CN101956025A - Method and kit for genotyping and quantitatively detecting hepatitis B virus - Google Patents
Method and kit for genotyping and quantitatively detecting hepatitis B virus Download PDFInfo
- Publication number
- CN101956025A CN101956025A CN201010524174XA CN201010524174A CN101956025A CN 101956025 A CN101956025 A CN 101956025A CN 201010524174X A CN201010524174X A CN 201010524174XA CN 201010524174 A CN201010524174 A CN 201010524174A CN 101956025 A CN101956025 A CN 101956025A
- Authority
- CN
- China
- Prior art keywords
- hepatitis
- virus
- genotype
- hbv
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kit for genotyping and quantitatively detecting hepatitis B virus. The kit comprises a DNA extraction reagent and a fluorescence quantitative PCR reagent, wherein the fluorescence quantitative PCR reagent comprises primers for a hepatitis B virus B gene and a hepatitis B virus C gene, a hepatitis B virus B genotype standard and a hepatitis B virus C genotype standard. The invention also discloses a method for genotyping and quantitatively detecting hepatitis B virus. The method comprises the following steps of: designing and synthesizing the primers and probes, obtaining a clinical serum sample, extracting the hepatitis B virus DNA, performing fluorescence quantitative PCR reaction on the hepatitis B virus DNA and judging the result. The genotyping accuracy of the invention is more than or equal to 99 percent; compared with the complete sequence analysis comparison method, the method is simpler and more convenient; compared with the routine PCR and enzyme cleavage method, the method is more accurate at the same time; the kit and the method can detect the hepatitis B virus B gene and the hepatitis B virus C gene usually appearing in the Chinese in the same reaction system at the same time, can quantitatively detect at the same time, more save cost, reduce workload and have obvious innovation.
Description
Technical field
The present invention relates to hepatitis B virus gene typing and quantitative detection method and test kit.
Background technology
(hepatitis B virus, the dna virus of the human acute and chronic hepatitis that HBV) causes are called for short HBV by hepatitis B virus.Hepatitis B virus belongs to has a liking for liver DNA Viraceae (hepadnaviridae), and genome is about 3.2kb, is partially double stranded cyclic DNA.The resistibility of hepatitis B virus is stronger.
HBV has only 3200bp, is a quite little virus.Its genome has four ORF, the following albumen of coding: Core albumen and pre-core albumen, and Pol albumen, X protein, and S albumen etc.Core is a nucleocapsid protein; Pre-core does not know that now what function is arranged, and it is dispensable to duplicating of virus, but may be relevant with the immune response that suppresses the host; X protein is important to virus replication, and is also relevant with the generation that causes liver cancer; S albumen is the envelope protein of virus, and to enter cell relevant with virus.
At present, the about 60%-70% of hepatitis B virus infection rate of China; The hepatitis B surface antigen carrying rate accounts for 7.18% of total population.Therefore, just more and more important for the diagnosis and the treatment of hepatitis B virus.Effectively suppress duplicating of hepatitis B virus, the seroconversion of the cloudy commentaries on classics of HBV-DNA, HBe-Ag, the improvement of liver histological, liver function have often become one of main purpose of present stage antiviral therapy again.The generation of the cloudy commentaries on classics of HBs-Ag, anti--HBs immune antibody also can appear in small part patient.But, by secular clinical observation, when discovery is used for different hepatitis B patient with a kind of antiviral, the result of treatment difference, and same patient uses the result of treatment of different antiviral also different.Along with the genotypic research of HBV, numerous clinical datas show, the effect of antiviral therapy hepatitis B outside the Pass having with patient's autoimmune response, also infects closely related with different genotype HBV.According to the principle of the full gene nucleotide series heterology of HBV 〉=8% or S gene regions nucleotide sequence heterology 〉=4%, being divided into 8 genotype at present is A, B, C, D, E, F, G and H genotype.China A, B, 4 genotype of C, D all exist.City, the north is with C genotype Flow Behavior master, to south, B genotype infection rate increases gradually by the north, and Guangzhou and Shenzhen B genotype are suitable with C genotype infection rate ratio, minority area A, D genotype have higher infection rate, and Tibet is then based on the D genotype.Accounted for the overwhelming majority at China B and C genotype on the whole, so HBV B and the genotypic somatotype of C are to our particularly important.Experimental results show that more and more that at present B, C genotype polyinfection rate increase, therefore, this situation is worth us to pay close attention to.
Summary of the invention
The purpose of this invention is to provide a kind of hepatitis B virus B and C genotype gene type and quantitative detection method, it can detect modal hepatitis B virus B genotype and C genotype in same reaction system, and detection by quantitative simultaneously, easy and simple to handle, quick and precisely, good reproducibility, versatility are good.
Another object of the present invention provides the test kit that is used for hepatitis B virus B and C genotype while gene type and detection by quantitative.
On the basis of the existing HBV dna sequence dna of somatotype of macromethod, find out the rule of the most of hepatitis b virus infection B of Chinese population genotype, the genotypic specificity base of C, adopt the method for quantitative fluorescent PCR to detect, both had higher sensitivity, reached the purpose of carrying out somatotype and detection by quantitative simultaneously again.
The test kit of hepatitis B virus gene typing of the present invention and detection by quantitative is characterized in that: comprise DNA extraction reagent and quantitative fluorescent PCR reagent;
DNA extraction reagent wherein comprises that containing 6 mol/L guanidinium isothiocyanates, 30mol/L Trisodium Citrate, volume is that 0.58% sodium laurylsulfonate, 1 mol/L sodium ethylene diamine tetracetate, volume are the A liquid and the B liquid-Virahol of 2% glycogen;
Quantitative fluorescent PCR reagent wherein comprises:
The Tris-HCl, the 500 mmol/L KCl that contain 100 mmol/L pH8.9, volume are 10 * PCR damping fluid of 50% glycerine;
Concentration is the MgCl of 25mmol/L
2
Concentration is the dNTP(triphosphoric acid dezyribonucleoside of 5mmol/L);
Concentration is the Taq archaeal dna polymerase of 5U/ μ l;
Concentration is that 1U/ μ l is UDG enzyme (uridylic-N-glycosylase);
(" U " is an international unit of enzyme, refers to can cause the enzyme amount that 1 μ mol substrate reacts in the 1min under 25 ℃, optimum condition)
Quantitative fluorescent PCR reagent also comprises following probe and corresponding primer:
The genotypic primer sequence of hepatitis B virus B is:
HBV B F:AGACTCGTGGTGGACTTC concentration is 10 μ mol/L
HBV B R:ACAAGAAGATGAGGCATAGC concentration is 10 μ mol/L
The genotypic probe sequence of hepatitis B virus B is:
HBV B P:5 ' TCGCAGTCCCAAATCTCCA 3 ' concentration is 3 μ mol/L
The fluorescence report gene of 5 ' end mark of fluorescent probe is FAM, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1;
The genotypic primer sequence of hepatitis B virus C is:
HBV C F:CTTGTTGGTTCTTCTGGACTAC concentration is 10 μ mol/L L
HBV C R:AGGATGATGGGATGGGAATAC concentration is 10 μ mol/L
The genotypic probe sequence of hepatitis B virus C is:
HBV C P:5 ' CCTCTACTTCCAGGAACATCAAC 3 ' concentration is 3 μ mol/L
The fluorescence report gene of 5 ' end mark of fluorescent probe is HEX, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1.
The test kit of described hepatitis B virus gene typing and detection by quantitative also comprises hepatitis B virus B genotype standard substance (being hepatitis B virus B genotype DNA), concentration 10
3-10
9Copies/ml, totally 7 the pipe, hepatitis B C genotype standard substance (being hepatitis B virus C genotype DNA), concentration 10
3-10
9Copies/ml, totally 7 pipes.
The test kit of described hepatitis B virus gene typing and detection by quantitative, the A liquid of its described DNA extraction reagent is 15ml, the B liquid of described DNA extraction reagent is 15ml.
The test kit of described hepatitis B virus gene typing and detection by quantitative, its described PCR reaction buffer are that 10 * PCR reaction buffer is 1.25ml, described MgCl
2For 2ml, described dNTP are that 100ul, described Taq archaeal dna polymerase are that 500 μ l, described UDG enzyme (uridylic-N-glycosylase) are 100 μ l.
The test kit of described hepatitis B virus gene typing and detection by quantitative, its described hepatitis B virus B genotypic primer HBV B F and HBV B R respectively are 0.1ml, and the genotypic primer HBV of described hepatitis B virus C C F and HBV C R respectively are 0.1ml; Described hepatitis B virus B genotypic probe HBV B P and the genotypic probe HBV of hepatitis B virus C C P respectively are 0.2ml.
Hepatitis B virus gene typing of the present invention and quantitative detection method, its step is as follows:
The first step, the design of primer and probe is synthetic, the geneseq database of safeguarding from GenBank(NIH) finds out HBV B genotype and the genotypic complete sequence of C is compared, find that all there are between type conservative zone in the special and type in HBV B genotype and C genotype between the 100-600 base, wherein HBV B genotype the 321st and the 324th site exist with all the other genotype between special site, HBV C genotype is special site between the existence of the 482nd and the 491st site and all the other genotype; Design primer and corresponding specific probe respectively, primer and various probe sequence are respectively:
At hepatitis B virus B genotype, the special primer sequence of its type is:
HBV?B?F：AGACTCGTGGTGGACTTC
HBV?B?R：ACAAGAAGATGAGGCATAGC
Hepatitis B virus B genotype, the special probe sequence of its type is:
HBV?B?P：5’TCGCAGTCCCAAATCTCCA?3’
The fluorescence report gene of 5 ' end mark of fluorescent probe is FAM, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1;
At the hepatitis B virus C genotype, the special primer sequence of its type is:
HBV?C?F：CTTGTTGGTTCTTCTGGACTAC
HBV?C?R：AGGATGATGGGATGGGAATAC
The hepatitis B virus C genotype, the special probe sequence of its type is:
HBV?C?P：5’CCTCTACTTCCAGGAACATCAAC?3’
The fluorescence report gene of 5 ' end mark of fluorescent probe is HEX, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1;
Synthesizing of primer and probe:, send specialized company's synthetic primer and probe (giving birth to worker, business-like primer and probe Synesis Company such as Ying Weijieji company) as Shanghai according to primer that designs and probe sequence.
In second step, person under inspection's venous blood 1ml is extracted in the acquisition of clinical serum sample, injects the centrifuge tube of aseptic 1.5ml, after room temperature leaves standstill 2 hours, gets supernatant and changes in another aseptic centrifuge tube, is serum sample;
The 3rd step, extract hepatitis B virus DNA,
(1) get 120 μ l DNA extraction A liquid from the test kit of hepatitis B virus gene typing of the present invention and detection by quantitative and inject the 0.5ml centrifuge tube, every pipe adds serum sample to be measured 60 μ l respectively, mixing, 98 ℃ of heating cracking in 10 minutes;
(2) every pipe adds 180 μ l DNA extraction B liquid, abundant mixing, and centrifugal 3 minutes of 13000rpm/min abandons supernatant, and the room temperature of uncapping is placed and was dried in 5 minutes;
(3) every pipe adds 15 μ l distilled waters (being about to distill resulting water once more through the water behind the single flash) dilution suspendible precipitation, and the hepatitis B virus DNA that this promptly obtains is instantaneous centrifugal standby;
The 4th step, carry out the quantitative fluorescent PCR reaction,
(1) in 25 μ l systems, adds 10 * PCR damping fluid of 2.5 μ l, the 25 mmol/L MgCl of 2.5 μ l
2The 5 mmol/L dNTP of 1 μ l, HBV B genotype and the genotypic primer of C of the 10 μ mol/L of each 1 μ l, B genotype and the genotypic probe of C of the 3 μ mol/L of each 2 μ l, the 5 U/ μ l Taq enzymes of 5 μ l, 2.5 the 1 U/ μ l UNG of μ l, the distilled water of 2 μ l adds the hepatitis B virus DNA 2 μ l that second step obtained at last; The blank that does not have hepatitis B virus DNA, B and C positive criteria product (being used for the making of typical curve) are set simultaneously;
(2) above-mentioned 25 μ l systems are added in the PCR pipe, the lid upper tube cap, as for (as the CFX96 detector of Bio-Rad company etc.) in the fluorescent quantitative PCR detector, the parameter of setting blank, B and C positive criteria product, test serum sample is carried out PCR and is reacted with reaction tubes; The fluorescent quantitative PCR condition is: 62 ℃ of 30s of 95 ℃ of 3min → 95 ℃ 10s → annealing temperatures, wherein carry out 40 circulations between 95 ℃ of 10s → 55-65 ℃ of 30s;
The 5th step, result's judgement,
Under the normal situation of PCR reactive system, be that PCR reaction finishes back fluorescent quantitation detector and detects in sample tube 〉=hepatitis B virus of 500 copies, obtain the hepatitis B virus copy number of sample to be tested by the reference standard curve, being judged to be of copy number 〉=500 is hepatitis b virus infected, and all the other are negative.If only in the genotypic reaction tubes of B, have 〉=fluorescent signal of 500 copies, the genotype of this sample is exactly a Type B so, if only in the genotypic reaction tubes of C, have 〉=fluorescent signal of 500 copies, the genotype of this sample is exactly the C type so, if in B genotype and the genotypic reaction tubes of C, simultaneously signal is arranged all, be B, C mixed type with regard to the genotype that this sample is described.
The quantitative fluorescent PCR reaction that the present invention carried out can be carried out in same reaction system, also can carry out respectively, promptly distinguishing genotypic probe of HBV B genotype and C and corresponding primer can be added in the same reaction tubes and react, also can be added in respectively in the reaction tubes separately and carry out, all can reach somatotype and quantitative purpose simultaneously.
The quantitative fluorescent PCR reaction that the present invention carried out can be carried out in arbitrary volume system more than 5 μ l.
Beneficial effect of the present invention: through the checking of thousands of parts of samples, somatotype accuracy rate of the present invention 〉=99%, more simple and convenient than the method for complete sequence analysis comparison, the while is more accurate than the method that the PCR and the enzyme of routine are cut evaluation again; The present invention can also detect modal two genotype of Chinese (hepatitis B virus B genotype and C genotype) and simultaneously can detection by quantitative simultaneously in same reaction system, save cost more and reduce workload, and novelty is obvious; The present invention simultaneously can also be used for the detection of hepatitis B virus B genotype and C genotype polyinfection situation, for the evaluation of polyinfection provides fast, reliable method.
Embodiment
The test kit of hepatitis B virus gene typing of the present invention and detection by quantitative comprises DNA extraction reagent and quantitative fluorescent PCR reagent;
DNA extraction reagent wherein comprises: the A liquid 15ml and the B liquid-Virahol 15ml that contain 6 mol/L guanidinium isothiocyanates, 30mol/L Trisodium Citrate, volume and be 0.58% sodium laurylsulfonate, 1 mol/L sodium ethylene diamine tetracetate, volume and be 2% glycogen;
Quantitative fluorescent PCR reagent wherein comprises: contain Tris-HCl, the 500 mmol/L KCl of 100 mmol/L pH8.9, volume is 10 * PCR damping fluid of 50% glycerine, 1.25ml; Concentration is the MgCl of 25mmol/L
2, 2ml; Concentration is the dNTP(triphosphoric acid dezyribonucleoside of 5mmol/L), 100ul; Concentration is the Taq archaeal dna polymerase of 5U/ μ l, 500 μ l;
Concentration is that 1U/ μ l is UDG enzyme (uridylic-N-glycosylase), 100 μ l;
Quantitative fluorescent PCR reagent also comprises following probe and corresponding primer:
The genotypic primer sequence of hepatitis B virus B is:
HBV B F:AGACTCGTGGTGGACTTC concentration is 10 μ mol/L, 0.1ml;
HBV B R:ACAAGAAGATGAGGCATAGC concentration is 10 μ mol/L, 0.1ml;
The genotypic probe sequence of hepatitis B virus B is:
HBV B P:5 ' TCGCAGTCCCAAATCTCCA 3 ' concentration is 3 μ mol/L, 0.2ml;
The fluorescence report gene of 5 ' end mark of fluorescent probe is FAM, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1;
The genotypic primer sequence of hepatitis B virus C is:
HBV C F:CTTGTTGGTTCTTCTGGACTAC concentration is 10 μ mol/L, 0.1ml;
HBV C R:AGGATGATGGGATGGGAATAC concentration is 10 μ mol/L, 0.1ml;
The genotypic probe sequence of hepatitis B virus C is:
HBV C P:5 ' CCTCTACTTCCAGGAACATCAAC 3 ' concentration is 3 μ mol/L, 0.2ml;
The fluorescence report gene of 5 ' end mark of fluorescent probe is HEX, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1.
Also comprise hepatitis B virus B genotype standard substance (being hepatitis B virus B genotype DNA), concentration 10
3-10
9Copies/ml, totally 7 the pipe, hepatitis B C genotype standard substance (being hepatitis B virus C genotype DNA), concentration 10
3-10
9Copies/ml, totally 7 pipes.
Be the embodiment that carries out hepatitis B virus gene typing and detection by quantitative with above-mentioned test kit below:
Embodiment one: hepatitis B virus B genotype and C genotype be somatotype and quantitative detection method simultaneously, and its step is as follows:
The first step, the design of primer and probe is synthetic,
The design of primer and probe: find out HBV B genotype the geneseq database of safeguarding from GenBank(NIH) and the genotypic complete sequence of C is compared, find that all there are between type conservative zone in the special and type in HBV B genotype and C genotype between the 100-600 base, wherein HBV B genotype the 321st and the 324th site exist with all the other genotype between special site, HBV C genotype is special site between the existence of the 482nd and the 491st site and all the other genotype; Design primer and corresponding specific probe respectively, primer and various probe sequence are respectively:
At hepatitis B virus B genotype, the special primer sequence of its type is:
HBV?B?F：AGACTCGTGGTGGACTTC
HBV?B?R：ACAAGAAGATGAGGCATAGC
Hepatitis B virus B genotype, the special probe sequence of its type is:
HBV?B?P：5’TCGCAGTCCCAAATCTCCA?3’
The fluorescence report gene of 5 ' end mark of fluorescent probe is FAM, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1;
At the hepatitis B virus C genotype, the special primer sequence of its type is:
HBV?C?F：CTTGTTGGTTCTTCTGGACTAC
HBV?C?R：AGGATGATGGGATGGGAATAC
The hepatitis B virus C genotype, the special probe sequence of its type is:
HBV?C?P：5’CCTCTACTTCCAGGAACATCAAC?3’
The fluorescence report gene of 5 ' end mark of fluorescent probe is HEX, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1;
Synthesizing of primer and probe:, send specialized company's synthetic primer and probe (giving birth to worker, business-like primer and probe Synesis Company such as Ying Weijieji company) as Shanghai according to primer that designs and probe sequence.
Second step, the acquisition of clinical serum sample,
Extract person under inspection's venous blood 1ml, inject the centrifuge tube of aseptic 1.5ml, after room temperature leaves standstill 2 hours, get supernatant and change in another aseptic centrifuge tube, be serum sample;
The 3rd step, extract hepatitis B virus DNA,
(1) get 120 μ l DNA extraction A liquid from the test kit of hepatitis B virus gene typing of the present invention and detection by quantitative and inject the 0.5ml centrifuge tube, every pipe adds serum sample to be measured 60 μ l respectively, mixing, 98 ℃ of heating cracking in 10 minutes;
(2) every pipe adds 180 μ l DNA extraction B liquid, abundant mixing, and centrifugal 3 minutes of 13000rpm/min abandons supernatant, and the room temperature of uncapping is placed and was dried in 5 minutes;
(3) every pipe adds 15 μ l distilled waters (being about to distill resulting water once more through the water behind the single flash) dilution suspendible precipitation, and the hepatitis B virus DNA that this promptly obtains is instantaneous centrifugal standby;
The 4th step, carry out the quantitative fluorescent PCR reaction,
(1) in 25 μ l systems, adds 10 * PCR damping fluid of 2.5 μ l, the 25 mmol/L MgCl of 2.5 μ l
2The 5 mmol/L dNTP of 1 μ l, HBV B genotype and the genotypic primer of C of the 10 μ mol/L of each 1 μ l, B genotype and the genotypic probe of C of the 3 μ mol/L of each 2 μ l, the 5 U/ μ l Taq enzymes of 5 μ l, 2.5 the 1 U/ μ l UNG of μ l, the distilled water of 2 μ l adds the hepatitis B virus DNA 2 μ l that second step obtained at last; The blank that does not have hepatitis B virus DNA, B and C positive criteria product (being used for the making of typical curve) are set simultaneously;
Detect B genotype and C genotype, with following reaction system:
PCR reaction solution (everyone part consumption is by 25 μ systems):
| ? | Usage quantity (μ l) | Final concentration |
| 10 * PCR damping fluid (100 mmol/L Tris-HCL, pH8.9,500 mmol/L KCL, 50% glycerine (volume percent)) | 2.5 | 1 * PCR damping fluid |
| 25?mmol/L MgCL 2 | 2.5 | 2.5?mmol/L |
| 5?mmol/L dNTP | 1 | 0.2?mmol/L |
| 10?μmol/L HBV?B?F | 1 | 0.4?mmol/L |
| 10?μmol/L HBV?B?R | 1 | 0.4?mmol/L |
| 10?μmol/L HBV?C?F | 1 | 0.4?mmol/L |
| 10?μmol/L HBV?C?R | 1 | 0.4?mmol/L |
| 3?μmol/L HBV?B?P | 2 | 0.24?mmol/L |
| 3?μmol/L HBV?C?P | 2 | 0.24?mmol/L |
| 5 U/ μ l Taq enzymes | 5 | 1U/μl |
| 1?U/μl?UNG | 2.5 | 0.1U/μl |
| Template DNA | 2 | ? |
| Distilled water | 1.5 | ? |
Cumulative volume 25 μ l.
Above quantitative fluorescent PCR reaction system can be carried out in arbitrary volume system more than 5 μ l.
(2) above-mentioned 25 μ l systems are added in the PCR pipe, the lid upper tube cap, as for (as the CFX96 detector of Bio-Rad company etc.) in the fluorescent quantitative PCR detector, the parameter of setting blank, B and C positive criteria product, test serum sample is carried out PCR and is reacted with reaction tubes; The fluorescent quantitative PCR condition is: 62 ℃ of 30s of 95 ℃ of 3min → 95 ℃ 10s → annealing temperatures, wherein carry out 40 circulations between 95 ℃ of 10s → 55-65 ℃ of 30s;
The 5th step, result's judgement,
Under the normal situation of PCR reactive system, be that PCR reaction finishes back fluorescent quantitation detector and detects in sample tube 〉=hepatitis B virus of 500 copies, obtain the hepatitis B virus copy number of sample to be tested by the reference standard curve, being judged to be of copy number 〉=500 is hepatitis b virus infected, and all the other are negative.If only in the genotypic reaction tubes of B, have 〉=fluorescent signal of 500 copies, the genotype of this sample is exactly a Type B so, if only in the genotypic reaction tubes of C, have 〉=fluorescent signal of 500 copies, the genotype of this sample is exactly the C type so, if in B genotype and the genotypic reaction tubes of C, simultaneously signal is arranged all, be B, C mixed type with regard to the genotype that this sample is described.
Embodiment two: genotypic somatotype of hepatitis B virus B and quantitative detection method, and its step is as follows:
The first step, the design of primer and probe is synthetic,
The design of primer and probe: from the geneseq database of GenBank(NIH maintenance) finding out HBV B genotype complete sequence compares, find HBV B genotype special site between the existence of the 321st and the 324th site and all the other genotype, design primer and corresponding specific probe, primer and various probe sequence are respectively:
Hepatitis B virus B genotype, the special primer sequence of its type is:
HBV?B?F：AGACTCGTGGTGGACTTC
HBV?B?R：ACAAGAAGATGAGGCATAGC
Hepatitis B virus B genotype, the special probe sequence of its type is:
HBV?B?P：5’TCGCAGTCCCAAATCTCCA?3’
The fluorescence report gene of 5 ' end mark of fluorescent probe is FAM, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1;
Synthesizing of primer and probe:, send specialized company's synthetic primer and probe (giving birth to worker, business-like primer and probe Synesis Company such as Ying Weijieji company) as Shanghai according to primer that designs and probe sequence.
Second step, the acquisition of clinical serum sample,
Extract person under inspection's venous blood 1ml, inject the centrifuge tube of aseptic 1.5ml, after room temperature leaves standstill 2 hours, get supernatant and change in another aseptic centrifuge tube, be serum sample;
The 3rd step, extract hepatitis B virus DNA,
(1) get 120 μ l DNA extraction A liquid from the test kit of hepatitis B virus gene typing of the present invention and detection by quantitative and inject the 0.5ml centrifuge tube, every pipe adds serum sample to be measured 60 μ l respectively, mixing, 98 ℃ of heating cracking in 10 minutes;
(2) every pipe adds 180 μ l DNA extraction B liquid, abundant mixing, and centrifugal 3 minutes of 13000rpm/min abandons supernatant, and the room temperature of uncapping is placed and was dried in 5 minutes;
(3) every pipe adds 15 μ l distilled waters (being about to distill resulting water once more through the water behind the single flash) dilution suspendible precipitation, and the hepatitis B virus DNA that this promptly obtains is instantaneous centrifugal standby;
The 4th step, carry out the quantitative fluorescent PCR reaction,
(1) in 25 μ l systems, adds 10 * PCR damping fluid of 2.5 μ l, the 25 mmol/L MgCl of 2.5 μ l
2The 5 mmol/L dNTP of 1 μ l, the HBV B genotype primer of the 10 μ mol/L of each 1 μ l, the B genotype probe of the 3 μ mol/L of 2 μ l, the 5 U/ μ l Taq enzymes of 5 μ l, 2.5 the 1 U/ μ l UNG of μ l, the distilled water of 2 μ l adds the hepatitis B virus DNA 2 μ l that second step obtained at last; The blank that does not have hepatitis B virus DNA, B positive criteria product (being used for the making of typical curve) are set simultaneously;
Detect the B genotype, please use following reaction system:
PCR reaction solution (everyone part consumption is by 25 μ systems):
| ? | Usage quantity (μ l) | Final concentration |
| 10 * PCR damping fluid (100 mmol/L Tris-HCL, pH8.9,500 mmol/L KCL, 50% glycerine (volume percent)) | 2.5 | 1 * PCR damping fluid |
| 25?mmol/L MgCL 2 | 2.5 | 2.5?mmol/L |
| 5?mmol/L dNTP | 1 | 0.2?mmol/L |
| 10?μmol/L HBV?B?F | 1 | 0.4?mmol/L |
| 10?μmol/L HBV?B?R | 1 | 0.4?mmol/L |
| 3?μmol/L HBV?B?P | 2 | 0.24?mmol/L |
| 5 U/ μ l Taq enzymes | 5 | 1U |
| 1?U/μl?UNG | 2.5 | 0.1U |
| Template DNA | 2 | ? |
| Distilled water | 5.5 | ? |
Cumulative volume 25 μ l.
Above quantitative fluorescent PCR reaction system can be carried out in arbitrary volume system more than 5 μ l.
(2) above-mentioned 25 μ l systems are added in the PCR pipe, the lid upper tube cap, as for (as the CFX96 detector of Bio-Rad company etc.) in the fluorescent quantitative PCR detector, the parameter of setting blank, B positive criteria product, test serum sample is carried out PCR and is reacted with reaction tubes; The fluorescent quantitative PCR condition is: 62 ℃ of 30s of 95 ℃ of 3min → 95 ℃ 10s → annealing temperatures, wherein carry out 40 circulations between 95 ℃ of 10s → 55-65 ℃ of 30s;
The 5th step, result's judgement,
Under the normal situation of PCR reactive system, be that PCR reaction finishes back fluorescent quantitation detector and detects in sample tube 〉=hepatitis B virus of 500 copies, obtain the hepatitis B virus copy number of sample to be tested by the reference standard curve, being judged to be of copy number 〉=500 is hepatitis b virus infected, and all the other are negative.If have in the genotypic reaction tubes of B 〉=fluorescent signal of 500 copies, the genotype of this sample is exactly a Type B so.
Embodiment three: the hepatitis B virus C genotype is somatotype and quantitative detection method simultaneously, and its step is as follows
The first step, the design of primer and probe is synthetic,
The design of primer and probe: from the geneseq database of GenBank(NIH maintenance) finds out the genotypic complete sequence of HBV C and compare, find HBV C genotype special site between the existence of the 482nd and the 491st site and all the other genotype; Design primer and corresponding specific probe, primer and various probe sequence are respectively:
The hepatitis B virus C genotype, the special primer sequence of its type is:
HBV?C?F：CTTGTTGGTTCTTCTGGACTAC
HBV?C?R：AGGATGATGGGATGGGAATAC
The hepatitis B virus C genotype, the special probe sequence of its type is:
HBV?C?P：5’CCTCTACTTCCAGGAACATCAAC?3’
The fluorescence report gene of 5 ' end mark of fluorescent probe is HEX, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1;
Synthesizing of primer and probe:, send specialized company's synthetic primer and probe (giving birth to worker, business-like primer and probe Synesis Company such as Ying Weijieji company) as Shanghai according to primer that designs and probe sequence.
Second step, the acquisition of clinical serum sample,
Extract person under inspection's venous blood 1ml, inject the centrifuge tube of aseptic 1.5ml, after room temperature leaves standstill 2 hours, get supernatant and change in another aseptic centrifuge tube, be serum sample;
The 3rd step, extract hepatitis B virus DNA,
(1) get 120 μ l DNA extraction A liquid from the test kit of hepatitis B virus gene typing of the present invention and detection by quantitative and inject the 0.5ml centrifuge tube, every pipe adds serum sample to be measured 60 μ l respectively, mixing, 98 ℃ of heating cracking in 10 minutes;
(2) every pipe adds 180 μ l DNA extraction B liquid, abundant mixing, and centrifugal 3 minutes of 13000rpm/min abandons supernatant, and the room temperature of uncapping is placed and was dried in 5 minutes;
(3) every pipe adds 15 μ l distilled waters (being about to distill resulting water once more through the water behind the single flash) dilution suspendible precipitation, and the hepatitis B virus DNA that this promptly obtains is instantaneous centrifugal standby;
The 4th step, carry out the quantitative fluorescent PCR reaction,
(1) in 25 μ l systems, adds 10 * PCR damping fluid of 2.5 μ l, the 25 mmol/L MgCl of 2.5 μ l
2The 5 mmol/L dNTP of 1 μ l, the genotypic primer of HBV C of the 10 μ mol/L of each 1 μ l, the genotypic probe of C of the 3 μ mol/L of 2 μ l, the 5 U/ μ l Taq enzymes of 5 μ l, 2.5 the 1 U/ μ l UNG of μ l, the distilled water of 2 μ l adds the hepatitis B virus DNA 2 μ l that second step obtained at last; The blank that does not have hepatitis B virus DNA, C positive criteria product (being used for the making of typical curve) are set simultaneously;
Detect the C genotype, please use following reaction system:
| ? | Usage quantity (μ l) | Final concentration |
| 10 * PCR damping fluid (100 mmol/L Tris-HCL, pH8.9,500 mmol/L KCL, 50% glycerine (volume percent)) | 2.5 | 1 * PCR damping fluid |
| 25?mmol/L MgCL 2 | 2.5 | 2.5?mmol/L |
| 5?mmol/L dNTP | 1 | 0.2?mmol/L |
| 10?μmol/L HBV?C?F | 1 | 0.4?mmol/L |
| 10?μmol/L HBV?C?R | 1 | 0.4?mmol/L |
| 3?μmol/L HBV?C?P | 2 | 0.24?mmol/L |
| 5 U/ μ l Taq enzymes | 5 | 1U |
| 1?U/μl?UNG | 2.5 | 0.1U |
| Template DNA | 2 | ? |
| Distilled water | 5.5 | ? |
Cumulative volume 25 μ l.
Above quantitative fluorescent PCR reaction system can be carried out in arbitrary volume system more than 5 μ l.
(2) above-mentioned 25 μ l systems are added in the PCR pipe, the lid upper tube cap, as for (as the CFX96 detector of Bio-Rad company etc.) in the fluorescent quantitative PCR detector, the parameter of setting blank, C positive criteria product, test serum sample is carried out PCR and is reacted with reaction tubes; The fluorescent quantitative PCR condition is: 62 ℃ of 30s of 95 ℃ of 3min → 95 ℃ 10s → annealing temperatures, wherein carry out 40 circulations between 95 ℃ of 10s → 55-65 ℃ of 30s;
The 5th step, result's judgement,
Under the normal situation of PCR reactive system, be that PCR reaction finishes back fluorescent quantitation detector and detects in sample tube 〉=hepatitis B virus of 500 copies, obtain the hepatitis B virus copy number of sample to be tested by the reference standard curve, being judged to be of copy number 〉=500 is hepatitis b virus infected, and all the other are negative.If have in the genotypic reaction tubes of C 〉=fluorescent signal of 500 copies, the genotype of this sample is exactly the C type so.
Claims (6)
1. the test kit of hepatitis B virus gene typing and detection by quantitative is characterized in that: comprise DNA extraction reagent and quantitative fluorescent PCR reagent;
DNA extraction reagent wherein comprises that containing 6 mol/L guanidinium isothiocyanates, 30mol/L Trisodium Citrate, volume is that 0.58% sodium laurylsulfonate, 1 mol/L sodium ethylene diamine tetracetate, volume are the A liquid and the B liquid-Virahol of 2% glycogen;
Quantitative fluorescent PCR reagent wherein comprises:
The Tris-HCl, the 500 mmol/L KCl that contain 100 mmol/L pH8.9, volume are 10 * PCR damping fluid of 50% glycerine;
Concentration is the MgCl of 25mmol/L
2
Concentration is the dNTP(triphosphoric acid dezyribonucleoside of 5mmol/L);
Concentration is the Taq archaeal dna polymerase of 5U/ μ l;
Concentration is that 1U/ μ l is UDG enzyme (uridylic-N-glycosylase);
Quantitative fluorescent PCR reagent also comprises following probe and corresponding primer:
The genotypic primer sequence of hepatitis B virus B is:
HBV B F:AGACTCGTGGTGGACTTC concentration is 10 μ mol/L
HBV B R:ACAAGAAGATGAGGCATAGC concentration is 10 μ mol/L
The genotypic probe sequence of hepatitis B virus B is:
HBV B P:5 ' TCGCAGTCCCAAATCTCCA 3 ' concentration is 3 μ mol/L
The fluorescence report gene of 5 ' end mark of fluorescent probe is FAM, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1;
The genotypic primer sequence of hepatitis B virus C is:
HBV C F:CTTGTTGGTTCTTCTGGACTAC concentration is 10 μ mol/L L
HBV C R:AGGATGATGGGATGGGAATAC concentration is 10 μ mol/L
The genotypic probe sequence of hepatitis B virus C is:
HBV C P:5 ' CCTCTACTTCCAGGAACATCAAC 3 ' concentration is 3 μ mol/L
The fluorescence report gene of 5 ' end mark of fluorescent probe is HEX, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1.
2. the test kit of hepatitis B virus gene typing according to claim 1 and detection by quantitative is characterized in that: also comprise hepatitis B virus B genotype standard substance (being hepatitis B virus B genotype DNA), concentration 10
3-10
9Copies/ml, totally 7 the pipe, hepatitis B C genotype standard substance (being hepatitis B virus C genotype DNA), concentration 10
3-10
9Copies/ml, totally 7 pipes.
3. the test kit of hepatitis B virus gene typing according to claim 1 and detection by quantitative is characterized in that: the A liquid of described DNA extraction reagent is 15ml, and the B liquid of described DNA extraction reagent is 15ml.
4. the test kit of hepatitis B virus gene typing according to claim 1 and detection by quantitative is characterized in that: described PCR reaction buffer is that 10 * PCR reaction buffer is 1.25ml, described MgCl
2For 2ml, described dNTP are that 100ul, described Taq archaeal dna polymerase are that 500 μ l, described UDG enzyme (uridylic-N-glycosylase) are 100 μ l.
5. the test kit of hepatitis B virus gene typing according to claim 1 and detection by quantitative, it is characterized in that: described hepatitis B virus B genotypic primer HBV B F and HBV B R respectively are 0.1ml, and the genotypic primer HBV of described hepatitis B virus C C F and HBV C R respectively are 0.1ml; Described hepatitis B virus B genotypic probe HBV B P and the genotypic probe HBV of hepatitis B virus C C P respectively are 0.2ml.
6. hepatitis B virus gene typing and quantitative detection method, its step is as follows:
The first step, the design of primer and probe is synthetic, finding out the genotypic complete sequence of HBV B genotype and C from GenBank compares, find that all there are between type conservative zone in the special and type in HBV B genotype and C genotype between the 100-600 base, wherein HBV B genotype the 321st and the 324th site exist with all the other genotype between special site, HBV C genotype is special site between the existence of the 482nd and the 491st site and all the other genotype; Design primer and corresponding specific probe respectively, primer and various probe sequence are respectively:
At hepatitis B virus B genotype, the special primer sequence of its type is:
HBV?B?F：AGACTCGTGGTGGACTTC
HBV?B?R：ACAAGAAGATGAGGCATAGC
Hepatitis B virus B genotype, the special probe sequence of its type is:
HBV?B?P：5’TCGCAGTCCCAAATCTCCA?3’
The fluorescence report gene of 5 ' end mark of fluorescent probe is FAM, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1;
At the hepatitis B virus C genotype, the special primer sequence of its type is:
HBV?C?F：CTTGTTGGTTCTTCTGGACTAC
HBV?C?R：AGGATGATGGGATGGGAATAC
The hepatitis B virus C genotype, the special probe sequence of its type is:
HBV?C?P：5’CCTCTACTTCCAGGAACATCAAC?3’
The fluorescence report gene of 5 ' end mark of fluorescent probe is HEX, and the fluorescent receptor gene of 3 ' end mark is the quenching group of BHQ1;
Synthesizing of primer and probe:, send specialized company's synthetic primer and probe according to primer that designs and probe sequence;
In second step, person under inspection's venous blood 1ml is extracted in the acquisition of clinical serum sample, injects the centrifuge tube of aseptic 1.5ml, after room temperature leaves standstill 2 hours, gets supernatant and changes in another aseptic centrifuge tube, is serum sample;
The 3rd step, extract hepatitis B virus DNA,
(1) get 120 μ l DNA extraction A liquid from the test kit of hepatitis B virus gene typing of the present invention and detection by quantitative and inject the 0.5ml centrifuge tube, every pipe adds serum sample to be measured 60 μ l respectively, mixing, 98 ℃ of heating cracking in 10 minutes;
(2) every pipe adds 180 μ l DNA extraction B liquid, abundant mixing, and centrifugal 3 minutes of 13000rpm/min abandons supernatant, and the room temperature of uncapping is placed and was dried in 5 minutes;
(3) every pipe adds 15 μ l distilled waters dilution suspendible precipitation, and the hepatitis B virus DNA that this promptly obtains is instantaneous centrifugal standby;
The 4th step, carry out the quantitative fluorescent PCR reaction,
(1) in 25 μ l systems, adds 10 * PCR damping fluid of 2.5 μ l, the 25 mmol/L MgCl of 2.5 μ l
2The 5 mmol/L dNTP of 1 μ l, HBV B genotype and the genotypic primer of C of the 10 μ mol/L of each 1 μ l, B genotype and the genotypic probe of C of the 3 μ mol/L of each 2 μ l, the 5 U/ μ l Taq enzymes of 5 μ l, 2.5 the 1 U/ μ l UNG of μ l, the distilled water of 2 μ l adds the hepatitis B virus DNA 2 μ l that second step obtained at last; The blank that does not have hepatitis B virus DNA, B and C positive criteria product are set simultaneously;
(2) above-mentioned 25 μ l systems are added in the PCR pipe, the lid upper tube cap as in the fluorescent quantitative PCR detector, is set reaction tubes the parameter of blank, B and C positive criteria product, test serum sample and is carried out the PCR reaction; The fluorescent quantitative PCR condition is: 62 ℃ of 30s of 95 ℃ of 3min → 95 ℃ 10s → annealing temperatures, wherein carry out 40 circulations between 95 ℃ of 10s → 55-65 ℃ of 30s;
The 5th step, result's judgement,
Under the normal situation of PCR reactive system, be that PCR reaction finishes back fluorescent quantitation detector and detects in sample tube 〉=hepatitis B virus of 500 copies, obtain the hepatitis B virus copy number of sample to be tested by the reference standard curve, being judged to be of copy number 〉=500 is hepatitis b virus infected, and all the other are negative;
If only in the genotypic reaction tubes of B, have 〉=fluorescent signal of 500 copies, the genotype of this sample is exactly a Type B so, if only in the genotypic reaction tubes of C, have 〉=fluorescent signal of 500 copies, the genotype of this sample is exactly the C type so, if in B genotype and the genotypic reaction tubes of C, simultaneously signal is arranged all, be B, C mixed type with regard to the genotype that this sample is described.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010524174XA CN101956025A (en) | 2010-10-29 | 2010-10-29 | Method and kit for genotyping and quantitatively detecting hepatitis B virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010524174XA CN101956025A (en) | 2010-10-29 | 2010-10-29 | Method and kit for genotyping and quantitatively detecting hepatitis B virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101956025A true CN101956025A (en) | 2011-01-26 |
Family
ID=43483610
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010524174XA Pending CN101956025A (en) | 2010-10-29 | 2010-10-29 | Method and kit for genotyping and quantitatively detecting hepatitis B virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101956025A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146487A (en) * | 2011-04-12 | 2011-08-10 | 武汉百泰基因工程有限公司 | Quantitative detection kit, detection method, primer and probe for hepatitis B virus nucleic acid |
| CN102586473A (en) * | 2012-01-12 | 2012-07-18 | 泰普生物科学（中国）有限公司 | Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1184255A (en) * | 1997-10-21 | 1998-06-10 | 曾真 | Detection method and reagent kit for subtype of hepatitis B virogene |
-
2010
- 2010-10-29 CN CN201010524174XA patent/CN101956025A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1184255A (en) * | 1997-10-21 | 1998-06-10 | 曾真 | Detection method and reagent kit for subtype of hepatitis B virogene |
Non-Patent Citations (1)
| Title |
|---|
| YAO ZHAO: "Simultaneous genotyping and quantification of hepatitis B virus for genotypes B and C by real-time PCR assay", 《J. CLIN. MICROBIOL.》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146487A (en) * | 2011-04-12 | 2011-08-10 | 武汉百泰基因工程有限公司 | Quantitative detection kit, detection method, primer and probe for hepatitis B virus nucleic acid |
| CN102146487B (en) * | 2011-04-12 | 2013-05-01 | 武汉百泰基因工程有限公司 | Quantitative detection kit, detection method, primer and probe for hepatitis B virus nucleic acid |
| CN102586473A (en) * | 2012-01-12 | 2012-07-18 | 泰普生物科学（中国）有限公司 | Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit |
| CN102586473B (en) * | 2012-01-12 | 2013-09-18 | 泰普生物科学（中国）有限公司 | Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104232798B (en) | The multiple fluorescence quantitative PCR method of DHAV detection and Gene A type and the discriminating of C type and test kit | |
| CN104450963B (en) | A kind of HBV DNA digital pcrs immue quantitative detection reagent box and its application | |
| CN103757091B (en) | Sudden cardiac death rapid gene detection kit and detection method | |
| CN101818207A (en) | Detection method and detection kit of influenza A virus, H1N1 and H3N2 subtype influenza virus | |
| CN102586473B (en) | Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit | |
| CN102146487B (en) | Quantitative detection kit, detection method, primer and probe for hepatitis B virus nucleic acid | |
| CN107460235A (en) | A kind of mankind's ApoE genetic polymorphism detection kits based on ARMS PCR melting curve methods | |
| CN103710465B (en) | Hepatitis B virus (HBV) gene typing PCR (polymerase chain reaction) detection kit | |
| CN104120080A (en) | Alpha-globin gene mutation detection kit as well as preparation method and use thereof | |
| WO2022068079A1 (en) | Method for detecting hepatitis b virus t216c mutation based on micro-droplet digital pcr technology | |
| CN105400903A (en) | Primer set, probe and kit for detection of HBV nucleic acid and method for detection of HBV nucleic acid in sample | |
| CN103834639A (en) | Single-nucleotide polymorphism (SNP) site rs9275319 related to liver cancer susceptibility and application thereof | |
| CN101475988A (en) | Design method for realtime fluorescent quantitative PCR experiment interior label | |
| CN102634605B (en) | Method for detecting egg drop syndrome viruses and kit for method | |
| CN101812537B (en) | Method and reagent kit for simultaneously detecting resistance site of three nucleotide analogues of hepatitis B virus | |
| CN103088151B (en) | Kit for hepatitis B virus four-color fluorescence quantitative PCR (polymerase chain reaction) assay and application | |
| CN103146826A (en) | Method for quantitatively determining blood circulation DNA (Deoxyribonucleic Acid) | |
| CN101956025A (en) | Method and kit for genotyping and quantitatively detecting hepatitis B virus | |
| CN100422344C (en) | Fluorescent PCR detecting method for hepatitis B virus gene parting and reagent kit | |
| CN115323075B (en) | RT-RAA primer probe group and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe group and kit | |
| CN111676315A (en) | Primer and probe for detecting novel coronavirus ORF1ab gene, kit and method thereof | |
| CN103103287A (en) | Multigene-based influenza C virus real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection reagent | |
| CN105671209A (en) | Primers, probe, kit and method for detecting bovine coronavirus | |
| CN101586170B (en) | Method and kits for detecting genotype of hepatitis B virus | |
| CN102181584B (en) | Gene-sequencing-method-based hepatitis B virus genotyping kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20110126 |
|
| RJ01 | Rejection of invention patent application after publication |