CN101955917B - Virus-like particle containing porcine parvovirus VP2 and somatostatin chimeric protein - Google Patents
Virus-like particle containing porcine parvovirus VP2 and somatostatin chimeric protein Download PDFInfo
- Publication number
- CN101955917B CN101955917B CN2010102409749A CN201010240974A CN101955917B CN 101955917 B CN101955917 B CN 101955917B CN 2010102409749 A CN2010102409749 A CN 2010102409749A CN 201010240974 A CN201010240974 A CN 201010240974A CN 101955917 B CN101955917 B CN 101955917B
- Authority
- CN
- China
- Prior art keywords
- virus
- recombinant
- somatostatin
- chimeric protein
- particle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to the field of gene engineered vaccine and provides a virus-like particle containing porcine parvovirus VP2 and somatostatin chimeric protein. The virus-like particle containing porcine parvovirus VP2 and somatostatin chimeric protein is prepared by the following steps of: acquiring a target gene; constructing and identifying a recombined transfer vector pFast-SS4-VP2; constructing and identifying a recombined shuttle vector rBacmid-SS4-VP2; obtaining stable recombined baculovirus rBac-SS4-VP2; and infecting the rBacmid-SS4-VP2 to sf-9 insect cell to obtain a target product. The virus-like particle can be applied to preparing a vaccine for preventing porcine-infecting parvovirus and improving the growing speed of pigs, not only can prevent the porcine-infecting parvovirus, bus also can improve the growing speed of the pigs. The invention also provides application of the virus-like particle to preparing the vaccine for preventing the porcine-infecting parvovirus and improving the growing speed of the pigs.
Description
Technical field
The present invention relates to a kind of heavy virus-like particle that contains pig parvoviral VP2 and Somatostatin chimeric protein, belong to the recombinant vaccine field.
Background technology
(somatostatin is a kind of braingut petide SS) to Somatostatin, is distributed widely in central nervous system and unifies in the stomach intestinal tissue, is a kind ofly can suppress the low molecule basic peptide that tethelin (GH) discharges.Brazeau etc. have isolated SS from the sheep hypothalamus, after this people have done big quantity research to generation, distribution and the biological activity of SS, and the primary structure of having measured it is one to contain 14 amino acid whose polypeptide.Mammals hypothalamus secretion somatotropin releasing factor (GHRF) and Somatostatin (SS); Regulate the secretion of somatotropin (GH), and then act on target organ, like liver; Produce rhIGF-1 (IGFs), thereby regulate growing of histoorgan.Because the release of GHRF stimulating growth hormone; SS suppresses the secretion of GH secretory cell, therefore, and in theory; Stimulate secretion or the release of GHRF or inhibition SS; Perhaps simultaneously GHRF is discharged into the technological line that assassinate to swash and the release of SS is suppressed, the release that just might improve hypophysis GH secretory cell finally reaches the purpose of promotion growth of animal.
3 kinds of structural protein of pig parvoviral (PPV) genome encoding are respectively VP1, VP2, VP3.Wherein VP2 is the main capsid protein that constitutes virus particle; Have hemagglutination activity, account for 80% of viral capsid proteins total amount, VP2 albumen carries main antigenic determinant; Can induce body to produce the protectiveness neutralizing antibody, VP2 to virus infection, bring into play its pathogenic aspect and also play a crucial role.VP2 albumen can independently assemble when vivoexpression, can form complete virus-like particle automatically, has good immunogenicity, becomes the main direction of virus vaccines research.Virus-like particle (virus-like particles VLPs) is the hollow bead that one or more structural protein of certain virus are assembled into; It had both had the stability and the immunogenicity of similar natural viral; Possesses the potential that carries foreign protein or polypeptide again; The nucleic acid that does not contain virus does not have infectivity, makes it be expected to become the good carrier that makes up polyvalent vaccine.
Summary of the invention
The purpose of this invention is to provide a kind of virus-like particle that contains pig parvoviral VP2 and Somatostatin chimeric protein, can prevent pig to infect parvovirus and can improve growth speed of pigs again; The present invention provides the application of this virus-like particle in the vaccine of preparation prevention pig infection parvovirus, raising growth speed of pigs simultaneously.
The present invention provides the virus-like particle that contains pig parvoviral VP2 and Somatostatin chimeric protein, is got by following method preparation:
(1) obtains goal gene: adopt forward primer P1 and reverse primer P2 amplification pig parvoviral VP2 gene; Adopt artificial synthesis to obtain the gene order of Somatostatin that 4 copies of restriction enzyme site have been added at two ends respectively, the gene order of the Somatostatin of said 4 copies is SS4;
The sequence of said forward primer P1 is:
5’-cgggatccagccggctgcaagaacttcttctggaagaccttcacctcctgcactgaattgtctgca-3’，
The sequence of said reverse primer P2 is:
5’-cgcctcgagctagtataattttcttggtat-3’；
(2) make up and identify recombinant transfer vector pFast-SS4-VP2;
(3) make up and identify recombinant shuttle vector rBacmid-SS4-VP2;
(4) obtain stable recombinant baculovirus rBac-SS4-VP2;
(5) described viral rBac-SS4-VP2 is infected the sf-9 insect cell, obtain to contain the virus-like particle of pig parvoviral VP2 and Somatostatin chimeric protein.
Gene order 5 ' the end of said 4 copy Somatostatins adds BamH I restriction enzyme site, 3 ' end adds Bg lII restriction enzyme site.
Said recombinant transfer vector pFast-SS4-VP2 structure of step (2) and authentication method are following: the VP2 gene clone to transfer vector pFastBac HT A, is cut through enzyme, and positive plasmid called after pFast-VP2 is identified in order-checking; This plasmid pFast-VP2 cuts, is connected with SS4 behind the dephosphorylation through enzyme, cuts through enzyme again, and order-checking, being accredited as the male plasmid is recombinant transfer vector pFast-SS4-VP2.
Structure and the authentication method of step (3) recombinant shuttle vector rBacmid-SS4-VP2 are: recombinant vectors pFast-SS4-VP2 is transformed among the competent cell DH10Bac that into contains shuttle plasmid Bacmid, blue white bacterium colony screening of warp and PCR are accredited as the male plasmid and are recombinant shuttle vector rBacmid-SS4-VP2; Adopt the baculovirus universal primer during said PCR identifies, upstream primer is GTTTTCCCAGTCACGAC, and downstream primer is CAGGAAACAGCTATGAC.
The method that step (4) obtains stable recombinant baculovirus rBac-SS4-VP2 is: recombinant shuttle vector rBacmid-SS4-VP2 transfection sf-9 insect cell; Carry out the amplification of recombinant baculovirus; Extract the genomic dna of the recombinant baculovirus after increasing, be accredited as positive person through PCR and be stable recombinant baculovirus rBac-SS4-VP2; Primer during said PCR identifies is primer P1 and P2.
With said viral rBac-SS4-VP2 inoculation sf-9 insect cell, collect the sf-9 insect cell of pathology in the step (5), centrifugal with carrying out after this sick cell fragmentation, obtain supernatant, adopt ammonium sulfate precipitation method to carry out albumen precipitation; Said albumen precipitation is suspended in the damping fluid, desalination behind the inactivation of viruses rBacmid-SS4-VP2, ultrafiltration obtains the virus-like particle of pig parvoviral VP2 and Somatostatin chimeric protein.
The present invention also provides the virus-like particle that contains pig parvoviral VP2 and Somatostatin chimeric protein to infect the application of the vaccine of parvovirus, raising growth speed of pigs preparation prevention pig.
The present invention contains the virus-like particle of pig parvoviral VP2 and Somatostatin chimeric protein, can prevent pig to infect parvovirus and can improve growth speed of pigs again; As antigen, with white oil or aluminium glue a vaccine immunity cleaning level mouse, can detect higher pig parvoviral antibody with this virus-like particle behind the booster immunization 2 weeks as adjuvant, behind the booster immunization during 4 weeks antibody rise to the highest; The content of tethelin and Insulin-Like cytokine obviously raises in the serum of immunity back, and the chimeric protein of promptly expressing has been brought into play the effect that promotes body growth.Virus-like particle of the present invention can prevent pig parvoviral safely and effectively, improve growth speed of pigs.
Four description of drawings
Fig. 1 is the electrophorogram after BamH I and the Xho I enzyme of recombinant plasmid pFast-SS4-VP2 cut, and among the figure: M-Marker DL2000,1-enzyme cut back recombinant plasmid pFast-SS4-VP2.
Fig. 2 is rBacmid-SS
4The electrophorogram that the PCR of-VP2 identifies is among the figure: M-Marker DL15000,1-rBacmid-pFast; 2-rBacmid-SS4-VP2.
Fig. 3 is rBac-SS
4The electrophorogram that the genomic PCR of-VP2 identifies is among the figure: 1-rBac-SS
4-VP2 genome, M-Marker DL2000
Fig. 4 is the SDS-PAGE electrophorogram that obtains recombinant protein SS4-VP2 under the different infection multiplicity conditions, among the figure:
1-empty carrier Bacmid, 2-infection multiplicity 0.01,3-infection multiplicity 0.05,4-infection multiplicity 0.1,5-infection multiplicity 0.5, M-molecular weight of albumen standard.
Fig. 5 is the Western-blotting electrophorogram of chimeric protein SS4-VP2, and among the figure: 1-0.2MOI infects the Sf9 cell and obtains albumen, 2-0.5MOI infection Sf-9 cell acquisition albumen, and 3-wild virus infection Sf9 cell obtains albumen, M-molecular weight of albumen standard.
A figure among Fig. 6 is indirect immunofluorescence (IFA) the detection figure that rBacmid-SS4-VP2 infects the sf-9 cell, and B figure is the IFA detection figure that empty carrier Bacmid infects the sf-9 cell, and C figure is the IFA detection figure of normal sf-9 cell.
A figure among Fig. 7 is the electron microscopic observation figure after rBacmid-SS4-VP2 infects the sf-9 cell, and B figure is the electron microscopic observation figure after empty carrier Bacmid infects the sf-9 cell.
Fig. 8 representes the blood-serum P PV antibody horizontal of different immunity each test group in period.
Fig. 9 representes the serum Somatostatin antibody horizontal of different immunity each test group in period.
Figure 10 representes the Serum GH level of each test group of different times.
Five embodiments
1) acquisition of goal gene
(accession number: AY781130), design two primers with Primer Premier 5.0 biosoftwares, the vp2 gene of the PPV NJ-1 strain of announcing with reference to GenBank is used to increase the full gene of VP2.
Forward primer P1 is:
5’-cgggatccagccggctgcaagaacttcttctggaagaccttcacctcctgcactgaattgtctgca-3’
Reverse primer P2 is:
5’-cgcctcgagctagtataattttcttggtat-3’
Adding BamHI and XhoI restriction enzyme site respectively, is template with the DNA of PPV NJ-1 strain, with P1; P2 is a primer amplification VP2 complete genome sequence, reclaims at 1% agarose gel electrophoresis, is connected into the pMD18-T carrier; Transformed competence colibacillus intestinal bacteria E.coli DH5 α; Alkaline lysis method of extracting plasmid, enzyme are cut and are checked order and identify correctly, acquisition positive plasmid pMD18T-VP2.
Somatostatin (SS) the gene order SS4 of 4 copies is: AAAAAGCTGGTTGTAAGAACTTTTTTTGGAAGACTTTTACTTCTTGTGCTGGTTGT AAGAACTTTTTTTGGAAGACTTTTACTTCTTGTGCTGGTTGTAAGAACTTTTTTTG GAAGACTTTTACTTCTTGTGCTGGTTGTAAGAACTTTTTTTGGAAGACTTTTACTT CTTGT.5 ' end at SS4 adds BamH I restriction enzyme site, 3 ' end adds Bg l II restriction enzyme site, adopts the artificial synthesis preparation then.
2) recombinant transfer vector pFast-SS4-VP2 makes up and identifies
Use BamH I and Xho I double digestion plasmid pMD18T-VP2 and transfer vector pFastBac HT A respectively; Behind VP2 fragment and transfer vector pFastBac HT A purifying; Connect with the T4DNA ligase enzyme, transform DH5 α competent cell, the alkaline lysis method of extracting plasmid; BamH I and Xho I double digestion and order-checking are identified, with positive plasmid called after pFast-VP2.Somatostatin (SS) gene of 4 copies is cut with BamH I and Bg l II enzyme; PFast-VP2 with BamH I single endonuclease digestion, is connected with Somatostatin (SS4) gene of T4DNA ligase enzyme with 4 copies behind the dephosphorylation, transforms DH5 α competent cell; The alkaline lysis method of extracting plasmid; With BamH I and Blg II double digestion, size occurring on the electrophorogram is the fragment about 1900bp, then the positive plasmid of this plasmid; Called after pFast-SS4-VP2 is recombinant transfer vector pFast-SS4-VP2 (seeing the numbering 1 among Fig. 1).
3) structure of recombinant shuttle vector rBacmid-SS4-VP2 and evaluation
Recombinant transfer vector pFast-SS4-VP2 is transformed the 100 μ l DH10Bac competent cells that into contain shuttle plasmid Bacmid; And the screening dull and stereotyped (containing qingfengmeisu qiong, kantlex and tetracyclin resistance) of coating X-Gal/IPTG; 37 ℃ of incubators are inverted lucifuge and are cultivated 36-48h, and extremely blue white bacterium colony occurs.X-Gal/IPTG (Kan/Tet/Gen) flat board is placed 4 ℃ of refrigerator 30min, bacterium colony is fully developed the color, select white single bacterium colony; Be inoculated in and contain in the three anti-LB liquid nutrient mediums; Overnight cultures, coating X-Gal/IPTG/ (Kan/Tet/Gen) flat board so carries out three blue hickie screenings; Extract the Bacmid of reorganization by the alkaline lysis of improveing in the Bac-to-Bac baculovirus expression system specification sheets, with the baculovirus universal primer reorganization Bacmid that is extracted carried out PCR and identify:
Upstream primer: GTTTTCCCAGTCACGAC
Downstream primer: CAGGAAACAGCTATGAC
The amplified fragments size is the plasmid about 4300bp, is positive plasmid, and called after rBacmid-SS4-VP2 is recombinant shuttle vector rBacmid-SS4-VP2 (seeing the numbering 2 among Fig. 2).
4) obtain stable recombinant baculovirus rBac-SS4-VP2:
According to Lipofectamine
TMThe description operation of 2000 transfection reagents, with the sf-9 cell of recombinant shuttle vector rBacmid-SS4-VP2 transfection logarithmic phase, 27 ℃ leave standstill more than the cultivation 3d; Collect sick cell; Recombinant baculovirus genomic dna after Proteinase K-SDS-phenol/chloroform extraction amplification is identified through VP2 Auele Specific Primer P1, P2, and the amplified fragments size is the stable recombinant virus that is about 1900bp; Called after rBac-SS4-VP2 is recombinant baculovirus rBac-SS4-VP2 (seeing the numbering 1 among Fig. 3);
5) acquisition contains the virus-like particle of pig parvoviral VP2 and Somatostatin chimeric protein:
Amplification rBac-SS4-VP2, inoculation sf-9 insect cell is cultivated the sf-9 insect cell that pathology is collected in the back; Behind the ultrasonic treatment, the centrifugal 15min of 10000rpm collects supernatant (the chimeric protein SS4-VP2 that contains expression in the supernatant); Add the pH7.0 saturated ammonium sulphate to final concentration 20%; 4 ℃ of stirred overnight precipitate, and the centrifugal 10min of 18000rpm is resuspended in deposition among the PBS then.Add Triton X-100 to 1% of enriched material volume, Tributyl phosphate (TBP is a tributyl phosphate) is used for inactivation of viruses rBacmid-SS4-VP2 to 0.3% of enriched material volume.The desalination of dialysing behind the static 30min of room temperature, centrifugal with the ultrafiltration of ultrafiltration pipe again, remove foreign protein, obtain chimeric protein SS4-VP2, promptly obtained the virus-like particle of pig parvoviral VP2 and Somatostatin chimeric protein.
6) evaluation of the virus-like particle of chimeric protein
1. recombinant protein SDS-PAGE identifies and the Western-Blot evaluation
Infect the Sf-9 cell with different infection multiplicity (MOI) 0.01,0.05,0.1,0.5 respectively with rBacmid-SS4-VP2; 96h collects pathology Sf-9 insect cell, after PBS washing 3 times, adds that a kind damping fluid boils 10min; After carrying out the SDS-PAGE electrophoresis; Coomassie brilliant blue dyeing, the result finds (see figure 4), in lane2, lane3, lane4, lane5 (corresponding infection multiplicity 0.01,0.05,0.1,0.5 respectively), the specific protein band that a size is about 64kD all occurs; With target protein molecular weight basically identical; And this protein belt does not appear in empty carrier contrast Bacmid (lane1), and several infection ratios do not have tangible difference, prove that the chimeric protein (SS4-VP2) that contains pig parvoviral VP2 and Somatostatin has obtained expression.
Using rBacmid-SS4-VP2 is 0.2,0.5 cells infected with MOI; Preparation contains the chimeric protein SS4-VP2 of pig parvoviral VP2 and Somatostatin; And carry out the SDS-PAGE electrophoresis, be transferred to nitrocellulose filter after, spend the night with the PBST sealing that contains 10% (mass concentration) skimming milk; Pig VP2 protein positive serum (Wuhan Keqian Animal Biological Products Co., Ltd.) the room temperature effect 2h that adds dilution in 1: 100; PBST washs three times, adds goat-anti pig IgG-HRP (Beijing Bo Aosen Bioisystech Co., Ltd) room temperature effect 2h of 1: 2000 times of dilution; It is inferior to give a baby a bath on the third day after its birth, and differential protein band (Fig. 5) is observed in DAB (diaminobenzidine) colour developing.The result show utilize the baculovirus vivoexpression SS4-VP2 albumen can with pig VP2 protein positive serum generation specific immune response, the chimeric protein of expression has BA.
2. indirect immunofluorescence detects
With empty carrier Bacmid, rBacmid-SS4-VP2 infects the sf-9 insect cell of logarithmic phase growth respectively, treat that cell produces pathology fully after, outwell supernatant, with the alcohol fixation 40-60min of 75% (volumetric concentration); PBS with containing 1% (mass concentration) BSA washes natural air drying 3 times; Add the pig parvoviral VP2 albumen cavy positive serum (with wild baculovirus protein effect) of dilution in 1: 100,37 ℃ of wet boxes are hatched 2h; PBS with containing 1% (mass concentration) BSA washes natural air drying 3 times; The goat-anti cavy two anti-(Beijing Bo Aosen Bioisystech Co., Ltd) that adds FITC (fluorescein isothiocyanate) mark of dilution in 1: 50,37 ℃ of effect 30min; PBS with containing 1%BSA (mass concentration) washes natural air drying 3 times; Fluorescent microscope is observed down, and the result shows the visible very strong green fluorescence (A in the corresponding diagram 6) corresponding to the Electronic Speculum result of rBacmid-SS4-VP2, and reason is recombinant protein SS4-VP2 and pig parvoviral VP2 albumen cavy positive serum specific reaction; And empty carrier Bacmid (B in the corresponding diagram 6) fluorescence very a little less than, normal sf-9 cell does not have fluorescence (C in the corresponding diagram 6).The result shows that rBac-SS4-VP2 has obtained expression in the sf-9 cell.
3. electron microscopic observation virus-like particle
Using rBacmid-SS4-VP2 is 0.05 infection Sf-9 cell with MOI, and 120h treats to receive poison after the complete pathology of cell, and it is inferior to give a baby a bath on the third day after its birth with PBS; 2000rpm centrifugation cell 10min; 4 ℃ of fixed overnight of 2.5% (volumetric concentration) LUTARALDEHYDE stationary liquid (0.1mol/mL phosphoric acid buffer, pH 7.4, contain 2.5% LUTARALDEHYDE); Do ultrathin section(ing), electron microscopic observation.The result finds in cell, to have and flocks together, diameter is the spheroidal particle of 20～30nm, this particulate form, size all with the totivirus particle close (A among Fig. 7 schemes) of PPV, be the virus-like particle (CVLP) that forms by the SS4-VP2 chimeric protein.Empty carrier Bacmid infects the electron microscopic observation of Sf9 cell, does not see identical virus particle (the B figure among Fig. 7).
The immunogenicity evaluation of the virus-like particle of embodiment 2 chimeric proteins
(1) immune programme for children
Choose 60 of cleaning level mouse, be divided into 4 groups at random.Each test group antigen, adjuvant and immunization ways such as following table:
Immunity twice, each 2 weeks at interval, eyeball of mouse blood sampling weekly after the immunity, conventional separation of serum ,-20 ℃ of preservations are for use.
(2) detection of pig parvoviral ELISA antibody (being PPV antibody)
Use pig parvoviral ELISA antibody assay kit (Wuhan Keqian Animal Biological Products Co., Ltd.) to detect the antibody in the serum.1: 40 dilution back of serum is added in the microwell plate that encapsulates in advance, and every hole adds 100 μ L.Same 1: 3 dilution positive and negative control serums (PPV negative antibody, the positive), 2 holes, every hole 100 μ L are respectively established in the positive and negative contrast.Other establishes a blank hole, and the blank hole adds 100 μ L diluents.37 ℃ of incubation 30min; After washing 3 times, every hole adds sheep anti-mouse igg-HRP 100 μ L of 1: 20000 times of dilution, 37 ℃ of incubation 1h; After washing 3 times, every hole adds substrate A liquid, each one of B liquid (being in the test kit), mixing room temperature lucifuge colour developing 10min; Every hole adds one of stop buffer, measures OD in the 10min
630The test-results (see figure 8) shows that the SS4-VP2 of baculovirus expression produces higher ELISA antibody, and the effect of aluminium glue adjuvant is superior to white-oil adjuvant, and the antibody that the totivirus inactivated vaccine produces is the highest.
(3) Somatostatin (SS) antibody ELISA detected result
Encapsulate elisa plate with the synthetic peptide (5 μ g/mL) of Somatostatin, 100 μ L/ holes, exempting from afterwards with two, 1 week, 3 weeks, 5 all mice serums carry out diluting at 1: 100 Somatostatin antibody horizontal in the detection serum.(see figure 9) is as a result: immune recombinant protein SS4-VP2/ aluminium glue group, and SS4-VP2/ white oil group has produced specific antibody in the test later stage, and PPV control group and PBS group do not have specific antibody to produce.SS4-VP2/ aluminium glue group antibody horizontal is the highest.Explain that SS4-VP2 antigen has good immunogenicity, produce the Somatostatin antibody of higher level, wherein aluminium adjuvant is superior to white-oil adjuvant to antigenic immuno-potentiation.
(4) detection of tethelin (GH)
Adopt radioimmunoassay (detection of Nanjing Military Command hospital general) to measure two and exempt from GH level in 2 weeks of back, the 4 all mice serums.The result shows (see figure 10), and two exempt from the back during 2 weeks, and SS4-VP2/ aluminium glue (II group), SS4-VP2/ white oil (I group) test group Serum GH level are apparently higher than PBS (IV group) and PPV deactivation vaccine (III group) test group; Two exempted from for 4 whens week, and SS4-VP2/ aluminium glue (II group), SS4-VP2/ white oil (I group) test group Serum GH level slightly descend, and PBS (IV group) and PPV deactivation vaccine (III group) test group slightly raise.Wherein II group (SS4-VP2/ aluminium glue) test group Serum GH level is higher; The specific antibody of anti-SS that SS4-VP2/ aluminium glue, SS4-VP2/ white oil test group the produce endogenic SS of part that neutralized is described; Thereby the concentration of tethelin is raise; The growth that this helps promoting experimental animal to a certain extent reaches somatotrophic purpose.
Claims (3)
1. the virus-like particle that contains pig parvoviral VP2 and Somatostatin chimeric protein is got by following method preparation:
(1) obtain goal gene: the DNA with PPV NJ-1 strain is a template; Adopt forward primer P1 and reverse primer P2 amplification pig parvoviral VP2 gene; Adopt artificial synthesis to obtain the gene order of Somatostatin that 4 copies of restriction enzyme site have been added at two ends respectively; Gene order 5 ' the end of said 4 copy Somatostatins adds BamH I restriction enzyme site, 3 ' end adds the BglII restriction enzyme site, and the gene order of the Somatostatin of said 4 copies is SS4, shown in SEQ ID NO:5; The sequence of said forward primer P1 is:
5 '-cgggatccagccggctgcaagaacttcttctggaagaccttcacctcctgcactga attgtctgca-3 ', the sequence of said reverse primer P2 is:
5’-cgcctcgagctagtataattttcttggtat-3’；
(2) make up and identify recombinant transfer vector pFast-SS4-VP2; The structure and the authentication method of this recombinant transfer vector are following:
The VP2 gene clone to transfer vector pFastBac HTA, is cut through enzyme, and positive plasmid called after pFast-VP2 is identified in order-checking; This plasmid pFast-VP2 cuts, is connected with SS4 behind the dephosphorylation through enzyme, cuts through enzyme again, and order-checking, being accredited as the male plasmid is recombinant transfer vector pFast-SS4-VP2;
(3) make up and identify recombinant shuttle vector rBacmid-SS4-VP2; The structure of this recombinant shuttle vector and authentication method are:
Recombinant vectors pFast-SS4-VP2 is transformed among the competent cell DH10Bac that into contains shuttle plasmid Bacmid, and blue white bacterium colony screening of warp and PCR are accredited as the male plasmid and are recombinant shuttle vector rBacmid-SS4-VP2; Adopt the baculovirus universal primer during said PCR identifies, upstream primer is GTTTTCCCAGTCACGAC, and downstream primer is CAGGAAACAGCTATGAC;
(4) obtain stable recombinant baculovirus rBac-SS4-VP2; The preparation method of this recombinant baculovirus is:
Recombinant shuttle vector rBacmid-SS4-VP2 transfection sf-9 insect cell carries out the amplification of recombinant baculovirus, extracts the genomic dna of the recombinant baculovirus after increasing, and is accredited as positive person through PCR and is stable recombinant baculovirus rBac-SS4-VP2; Primer during said PCR identifies is forward primer P1 and the reverse primer P2 in the step (1);
(5) described viral rBac-SS4-VP2 is infected the sf-9 insect cell, obtain to contain the virus-like particle of pig parvoviral VP2 and Somatostatin chimeric protein.
2. the virus-like particle that contains pig parvoviral VP2 and Somatostatin chimeric protein according to claim 1; It is characterized in that in the step (5) said viral rBac-SS4-VP2 inoculation sf-9 insect cell; Collect the sf-9 insect cell of pathology; Centrifugal with carrying out after this sick cell fragmentation, obtain supernatant, adopt ammonium sulfate precipitation method to carry out albumen precipitation; Said albumen precipitation is suspended in the damping fluid, desalination behind the inactivation of viruses rBacmid-SS4-VP2, ultrafiltration obtains the virus-like particle of pig parvoviral VP2 and Somatostatin chimeric protein.
3. claim 1 or the 2 described virus-like particles that contain pig parvoviral VP2 and the Somatostatin chimeric protein application infecting parvovirus, improve the vaccine of growth speed of pigs preparation prevention pig.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102409749A CN101955917B (en) | 2010-07-30 | 2010-07-30 | Virus-like particle containing porcine parvovirus VP2 and somatostatin chimeric protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102409749A CN101955917B (en) | 2010-07-30 | 2010-07-30 | Virus-like particle containing porcine parvovirus VP2 and somatostatin chimeric protein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101955917A CN101955917A (en) | 2011-01-26 |
| CN101955917B true CN101955917B (en) | 2012-08-22 |
Family
ID=43483505
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102409749A Expired - Fee Related CN101955917B (en) | 2010-07-30 | 2010-07-30 | Virus-like particle containing porcine parvovirus VP2 and somatostatin chimeric protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101955917B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321634B (en) * | 2011-08-31 | 2014-02-12 | 中国农业科学院生物技术研究所 | Preparation method of mink enteritis parvovirus empty capsid antigen particles |
| CN102382845B (en) * | 2011-10-14 | 2014-01-29 | 中国农业科学院生物技术研究所 | Method for producing porcine parvovirus antigen and its product |
| CN103033622B (en) * | 2011-12-26 | 2015-03-25 | 武汉中博生物股份有限公司 | PCV2 (porcine circovirus 2) ELISA (enzyme-linked immuno sorbent assay) antigen detection kit as well as preparation method and applications thereof |
| CN107142235A (en) * | 2017-06-20 | 2017-09-08 | 江西嘉博生物工程有限公司 | A kind of restructuring Brevibacillus brevis for expressing pig growth hormone gene and construction method and application |
| CN107868131A (en) * | 2017-10-13 | 2018-04-03 | 长春西诺生物科技有限公司 | A kind of porcine parvovirus subunit vaccine and preparation method thereof |
| CN111793650A (en) * | 2020-07-08 | 2020-10-20 | 中国农业科学院兰州兽医研究所 | Preparation method and application of chimeric south Africa type 2 foot-and-mouth disease virus multi-epitope gene porcine parvovirus H-like particle |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101289657A (en) * | 2008-03-28 | 2008-10-22 | 江苏省农业科学院 | Recombination porcine parvovirus VP2 virus particles for expressing exogenous gene |
| CN101289658A (en) * | 2008-03-28 | 2008-10-22 | 江苏省农业科学院 | Recombination virus particles for expressing 2-typed porcine circovirus nucleocapsid protein Cap gene |
-
2010
- 2010-07-30 CN CN2010102409749A patent/CN101955917B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101289657A (en) * | 2008-03-28 | 2008-10-22 | 江苏省农业科学院 | Recombination porcine parvovirus VP2 virus particles for expressing exogenous gene |
| CN101289658A (en) * | 2008-03-28 | 2008-10-22 | 江苏省农业科学院 | Recombination virus particles for expressing 2-typed porcine circovirus nucleocapsid protein Cap gene |
Non-Patent Citations (3)
| Title |
|---|
| Qunxing Pan 等.Development of recombinant porcine parvovirus-like particles as an antigen carrier formed by the hybrid VP2 protein carrying immunoreactive epitope of porcine circovirus type 2.《vaccine》.2008,第26卷(第17期),2119-2126. * |
| 司艳红 等.猪细小病毒vp2基因的表达和类病毒颗粒的构建.《中国病毒学》.2006,第21卷(第2期),148-152. * |
| 吕建强 等.猪细小病毒VP2蛋白在昆虫细胞中的表达及其特性.《微生物学报》.2002,第42卷(第6期),675-679. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101955917A (en) | 2011-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101117627B (en) | Pig epidemic diarrhea virus attenuated vaccine strain and uses thereof | |
| CN101955917B (en) | Virus-like particle containing porcine parvovirus VP2 and somatostatin chimeric protein | |
| CN103260645B (en) | As norovirus housing and rotavirus vp 6 albumen of combined vaccine | |
| CN104248762B (en) | A kind of pig epidemic diarrhea vaccine combination and its preparation method and application | |
| CN113337478B (en) | Cat parvovirus strain and application thereof | |
| CN101289658A (en) | Recombination virus particles for expressing 2-typed porcine circovirus nucleocapsid protein Cap gene | |
| CN103509761B (en) | Recombinant porcine pseudorabies virus strain used for expression of porcine circovirus type II (PCV2) ORF2 gene, and preparation method thereof | |
| Xu et al. | Chimeric Newcastle disease virus-like particles containing DC-binding peptide-fused haemagglutinin protect chickens from virulent Newcastle disease virus and H9N2 avian influenza virus challenge | |
| CN107227311A (en) | Recombination porcine parvovirus like-particles and its preparation method and application | |
| CN101289657A (en) | Recombination porcine parvovirus VP2 virus particles for expressing exogenous gene | |
| CN112940084B (en) | Serum type4 avian adenovirus subunit vaccine and application thereof | |
| CN110559434B (en) | Avian influenza virus-like particle vaccine, and preparation method and application thereof | |
| CN117431200A (en) | Recombinant bacillus subtilis for displaying Newcastle disease virus HN protein on spore surface, construction method and application | |
| CN110559433B (en) | Avian influenza virus-like particle vaccine, and preparation method and application thereof | |
| CN105802918B (en) | Chicken's infectious bronchitis nephritis strain and its vaccine composition, preparation method and application | |
| CN102363770A (en) | Recombinant baculovirus capable of expressing porcine circovirus type 2 Cap protein and somatostatin in fusion manner, and subunit vaccine thereof | |
| CN101979503A (en) | Recombinant brucella for expressing Asia type-I foot and mouth disease virus VP1 genes and method for producing vaccines thereof | |
| CN109022373A (en) | The end of duck plague virus UL56 gene 3 ' missing and LORF5 gene deletion mutants and its construction method and application | |
| CN1225553C (en) | Recombinant pseudo-rabies virus expressing swine parvovirus VP2 gene and vacine and its preparation method | |
| CN113461786B (en) | Avian influenza virus-like particle vaccine, and preparation method and application thereof | |
| CN103820398B (en) | A kind of mink enteritis virus recombinant subunit vaccine and preparation method thereof | |
| CN1202251C (en) | Infectious bursal disease virus (IBDV) polyprotein gene (VP2/VP4/VP3), eukaryon expressing plasmid, DNA vaccine | |
| CN102370976B (en) | Mixed virus-like particles of swine influenza virus and foot and mouth disease virus, preparation method and application thereof | |
| CN102373181B (en) | Swine influenza virus-porcine reproductive and respiratory syndrome virus mixed virus-like particle, and preparation method and use thereof | |
| CN102311928B (en) | Recombinant yeast engineering strain coexpressed by proteins of chicken anaemia viruses VP1 and VP2, construction method thereof and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: NANJING TIANBANG BIO-INDUSTRY CO., LTD. |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20110815 Address after: Xiaolingwei Nanjing City, Jiangsu province 210014 Zhongling Street No. 50 Applicant after: National Center for Veterinary Biologicals Engineering Research Co-applicant after: NANJING TIANBANG BIO-INDUSTRY Co.,Ltd. Address before: Xiaolingwei Nanjing City, Jiangsu province 210014 Zhongling Street No. 50 Applicant before: National Center for Veterinary Biologicals Engineering Research |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: JIANGSU ACADEMY OF AGRICULTURAL SCIENCES Free format text: FORMER OWNER: NATIONAL RESEARCH CENTER OF VETERINARY BIOLOGICALS ENGINEERING AND TECHNOLOGY Effective date: 20140113 Free format text: FORMER OWNER: NANJING TIANBANG BIO-INDUSTRY CO., LTD. Effective date: 20140113 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20140113 Address after: Xiaolingwei Nanjing City, Jiangsu province 210014 Zhongling Street No. 50 Patentee after: JIANGSU ACADEMY OF AGRICULTURAL SCIENCES Address before: Xiaolingwei Nanjing City, Jiangsu province 210014 Zhongling Street No. 50 Patentee before: National Center for Veterinary Biologicals Engineering Research Patentee before: NANJING TIANBANG BIO-INDUSTRY Co.,Ltd. |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120822 Termination date: 20210730 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |