CN101955525A - Artificial antimicrobial peptide, gene and preparation method thereof - Google Patents

Abstract

The invention relates to artificial antimicrobial peptide, a gene and a preparation method thereof, and belongs to the field of biological pharmacy. An amino acid sequence (Genbank ID:NP_001161799.1) of hepcidin antimicrobial peptide in Genbank is transformed so as to obtain new antimicrobial peptide with high activity and wide antimicrobial spectra; and a nucleotide sequence for encoding the polypeptide is optimized according to the preference of pichia pastoris on amino acid codon, the nucleotide sequence is transferred into the pichia pastoris, and the expression quantity and antimicrobial spectra are higher those of the gene of the original hepcidin antimicrobial peptide.

Description

A kind of artificial antibacterial peptide and gene and preparation method

Technical field

The present invention relates to molecular biology and biological medicine technology, specially refer to a kind of artificial antibacterial peptide and gene and preparation method.

Background technology

Antibacterial peptide (antibacterial peptide) separated acquisition first in insect body in 1972, be a class nonspecific immune response product that when being subjected to the invasion and attack of extraneous pathogenic agent, produces by the organism immunity system, have wide spectrum antibacterium, fungi, virus and press down effect such as tumor killing cell.Molecular mass is less, is rich in hydrophobic amino acid and basic aminoacids, how positively charged, high temperature resistant, soda acid, and stability is strong.The contrast microbiotic, wider (the Miyasaki K T of the antimicrobial spectrum of antibacterial peptide, Lofel R, Lehrer RI.Sensitivity of periodontal pathogens to the bacterial activity of synthetic protegrins, antibioticpeptides derived from porcine leukocytes[J] .J Dent Res, 1997,76:1453-1459.Andreu D, RivasL.Animal antimicrobial peptides:an overview[J] .Biopolymers, 1998,47:415-433.); Its sterilization mechanism uniqueness is difficult for producing resistant organism; Act on single-mindedly, normal cell is not had obvious toxic-side effects, no teratogenesis is difficult for producing accumulate poisoning.Be a class ideal novel " green " antibacterials.

Hepcidin be 2000 found a kind of synthetic and be rich in the antibacterial peptide of halfcystine at liver, belong to alexin family.The protein structure of Hepcidin high conservative between different plant species, its protein structure is rich in the amino-acid residue of positively chargeds such as arginine, Methionin, 8 halfcystines form 4 disulfide linkage, become hairpin structure, the the 4th and the 5th halfcystine forms a disulfide linkage in the corner of hair clip, in phosphoric acid buffer, form stable β folding structure (Wang Yuanzhong, Zhou Jianxin .Hepcidin: have the active iron of anti-mattress and regulate hormone [J]. the physiological science progress, 2005,36 (4): 372-375.).Similar with many antibacterial peptides that are rich in halfcystine, Hepcidin has the effect that suppresses bacterium and fungal growth, in the in-vitro antibacterial test, has Chinese People's Anti-Japanese Military and Political College enterobacteria, the B group streptococcus, streptococcus aureus, staphylococcus epidermidis, bacterial activity and anti-candida albicanses such as micrococci, fungi activities such as aspergillus tubigensis, its the same with other antibacterial peptide in vivo natural defence (Vyoral D that participates in the host, Petrak J.Hepcidin:a direct link between iron metabolism and immunity[J] .Int J Biochem CellBiol, 2005,37 (9): 1768-1773. week thunder, Zhang Yong, Wang Jianfeng, Deng. the clone of milk cow beta-alexin 5 genes and prokaryotic expression [J]. Gansu Agriculture University,'s journal, 2009,2 (1): 7-10.).Simultaneously, Hepcidin still keeps critical hormone (the Nicolas G of iron stable state, Viatte L, Lou DQ, et al.Constitutive hepcidin expression prevents iron overload in a mouse model ofhemocromatosis[J] .Nat Genet, 2003,34:97-101.)

Summary of the invention

A kind of novel antimicrobial peptide that possesses high bacteriostatic activity of the present invention, it is the aminoacid sequence (Genbank ID:NP_001161799.1) of going up the hepcidin antibacterial peptide according to Genbank, manually design and synthesize a kind of nucleotide sequence of hepcidin antibacterial peptide, and be building up in the expression vector, be transformed into abduction delivering in the yeast recipient bacterium, expression product shows high expression level amount, characteristics such as high vigor.External bacteriostatic experiment result shows that this antibacterial peptide biological activity is strong, and streptococcus aureus, streptococcus agalactiae, subtilis are all had tangible bacteriostatic activity.

A kind of artificial antibacterial peptide, its aminoacid sequence is shown in Seq ID No.1.

A kind of artificial antibacterial peptide, be by the aminoacid sequence shown in the Seq ID No.1 is replaced, disappearance, adding, cyclisation, L-type amino acid become D-type amino acid that obtain with the aminoacid sequence identical anti-microbial activity of polypeptide shown in the aminoacid sequence shown in the Seq ID No.1.

The application of above-mentioned artificial antibacterial peptide in anti-streptococcus aureus (Staphylococcus aureus), subtilis (Bacillussubtilis), streptococcus agalactiae (Streptococcus agalactiae).

The encode gene of above-mentioned artificial antibacterial peptide.

The nucleotide sequence of described gene is shown in Seq ID No.2.

The expression vector that contains said gene.

Described expression vector refers to pPICZ α A-hepcidin.

The preparation method of above-mentioned artificial antibacterial peptide refers to above-mentioned expression vector is transformed in the host bacterium, cultivates the host bacterium and makes it express described artificial antibacterial peptide.

Described host bacterium refers to intestinal bacteria or yeast.

Described yeast refers to pichia bacterium (Pichia pastoris).

The present invention carries out artificial reconstructed and design to the aminoacid sequence (Genbank ID:NP_001161799.1) of the hepcidin antibacterial peptide that writes down among the Genbank, obtain the aminoacid sequence shown in the Seq ID No.1 of the present invention, and amino acid whose codon preference is designed its nucleotide sequence according to pichia, obtain the gene that code book is invented artificial antibacterial peptide.By carrier construction, be transformed into the host, find behind the abduction delivering that compare with former expression of polypeptides albumen, artificial antibacterial peptide of the present invention has the expression amount height, the advantage of antibiotic spectrum width.Be the about 127.9mg/L of former polypeptide expression amount, can not satisfy the production needs, production cost is too high; The abduction delivering amount of the gene of improved polypeptide in pichia improves about 214.2mg/L greatly.Former polypeptide only has bacteriostatic action to subtilis, and fungistatic effect is undesirable.Artificial antibacterial peptide of the present invention not only has fungistatic effect to subtilis, and streptococcus aureus and streptococcus agalactiae are all had tangible inhibitory or killing effect.

Description of drawings

Fig. 1. recombinant plasmid pPICZ alpha A-hepcidin PCR identifies

1 recombinant plasmid pPICZ alpha A-hepcidin 2.DNA Marker

Fig. 2 recombination microzyme PCR identifies

1. recombination microzyme; 2. empty carrier; 3.DNAMarker

The SDS-PAGE of Fig. 3 Hepcidin expression product analyzes

1. empty carrier contrast; 2. the screening height copies the hepcidin expression product; 3. without screening hepcidin expression product; 4. albumen Marker

The antibacterial simultaneous test of the artificial antibacterial peptide of Fig. 4 the present invention

A. streptococcus aureus; B. subtilis; C. streptococcus agalactiae

Bacterial plaque 1. penbritins; 2～5. polypeptide of the present invention; 6 negative controls

The inhibition test of the former antibacterial peptide of Fig. 5

A. subtilis;

1. negative control; 2. positive control Amp; 3-5.50 the former expression of polypeptides supernatant liquor of μ L;

The B streptococcus aureus;

1.AMP, polypeptide 2. of the present invention, the former polypeptide of 3-7.

Embodiment

Below concrete experimental implementation step the present invention is further described, if no special instructions, be ordinary method in the experimental technique.

Embodiment 1. makes up recombination microzyme

Step 1. goes up the aminoacid sequence (Genbank ID:NP_001161799.1) of hepcidin antibacterial peptide according to Genebank, design the aminoacid sequence Seq ID No.1 of antibacterial peptide of the present invention, again according to the preference of pichia to codon, do not changing under the amino acid whose condition, the nucleotide sequence of this polypeptide of design coding is shown in Seq ID No.2, by synthetic this nucleotide sequence of Beijing Invitrogen company.

And design a pair of primer H1/H2 according to Seq ID No.2:

H1：5′GGCCTCGAGATGGCTCTGTCTTCCACAATC?3′

H2：5′CGCTCTAGATCAGGTCTTCCTGCAACAGCA?3′

3 ' end at Seq ID No.2 is introduced terminator codon, introduces Xho I and Xba I restriction enzyme site respectively at Seq ID No.2 two ends.

The nucleotide sequence of gene shown in Seq ID No.3 of the aminoacid sequence of synthetic former antibacterial peptide Genbank ID:NP_001161799.1, and as follows according to this sequences Design synthetic primer:

H3：5′GGCCTCGAGATGGCTCTGAACACGAACATC?3′

H4:5 ' CGCTCTAGATCAGGTCTTGCAGCACCAGCC 3 ' introduces terminator codon at the 3 ' end of Seq ID No.3, introduces Xho I and Xba I restriction enzyme site respectively at Seq ID No.3 two ends.

Step 2. construction of expression vector pPICZ α A-hepcidin

Material: expression vector pPICZ α A purchases the company in Invitrogen.T ₄Restriction enzymes such as dna ligase, GoTaq enzyme, Xho I, Xba I are available from TaKaRa company, and penbritin (AMP), Zeocin purchase the company in Invitrogen.

Method:

Pcr amplification: synthetic hepcidin gene integration on carrier PCR2.1-TOPO (in the synthetic gene process Invitrogen attached give), the hepcidin behind the upgrading grain among the pcr amplification PCR2.1-TOPO.Reaction conditions is as follows: 94 ℃ of pre-sex change 5min, and 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 1min, 30 circulations, 72 ℃ are extended 10min.

Pcr amplification product is identified through 1.5% agarose gel electrophoresis, adopt Xho I, Xba I double digestion PCR product and pPICZ α A, by the T4DNA ligase enzyme synthetic gene hepcidin is incorporated among the pPICZ α A (purchasing in Invitrogen), PCR identifies positive recombinant plasmid, see Fig. 1, called after pPICZ α A-hepcidin, the positive plasmid censorship dna sequencing that PCR identifies, sequencing result is consistent with Seq ID No.2.

Same procedure makes up the expression vector pPICZ α A-hepcidin ' of the gene Seq ID No.3 of former antibacterial peptide, and the PCR primer is H3/H4, and the double digestion enzyme is Xho I, Xba I.

Step 3 transformed yeast bacterium and evaluation

Material: host bacterium: pichia bacterium X-33 (Pichiapastoris) has preservation by the contriver laboratory, can provide to the public from 20 years applyings date to be used for proof test.

Method: positive recombinant plasmid pPICZ alpha A-hepcidin and pPICZ α A-hepcidin ' are after Sac I linearizing, and electricity transforms pichia bacterium X-33 respectively.Electric shock condition: voltage 1800V, resistance 200 Ω, electric capacity 25 μ F, electric shock time 5ms.On the YPDs solid medium of 25 μ g/mLZeocin, screen positive transformant, after the YPD liquid nutrient medium increases bacterium, extract the recombination yeast DNA in the YPD liquid nutrient medium, carry out PCR and identify primers designed:

5′AOX：5′-GACTGGTTCCAATTGACAAGC-3‘

3′AOX：5′-GGCAAATGGCATTCTGACAT-3‘

The PCR response procedures is: 1. 94 ℃ of 1min; 2. 94 ℃ of 1min, 59 ℃ of 1min, 72 ℃ of 1min, 30 circulations; Get 5 μ L samples after 72 ℃ of 10min electrophoresis finish and detect, the results are shown in Figure 2 with 1% agarose gel electrophoresis.

The PCR that has transformed the recombination microzyme of pPICZ α A-hepcidin ' identifies that primer is all 5 ' AOX/3 ' AOX: program is the same.

The high copy of step 4. screening recombination microzyme

The height that transforms with aseptic 96 orifice plates screening pPICZ α A-hepcidin ', pPICZ α A-hepcidin copies positive recombination microzyme, Zeocin (purchases in Invitrogen, Cat.No.:R250-0) resistance concentration is 2,4, the 6mg/ml gradient rises screening multi-copy integration transformant.

Step 5. abduction delivering

The YPD liquid nutrient medium culture that screens recombination microzyme is transferred in 100mL BMGY substratum in 1: 50 ratio, be cultured to OD600 at 30 ℃ of 250rpm and reach 3～6, centrifugal collection thalline, and be resuspended in 500mL BMMY substratum, carry out abduction delivering: 28 ℃, 250rpm cultivates 96h, and it is 1% that every 24h adds methyl alcohol to final concentration.10000rpm behind the 96h, the centrifugal collection culture supernatant of 20min.

Survey concentration, the about 214.2mg/L of peptide expression amount of the recombination microzyme that pPICZ α A-hepcidin transforms, the peptide expression amount of the recombination microzyme that pPICZ α A-hepcidin ' transforms is about 127.9mg/L.

The supernatant that step 6. step 5 obtained identifies that through the SDS-PAGE electrophoresis result as shown in Figure 3.

Embodiment 2. bacteriostatic tests

Material: experimental bacteria bacterial strain:

Streptococcus aureus (Staphylococcus aureus) CVCC1882, subtilis (Bacillus subtilis) CVCC717, streptococcus agalactiae CVCC586 (Streptococcus agalactiae), there is preservation in laboratory, the first contriver place, assurance can be used for proof test to public's granting in 20 years applyings date.

Method:

Dip in aseptic cotton swab and to get golden yellow grape ball, subtilis, the streptococcus agalactiae suspension that is in logarithmic phase, evenly coat the LB solid medium, room temperature is placed 3min.Aseptic technique is attached to the aseptic scraps of paper on the flat board that coats bacterium, the supernatant sample that Dropwise 50 μ L embodiment 1 to be measured prepares, cultivate 16h for 37 ℃, to transform the negative contrast of X-33 zymic expressing protein, the positive contrast of 5 μ L penbritins (AMP 50 μ g/mL) with volume pPICZ α A empty carrier.Measure bacteriostatic diameter (bacteriostatic diameter=antibacterial circle diameter-aseptic scraps of paper diameter).

The result:

The bacteriostatic test result shows that 2# and 3# bacterial strain have bacteriostatic activity preferably to streptococcus aureus, streptococcus agalactiae, subtilis, and intestinal bacteria are not all had obvious effect.The 4# bacterial strain has bacteriostatic activity to streptococcus aureus, subtilis, and streptococcus agalactiae is not had bacteriostatic activity.The 5# bacterial strain only has bacteriostatic activity to streptococcus aureus, and subtilis, streptococcus agalactiae are not had bacteriostatic activity.(see Table 1, Fig. 4).

The inhibition zone diameter result (diameter cm) of the different yeast strain bacteriostatic tests of table 1 reorganization hepcidin

In the same way, detect the recombination microzyme expressed proteins that pPICZ α A-hepcidin ' transforms golden yellow grape ball, subtilis suppressed, the result as shown in Figure 5: the result shows that former antibacterial peptide only can suppress subtilis.

Claims (10)

1. artificial antibacterial peptide, its aminoacid sequence is shown in Seq ID No.1.

2. artificial antibacterial peptide, be by the aminoacid sequence shown in the Seq ID No.1 is replaced, disappearance, adding, cyclisation, L-type amino acid become D-type amino acid that obtain with the aminoacid sequence identical anti-microbial activity of polypeptide shown in the aminoacid sequence shown in the Seq ID No.1.

3. claim 1 or the 2 described artificial antibacterial peptides application in anti-streptococcus aureus (Staphylococcus aureus), subtilis (Bacillus subtilis), streptococcus agalactiae (Streptococcus agalactiae).

4. the gene of coding claim 1 or 2 described artificial antibacterial peptides.

5. the described gene of claim 4, its nucleotide sequence is shown in Seq ID No.2.

6. contain claim 4 or 5 described expression carrier.

7. expression vector according to claim 6 refers to pPICZ α A-hepcidin.

8. the preparation method of claim 1 or 2 described artificial antibacterial peptides refers to claim 6 or 7 described expression vectors are transformed in the host bacterium, cultivates the host bacterium and makes it express described artificial antibacterial peptide.

9. preparation method according to claim 8, described host bacterium refers to intestinal bacteria or yeast.

10. preparation method according to claim 8, described yeast refers to pichia bacterium (Pichia pastoris).

Images