CN101948911A - Primer, kit and method for detecting Toxoplasma gondii - Google Patents
Primer, kit and method for detecting Toxoplasma gondii Download PDFInfo
- Publication number
- CN101948911A CN101948911A CN 201010197675 CN201010197675A CN101948911A CN 101948911 A CN101948911 A CN 101948911A CN 201010197675 CN201010197675 CN 201010197675 CN 201010197675 A CN201010197675 A CN 201010197675A CN 101948911 A CN101948911 A CN 101948911A
- Authority
- CN
- China
- Prior art keywords
- primer
- toxoplasma gondii
- dna
- sample
- reference items
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of biotechnology, in particular relates to a primer, kit and method for detecting Toxoplasma gondii. The nucleotide sequence of the primer of the invention is as follows: the upstream primer is 5'-TCACAGGCAAGCTCGCCTGTGCTT-3', the downstream primer is 5'-TTTCCACCCTCCAGGAAAAGCA-3'; and Toxoplasma gondii can be diagnosed on gene level by using the primer. The kit for detecting Toxoplasma gondii by using the primer has higher sensitivity, high efficiency and high specificity in Toxoplasma gondii detection, the detection consumes less time, and the detection result is stable, thus avoiding the occurrence of incorrect detection results caused by adding false positive faults due to sample pollution in the current electrophoresis method. The invention also provides the method for detecting Toxoplasma gondii. The method uses the kit provided by the invention to detect Toxoplasma gondii, thus the detection consumes less time and the detection result is stable; and compared with a traditional filter paper method, a gel method and other methods, the method of the invention is more fast, sensitive and accurate.
Description
Technical field
The invention belongs to biological technical field, particularly, the present invention relates to a kind of primer, test kit and method that is used to detect toxoplasma gondii.
Background technology
Toxoplasmosis is that arch insect infection all over the world is very general, among the grownup of American and Britain by the parasitogenic a kind of infection of toxoplasma gondii, approximately 16-40% once infected, and the investigation that has reaches 70%, and Continent of Europe and Hispanic grownup, 50-80% had infection, and the Frenchman is up to 90%.China's arch insect infection is lower than abroad.But toxoplasma gondii multigravida placenta is invaded fetus, and can cause serious harm to it, as hydrocephalus, little deformity of brain, the blind intelligence growth obstacle etc. that reaches.Therefore, rapid and reliable antenatal diagnosis is the ten minutes needs.If conceived 3 months generation congenital infection, about 40% fetus has grievous injury, miscarriage, stillborn foetus or newborn child's illness appear, pathology or deformity that eye, brain or liver are perhaps arranged after the birth are as calcification in retinochoroiditis, cataract, the brain, hydrocephalus, microcephalus, dysnoesia, jaundice and hepatosplenomegaly.The infection that conceived end took place in 3 months, severe patient is less than 3%.Therefore check and treat to be very important that pregnant detection also can not be ignored before pregnant.
Present existing toxoplasma gondii detection method has following several:
1) directly microscopy is got blood samples of patients, marrow or cerebrospinal fluid, ascites pleural fluid, sputum, bronchoalveolar lavage fluid, aqueous humor, amniotic fluid vaginal secretions etc. and is made smear, or slicer such as lymphoglandula, muscle, liver, placenta, make Rui Shi or Ji's Albert'stain Albert microscopy can find trophont or packing, but it is not high to detect positive rate, sensitive inadequately credible.
2) animal inoculation pvaccination or tissue culture are got body fluid to be checked or tissue suspension, in the inoculation intraperitoneal mouse, can produce infection and find pathogenic agent, when first-generation inoculation is negative, answer blind passage 3 times; Or make tissue (monkey kidney or porcine kidney cell) and cultivate to separate, to identify toxoplasma gondii.But this method time is long, and recall rate is low.
3) immunologic test detects the used antigen of antibody and mainly contains tachyzoite soluble antigen (kytoplasm antigen) and membrane antigens.The former antibody appearance early (detects with stain test, indirect immunofluorescence assay) and the latter's antibody appearance later (with detections such as indirect hemagglutination tests).Adopt the several different methods detection can play complementary action and improve recall rate simultaneously.But because but toxoplasma gondii long-term existence in human body cell generally is difficult to distinguish existing disease infection or infection in the past so detect antibody.
4) the domestic polymerase chain reaction,PCR of having set up of DNA detection technology is diagnosed this virus, and compares with probe hybridization, animal inoculation pvaccination and immunologic test method, shows tool high special, sensitivity and advantage such as quick.
PCR detects specificity and the susceptibility with height, can detect the polypide DNA of trace, thereby infer that whether polypide exists, and can yet be regarded as a kind ofly to judge that more effectively parent has or not the etiological diagnosis means of worm mass formed by blood stasis.Use PCR diagnosis immune deficiency patient arch insect infection abroad in recent years and obtain result preferably.But traditional PCR diagnosis needs use electrophoresis detection, is the Chinese patent application of CN200710032159.1 as application number, and electrophoresis detection sensitivity generally and be not suitable for clinically causes detected result inaccurate because of sample contamination increases false positive results easily.
Summary of the invention
The purpose of this invention is to provide a kind of primer that is used to detect toxoplasma gondii, utilize this primer on gene level, to diagnose rapidly toxoplasma gondii.
Another object of the present invention provides a kind of test kit that is used to detect toxoplasma gondii that utilizes the preparation of above-mentioned primer, and this test kit has higher sensitivity and efficient, high specific in the detection of toxoplasma gondii, detects consuming time less, detected result stablizes.
Another purpose of the present invention provides a kind of method that is used to detect toxoplasma gondii, and this method utilizes test kit provided by the invention to carry out the detection of toxoplasma gondii, detect consuming time less, detected result is stable.
Above-mentioned technical problem of the present invention is implemented by the following technical programs:
A kind of primer that is used to detect toxoplasma gondii is characterized in that this primer is a toxoplasma gondii specific b gene, and the upstream primer of this primer has nucleotide sequence shown in SEQ ID No.1 (5 '-TCACAGGCAAGCTCGCCTGTGCTT-3 '); Downstream primer has nucleotide sequence shown in SEQ ID No.2 (5 '-TTTCCACCCTCCAGGAAAAGCA-3 ').Described primer can specificly amplify toxoplasma gondii B gene, when this primer is used to detect toxoplasma gondii, preferably (gene of β-globin) is as the confidential reference items primer with the peculiar gene beta Globulin of people DNA conserved sequence, the upstream primer nucleotides sequence of this confidential reference items primer is classified SEQ ID NO.3(5 '-TGACAAGGCCATGAGGCTGGTGTA-3 ' as), the downstream primer nucleotides sequence is classified SEQ ID NO.4(5 '-GAGTCCATCACGATGCCAGTGGTA-3 ' as).Our experiments show that by the PCR reaction, this confidential reference items primer can more fast and effeciently be discerned human DNA than other primer according to the design of people DNA conserved sequence, can determine the extraction quality of template, avoids the false negative of amplification.
A kind of test kit that is used to detect toxoplasma gondii comprises PCR reaction solution, described primer and confidential reference items primer mixed solution, negative control thing, positive control and sterilization distilled water.This test kit adopts primer provided by the invention, is a kind of instrument with detection toxoplasma gondii of better sensitivity and efficient, high specific.
As preferred version, the upstream primer of described confidential reference items primer has the nucleotide sequence shown in SEQ ID No.3; Downstream primer has the nucleotide sequence shown in SEQ ID No.4.
As preferred version, described PCR reaction solution is the Tris-HCl40 mM that comprises pH 8.4, MgCl
215～24mM, KCl 50 mM, (NH
4)
2 SO
410 mM, the mixing solutions of the Taq DNA polymerase of dNTP 0.4mM and final concentration 0.06～0.10 U/ μ L.More preferred scheme is that described PCR reaction solution is Tris-HCl 40 mM that comprise pH 8.4, MgCl
220 mM, KCl 50 mM, (NH
4)
2 SO
410 mM, the mixing solutions of the Taq DNA polymerase of dNTP 0.4mM and final concentration 0.08 U/ μ L.
As preferred version, described primer and confidential reference items primer mixed solution are to be formed by 10 μ M confidential reference items primers and 10 μ M primer mixed preparing, and wherein the volume ratio scope of confidential reference items primer/primer is 0.6～1.2.The volume ratio of best confidential reference items primer/primer is 1:1.
As preferred version, described positive control is the cervical cell DNA that contains the toxoplasma gondii specific gene, and the negative control thing is ddH
2O.
A kind of method that detects toxoplasma gondii may further comprise the steps: 1) extract sample DNA; 2) use primer provided by the invention or test kit that the DNA that step 1) obtains is carried out pcr amplification; 3) detect step 2) resulting amplified production.This method is a kind of method with detection toxoplasma gondii of better sensitivity and efficient, high specific.This method is simple, with low cost, be suitable for extensive popularization.As preferred version, vein whole blood or uterine neck suspension cell and secretory product that the sample in the step 1) is behaved, the detection method of the employing in the step 3) is the micro-fluid chip detection method.The micro-fluid chip detection method is the some micron order passages of etching on glass-chip, make up " microscale experiment chamber ", analytic sample enters chip from last sample pipeline, under electric field or pressure field effect, enter separating pipe, sample is finished automatic separation in separating pipe, arrive the monitoring point, LASER Excited Fluorescence is luminous, and instrument is collected and automatic data processing, finishes the automated analysis on the chip.
The present invention is by carrying out toxoplasma gondii B gene test to the DNA in patient's vein hemocyte or cervical cell and the secretory product, thereby whether the diagnosis patient has infected toxoplasma gondii, specifically may further comprise the steps:
1) primer provided by the invention and confidential reference items primer (being respectively the nucleotide sequence shown in the nucleotide sequence shown in SEQ ID NO:1 and 2 and SEQ ID NO:3 and 4) are mixed, the DNA of tested sample is carried out the multiplex PCR amplification; Or adopt test kit provided by the invention that the DNA of tested sample is carried out the multiplex PCR amplification; The target gene clip size that is amplified has nothing in common with each other;
2) amplified production detects by micro-fluid chip;
3) by to the judgement of each detected peaks position, determine detected segmental size, thereby determine the gene that is detected, judge the viral classification that clinical sample infects;
4) result judges: a) any specific peak do not occur, illustrate that the DNA of clinical sample does not extract, it is invalid to detect; B) DNA confidential reference items specific peak only occurs, illustrating does not have arch insect infection; C) DNA confidential reference items and toxoplasma gondii B gene specific peak occur, arch insect infection has been described.
Compare with test kit with conventional detection, the present invention has the following advantages:
1) the present invention adopts round pcr, and toxoplasma gondii specific gene fragment is increased.Its difference with the main aspect of other existing gene tests is: this test kit detection means is the micro-fluid chip detection method, being different from electrophoresis detection or RT-PCR instrument detects, detected result is more directly perceived, highly sensitive, credible good, and detection chip is disposable use, can not be fit to clinical application because of pollution increases false positive results.
2) adding of confidential reference items primer: the Auele Specific Primer of the preferred peculiar gene of people DNA conserved sequence is as the confidential reference items primer, this confidential reference items primer design has been selected people's beta Globulin (gene of β-globin) for use, because all contain this gene in the human body cell, introduce this internal control gene and can determine the extraction quality of clinical sample, avoid the false negative of amplification.
3) method of detection toxoplasma gondii provided by the invention can be diagnosed on gene level rapidly, has sensitivity preferably and specificity.This method can be directly detects patient's clinical sample (for example venous blood, uterine neck suspension cell), virus strain is not detected after not needing sample cultivated again, and has saved the time.Simultaneously, the micro-fluid chip detection method is simpler, quick than traditional DNA electrophoresis detection method, directly perceived, for clinical application provides accurately, instructed timely.Therefore, method and technology maturation provided by the present invention, detected result is stable, and is more faster, sensitive than traditional filter paper method, gel method etc., accurate.
Description of drawings
Fig. 1 is the electrophorogram of primer and confidential reference items primer mixed solution DNA amplification sample, and wherein 1-5 is a uterine neck suspension cell DNA sample, and 6-10 is a venous blood DNA sample ,+be positive control ,-be negative control, 200 and 300 is bp numbers of the Marker band of correspondence.
Fig. 2 is the primer of different ratios and the DNA sample drawing of confidential reference items primer mixed solution amplification toxoplasma gondii infection, wherein the volume ratio of confidential reference items primer and primer is as follows in each point sample hole: 1-2: confidential reference items primer/primer=0.6,3-4: confidential reference items primer/primer=1.0,5-6: confidential reference items primer/primer=1.2,-be negative control, 200 and 300 is bp numbers of the Marker band of correspondence.
Fig. 3 is the DNA sample drawing of the PCR reaction solution amplification toxoplasma gondii infection of different components, wherein 1-2:MgCl
215mM, Taq DNA polymerase 0.06U/ μ l, 3-4:MgCl
220mM, Taq DNA polymerase 0.08U/ μ l, 5-6:MgCl
224mM, Taq DNA polymerase 0.10U/ μ l ,-be negative control, 200 and 300 is bp numbers of the Marker band of correspondence.
Fig. 4 is the micro-fluid chip detected result figure of the DNA sample of not toxoplasma gondii infection.
Fig. 5 is the micro-fluid chip detected result figure of the DNA sample of toxoplasma gondii infection.
Embodiment
Followingly the present invention is described with reference to specific embodiment and accompanying drawing.It will be appreciated by those skilled in the art that these embodiment only are used to illustrate the present invention, the scope that it does not limit the present invention in any way.
Employed technology in following examples unless stated otherwise, is routine techniques known to those skilled in the art; Employed plant and instrument, reagent etc., only this specification sheets specifies, is that the research of this area and technician can be by public approach acquisition." PCR " of the present invention is meant polymerase chain reaction (polymerase chain reaction, PCR), be that a pair of oligo DNA of usefulness well known to those skilled in the art is as primer, by the repeatedly circulation of synthetic this one-period of sex change-annealing-DNA of heating, a Protocols in Molecular Biology that makes target DNA fragment obtain increasing.
The detecting instrument that micro-fluid chip detection method of the present invention is used is that the number of patent application of this instrument is: CN200910272437.X, CN200920230097.X, CN200910272874.X, CN200910273037.0, CN200920288540.9, CN200910272436.5 available from the beautiful micro-fluid chip electrophoresis apparatus of giving birth to the production of medicine equipment company limited in Ningbo.
Embodiment 1:The composition of test kit and preparation
Test kit of the present invention is made up of PCR reaction solution, primer and confidential reference items primer mixed solution, negative control thing, positive control and sterilization distilled water.
1. prepare the PCR reaction solution: Tris-HCl(pH 8.4) 40 mM, MgCl
215～24mM, KCl 50 mM, (NH
4)
2 SO
410 mM, dNTP 0.4 mM, the final concentration of Taq DNA polymerase are 0.06～0.10 U/ μ L.MgCl wherein
2Best concentration is 20 mM, and the best final concentration of Taq DNA polymerase is 0.08 U/ μ L;
2. prepare primer and confidential reference items primer mixed solution: formed by the confidential reference items primer of 10 μ M and the primer mixed preparing of 10 μ M, confidential reference items primer/primer volume ratio scope is 0.6～1.2, and wherein preferred the confidential reference items primer/the primer volume ratio is 1:1; Confidential reference items primer (being the B297 primer) is at internal control gene---(a pair of Auele Specific Primer of gene design of β-globin) can specific amplified goes out the beta Globulin (conservative fragments of 297bp size in the gene of β-globin) to beta Globulin.
3. distilled water (ddH sterilizes
2O);
4. positive control: the cervical cell DNA that contains toxoplasma cdna;
5. negative control thing: ddH
2O.
Be the convenient effect of the present invention of describing, below each embodiment all adopt the optimal proportion of this test kit, test kit promptly of the present invention comprises:
1. 40 mM PCR reaction solution: Tris-HCl(pH 8.4), MgCl
220 mM, KCl 50 mM, (NH
4)
2 SO
410 mM, dNTP 0.4 mM, the final concentration of Taq DNA polymerase are 0.08 U/ μ L;
2. primer and confidential reference items primer mixed solution: formed by the confidential reference items primer of 10 μ M and the primer mixed preparing of 10 μ M, confidential reference items primer/primer volume ratio is 1:1;
3. distilled water (ddH sterilizes
2O);
4. positive control: the cervical cell DNA that contains toxoplasma cdna;
5. negative control thing: ddH
2O.
Embodiment 2: the preparation of clinical sample (pressing blood, tissue extraction test kit)
It is human vein blood sample or cervical cell sample that present embodiment prepares the employed sample of detection method of the present invention, and extracting with test kit is that the blood/tissue genome that Geneinn Biotechnology (Ningbo) Co., Ltd. produces extracts test kit (number of registration: No. the 1400013rd, river in Zhejiang Province, Zhejiang food medicine prison tool (standard) word 2010).Details are as follows to use this test kit to extract 5 clinical uterine neck suspension cell samples and 5 clinical vein blood samples respectively.
1. sample process
A, blood sample handle: get the blood sample that fresh blood sample maybe will add antithrombotics and thaw, get 100 μ l behind the mixing in the 1.5ml centrifuge tube.
B, suspension cell sample process: after the cervical tissue suspension sample natural subsidence, get sedimentation solution bottom enchylema 1ml and put into the EP pipe, the centrifugal 2min of 12000r/min abandons supernatant.
2. absorption → rinsing → washing → dissolving.Concrete operations are extracted the test kit specification sheets with the blood/tissue genome.
Embodiment 3: with primer and confidential reference items primer mixed solution DNA amplification sample
Present embodiment is 10 DNA samples that employing primer provided by the present invention and confidential reference items primer sequence amplification embodiment 2 are extracted, and adopts the amplification of detected through gel electrophoresis PCR.Primer and confidential reference items primer sequence see Table 1.
Table 1 pcr amplification primer and confidential reference items primer sequence
1, the pcr amplification system sees Table 2.
Table 2
2, pcr amplification program
94 ℃ of fs, 2 minutes;
94 ℃ of subordinate phase, 20 seconds; 56 ℃, 30 seconds; 72 ℃, 45 seconds; 30 circulations;
72 ℃ of phase IIIs, 5 minutes.
3, agarose electrophoresis detects
The sepharose of employing 2% detects point sample to pcr amplification product: 5 μ l PCR products+1 μ l, 6 * Loading Buffer, deposition condition: 100V, 100mA, 30 minutes.
4, electrophoresis result
As shown in Figure 2, wherein No. 3 sample and No. 6 sample amplification go out the B gene band of toxoplasma gondii, are the dna sample of toxoplasma gondii infection, and other 7 samples all only amplify confidential reference items B297 band, are the dna sample of toxoplasma gondii infection not.
Embodiment 4: the primer of different ratios and confidential reference items primer mixed solution DNA amplification sample
Present embodiment adopts the mixed solution by the formulated different primer ratios of primer and confidential reference items primer that No. 3 dna sample that contains toxoplasma cdna among the embodiment 3 increased, and adopts the amplification of detected through gel electrophoresis PCR.
The volume ratio of confidential reference items primer/primer is decided to be 3 gradients, adopts the primer of these 3 kinds of different ratioss and confidential reference items primer respectively above-mentioned No. 3 dna sample to be increased.
1, the pcr amplification system sees Table 3.
Table 3
2, pcr amplification program
94 ℃ of fs, 2 minutes;
94 ℃ of subordinate phase, 20 seconds; 56 ℃, 30 seconds; 72 ℃, 45 seconds; 30 circulations;
72 ℃ of phase IIIs, 5 minutes.
3, agarose electrophoresis detects: the sepharose of employing 2% detects point sample to pcr amplification product: 5 μ l PCR products+1 μ l, 6 * Loading Buffer, deposition condition: 100V, 100mA, 30 minutes.
4, electrophoresis result: as shown in Figure 3, when the volume ratio of confidential reference items primer/primer is respectively 0.6,1.0,1.2, can both amplify correct band, just when the volume ratio of confidential reference items primer/primer is 1.0, band is the brightest, and expanding effect is best, in the time of can confirming that volume ratio when confidential reference items primer/primer is between 0.6～1.2, it all is feasible that PCR detects, and the volume ratio of preferred confidential reference items primer/primer is 1.0.
Embodiment 5: the PCR reaction solution DNA amplification sample of different components
Present embodiment adopts the MgCl by different concns
2, different enzyme amounts and 40 mM Tris-HCl(pH 8.4), 50 mM KCl, 10 mM (NH
4)
2SO
4, the formulated PCR reaction solution of 0.4 mM dNTP increases to No. 3 dna sample that contains toxoplasma cdna among the embodiment 4, and adopts the amplification of detected through gel electrophoresis PCR.
With MgCl
2Final concentration be decided to be 3 gradients, be respectively: 15 mM, 20 mM, 24mM.Final concentration with Taq DNA polymerase also is decided to be 3 gradients simultaneously, is respectively: 0.06U/ μ l, 0.08 U/ μ l, 0.10 U/ μ l.Then with MgCl
2With the corresponding respectively combination of Taq DNA polymerase lower concentration, middle concentration, high density, obtain the PCR reaction solution of 3 kinds of different componentss, concrete component is as follows:
First group: MgCl
215 mM, Taq DNA polymerase 0.06U/ μ l, Tris-HCl(pH 8.4) 40 mM, KCl 50 mM, (NH
4)
2SO
410 mM, dNTP0.4 mM.
Second group: MgCl
220 mM, Taq DNA polymerase 0.08U/ μ l, Tris-HCl(pH 8.4) 40 mM, KCl 50 mM, (NH
4)
2SO
410 mM, dNTP0.4 mM.
The 3rd group: MgCl
224mM, Taq DNA polymerase 0.10U/ μ l, Tris-HCl(pH 8.4) 40 mM, KCl 50 mM, (NH
4)
2SO
410 mM, dNTP0.4 mM.
1.PCR amplification system sees Table 4.
Table 4
2, pcr amplification program
94 ℃ of fs, 2 minutes;
94 ℃ of subordinate phase, 20 seconds; 56 ℃, 30 seconds; 72 ℃, 45 seconds; 30 circulations;
72 ℃ of phase IIIs, 5 minutes.
3, agarose electrophoresis detects: adopt the sepharose of mass concentration 2% pcr amplification product to be detected point sample: 5 μ l PCR products+1 μ l, 6 * Loading Buffer, deposition condition: 100V, 100mA, 30 minutes.
4, electrophoresis result: as shown in Figure 3, the PCR reaction solution of 3 kinds of different componentss can both amplify correct DNA band, just works as MgCl
2When 20 mM, Taq DNA polymerase 0.08U/ μ l, amplified band is the brightest, and can confirm that the component of PCR reaction solution can be decided to be: Tris-HCl(pH 8.4) 40 mM, MgCl
215～24mM, KCl 50 mM, (NH
4)
2SO
410 mM, dNTP 0.4 mM, Taq DNA polymerase 0.06～0.10 U/ μ L, wherein MgCl
2Best concentration is 20 mM, and Taq DNA polymerase optimum concn is 0.08 U/ μ L.
Embodiment 6: micro-fluid chip detects the sample method
Present embodiment detects the DNA sample that is amplified among the embodiment 3 for adopting micro-fluid chip.Micro-fluid chip detects sample and specifically comprises following operation steps:
1, connects power supply, capillary electrophoresis apparatus (model MS-CE-1 is available from the beautiful medicine equipment company limited of giving birth in Ningbo) preheating 30 minutes.
2, joint detection pond and mainframe box front output interface, in the buffered soln bottle, add the buffered soln that newly prepares and (contain 2% HPMC-50,80mM MES, 40mM Tris), electrode and two ends capillaceous are immersed in the buffered soln, keep the outlet of kapillary two ends on same horizontal plane, and must be full of buffered soln in the kapillary, shut the instrument main entrance, after confirming that the instrument each several part connects correctly, press the high voltage startup button, turn-off button if dynamic high-pressure takes place should press immediately unusually, after inspection and the eliminating fault, pressurization again again.
3, electric sample introduction: change buffered soln bottle on the sample holder with sample bottle, insert electrode and kapillary, shut the after-applied required voltage 380v of main entrance, wait to reach 30 seconds scheduled times after, disconnect high pressure, can begin experiment after changing the buffered soln bottle.
4, fluid pressure difference sample introduction: sample bottle is placed on the difference of altitude sample introduction parts, adjust the sample introduction height as required, then sample introduction end capillaceous is inserted in the sample pool, wait to reach and take out the sample introduction support of putting into buffered soln after the scheduled time and can begin experiment.
5, set Instrument working parameter according to the experiment needs: sample introduction voltage is 380v, and electrophoretic voltage is 700v.
6, wait for that the instrument each several part is working properly after, can begin the analytical work of sample, specific as follows: that micro-fluid chip is placed on the support, regulate chip position, make and detect the light velocity, move sample introduction and electrophoretic procedures, when the DNA band passes through check point by apart from chip sample delivery point 1cm place, its information is noted by data collecting system, and is converted into electrical signal.
7, experiment finishes the back powered-down, with distilled water flushing kapillary 30 minutes, or buffered soln remained on is about to kapillary in the kapillary and places pressure washer.
Detect the DNA sample that is amplified among the embodiment 3 according to the method described above, wherein not the micro-fluid chip detected result figure of the sample of toxoplasma gondii infection as shown in Figure 4, the micro-fluid chip detected result figure of the sample of toxoplasma gondii infection is as shown in Figure 5.Entrust Invitrogen Shanghai branch office to the comparison of checking order of the amplification of the sample of toxoplasma gondii infection shown in Fig. 5, by comparison as can be known, the sequence that this clinical sample amplification obtains is the distinctive gene order of toxoplasma gondii really.
＜110〉Geneinn Biotechnology (Ningbo) Co., Ltd.
＜120〉be used to detect primer, test kit and the method for toxoplasma gondii
<130>?ZH10015
<160>?4
<170>?PatentInversion3.3
<210>?1
<211>?24
<212>?DNA
＜213〉artificial sequence
<400>?1
tcacaggcaagctcgcctgtgctt 24
<210>?2
<211>?22
<212>?DNA
＜213〉artificial sequence
<400>?2
tttccaccctccaggaaaagca 22
<210>?3
<211>?24
<212>?DNA
＜213〉artificial sequence
<400>?3
tgacaaggccatgaggctggtgta 24
<210>?4
<211>?24
<212>?DNA
＜213〉artificial sequence
<400>?4
gagtccatcacgatgccagtggta 24
Claims (10)
1. a primer that is used to detect toxoplasma gondii is characterized in that this primer is a toxoplasma gondii specific b gene, and the upstream primer of this primer has the nucleotide sequence shown in SEQ ID No.1; Downstream primer has the nucleotide sequence shown in SEQ ID No.2.
2. a test kit that is used to detect toxoplasma gondii is characterized in that comprising PCR reaction solution, primer as claimed in claim 1 and confidential reference items primer mixed solution, negative control thing, positive control and sterilization distilled water.
3. test kit according to claim 2, the upstream primer that it is characterized in that described confidential reference items primer has the nucleotide sequence shown in SEQ ID No.3; Downstream primer has the nucleotide sequence shown in SEQ ID No.4.
4. according to claim 2 or 3 described test kits, it is characterized in that described PCR reaction solution is the Tris-HCl40 mM that comprises pH 8.4, MgCl
215～24 mM, KCl 50 mM, (NH
4)
2SO
410 mM, the mixing solutions of the Taq DNA polymerase of dNTP 0.4mM and final concentration 0.06～0.10 U/ μ L.
5. test kit according to claim 2 is characterized in that described PCR reaction solution is the Tris-HCl40 mM that comprises pH 8.4, MgCl
220 mM, KCl 50 mM, (NH
4)
2SO
410 mM, the mixing solutions of the Taq DNA polymerase of dNTP 0.4mM and final concentration 0.08 U/ μ L.
6. according to claim 2 or 3 or 5 described test kits, it is characterized in that described primer and confidential reference items primer mixed solution are to be formed by 10 μ M confidential reference items primers and 10 μ M primer mixed preparing, wherein the volume ratio scope of confidential reference items primer/primer is 0.6～1.2.
7. according to claim 2 or 3 or 5 described test kits, it is characterized in that described positive control is the cervical cell DNA that contains the toxoplasma gondii specific gene; The negative control thing is ddH
2O.
8. method that detects toxoplasma gondii is characterized in that may further comprise the steps:
1) extracts sample DNA;
2) use described primer of claim 1 or the described test kit of claim 3 that the DNA that step 1) obtains is carried out pcr amplification;
3) detect step 2) resulting amplified production.
9. method according to claim 8 is characterized in that: vein whole blood or uterine neck suspension cell and secretory product that the sample in the described step 1) is behaved; The detection method of the employing in the step 3) is the micro-fluid chip detection method.
10. method according to claim 8 is characterized in that this method may further comprise the steps:
1) with the described primer of claim 1 or the described test kit of claim 3 DNA of tested sample is carried out the multiplex PCR amplification; The target gene clip size that is amplified has nothing in common with each other;
2) amplified production detects by micro-fluid chip;
3) by to the judgement of each detected peaks position, determine detected segmental size, thereby determine the gene that is detected, judge the viral classification that clinical sample infects;
4) result judges: a) any specific peak do not occur, illustrate that the DNA of clinical sample does not extract, it is invalid to detect; B) DNA confidential reference items specific peak only occurs, illustrating does not have arch insect infection; C) DNA confidential reference items and toxoplasma gondii B gene specific peak occur, arch insect infection has been described.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010197675 CN101948911A (en) | 2010-08-27 | 2010-08-27 | Primer, kit and method for detecting Toxoplasma gondii |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010197675 CN101948911A (en) | 2010-08-27 | 2010-08-27 | Primer, kit and method for detecting Toxoplasma gondii |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101948911A true CN101948911A (en) | 2011-01-19 |
Family
ID=43452537
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010197675 Pending CN101948911A (en) | 2010-08-27 | 2010-08-27 | Primer, kit and method for detecting Toxoplasma gondii |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101948911A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102277418A (en) * | 2011-01-26 | 2011-12-14 | 宁波基内生物技术有限公司 | Primer, kit and method used for detecting Treponema pallidum |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101182593A (en) * | 2007-12-07 | 2008-05-21 | 东北大学 | Gas stove outer circulation cooling method of double chamber atmosphere pressure hardening furnace and cooling system thereof |
| CN101302524A (en) * | 2008-04-30 | 2008-11-12 | 山东大学 | Fusion gene of Toxoplasma gondii multi-epitope gene and cholera toxin CTXA2/B subunit and use thereof |
| CN101613751A (en) * | 2009-05-27 | 2009-12-30 | 中国人民解放军军事医学科学院军事兽医研究所 | The PCR kit for fluorescence quantitative of rapid detection toxoplasma gondii |
-
2010
- 2010-08-27 CN CN 201010197675 patent/CN101948911A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101182593A (en) * | 2007-12-07 | 2008-05-21 | 东北大学 | Gas stove outer circulation cooling method of double chamber atmosphere pressure hardening furnace and cooling system thereof |
| CN101302524A (en) * | 2008-04-30 | 2008-11-12 | 山东大学 | Fusion gene of Toxoplasma gondii multi-epitope gene and cholera toxin CTXA2/B subunit and use thereof |
| CN101613751A (en) * | 2009-05-27 | 2009-12-30 | 中国人民解放军军事医学科学院军事兽医研究所 | The PCR kit for fluorescence quantitative of rapid detection toxoplasma gondii |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102277418A (en) * | 2011-01-26 | 2011-12-14 | 宁波基内生物技术有限公司 | Primer, kit and method used for detecting Treponema pallidum |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107513575B (en) | It is a kind of to detect the pretreating reagent box and its application that cloth Shandong bacterium infects | |
| CN102277455B (en) | Primer, probe and assay kit used for detecting porcine circovirus, porcine pseudorabies virus and porcine parvovirus | |
| CN103131798A (en) | Norovirus real-time fluorescent RT-PCR detection kit and application thereof | |
| CN110283935A (en) | A kind of African swine fever virus LAMP detection kit and its application | |
| CN102559935A (en) | M-gene based fluorescent RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection method of Nipah virus | |
| CN103305634A (en) | Isothermal amplication rapid detection method of H7N9 avian influenza virus | |
| CN102559930A (en) | Kit of detecting hepahtis C virus by fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) | |
| CN105525012A (en) | Molecular identification method of peanut hybrid | |
| CN103122396A (en) | Kit for detecting human cytomegalovirus (HCMV) | |
| CN101550454B (en) | Real-time fluorescence PCR reagent kit for human metapneumovirus | |
| CN104745689A (en) | Primers, probe and kit used for detecting bordetella pertussis | |
| CN102071263B (en) | Nested fluorescence reverse transcription-polymerase chain reaction (RT-PCR) detection reagent for avian influenza virus (AIV) H5 subtype and detection kit | |
| CN105349661A (en) | Chlamydia trachomatis and gonococcus nucleic acid detection kit | |
| CN103074429B (en) | UU (ureaplasma urealyticum) detection kit | |
| CN104593486A (en) | Primer, probe and kit all used for detecting blood fluke | |
| CN107502679A (en) | Differentiate LAMP primer and discrimination method and the application of PRRSV strain gene hypotypes | |
| CN101948911A (en) | Primer, kit and method for detecting Toxoplasma gondii | |
| CN102277418A (en) | Primer, kit and method used for detecting Treponema pallidum | |
| CN114592047B (en) | Method for detecting circulating tumor cells and application thereof | |
| CN101580883A (en) | Respiratory syncytial virus real-time fluorescence PCR detection kit | |
| CN107236827B (en) | Kit and method for detecting transmissible gastroenteritis virus of swine | |
| CN105316428A (en) | Method for detecting human cytomegalovirns PP65 genes and kit | |
| CN102876814B (en) | Real-time fluorescence RT-HDA (Reverse Transcriptase-Helicase-Dependent Isothermal Amplification) kit and primer for detecting foot-and-mouth disease virus | |
| CN107177692A (en) | Cryptosporidium, the quick detection of giardia lamblia and source tracing method in a kind of municipal sewage | |
| CN102168148B (en) | Primers, reagent kits and method for detecting human cytomegalovirus and/or herpes simplex virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110119 |