preparation method of human lysozyme-antibacterial peptide Catesbeianin-1 fusion protein and application of same on preventing and curing cow mastitis
KR20210134479A (en) Corona virus prevention and treatment drugs
CN101225110B (en) Human interleukins-22 mutant as well as construction method and use thereof
CN101962404A (en) Protein used for treating hemangioma
Cui et al. How microalgae is effective in oxygen deficiency aggravated diseases? A comprehensive review of literature
CN1267223A (en) Carcinostatic agents
CN107857818A (en) A kind of bispecific fusion protein for IL 17 and TNF α
CN102526712B (en) Application of super oxygen dehydrogenises-trans-activator transcription (SOD-TAT) fusion protein to radiation injury prevention and cure medicine preparation
CN101890155B (en) Medicinal composition and application thereof
CN111569044B (en) Composition containing porphyridium polypeptide and preparation method thereof
CN100368540C (en) Production method for recombinant cytoglobin and uses thereof
KR102193195B1 (en) Active peptide of Octopus minor octopressin, and uses thereof
CN100562306C (en) Contain the biological beauty skin care item of body keratinized cell growth factor-2 and the preparation method of recombinant human keratinized cell growth factor-2
CN104971359A (en) New use of organic-inorganic hybrid polyanion oxometallate compounds
CN105030822A (en) Novel application of organic-inorganic hybrid multi-anion metallic oxide acid salt compounds
CN103215257A (en) Protein for treating hemangioma
CN112888712A (en) Engineered microorganisms and methods of making and using the same
CN102443586A (en) Protein for treating tumor
CN109432005A (en) A kind of allergic dermatitis spray containing marine oligosaccharide
CN102793914A (en) Novel vascular endothelial cell vaccine and preparation method thereof
CN102718856A (en) Recombinant chromatin modified albumin 1A, as well as coding gene and application thereof
CN102250914B (en) Protein for treating ocular vascular proliferation
CN1348005A (en) Prepn and use of reconstituted target cysteine asparagusic enzyme gene

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20110202