CN101935679A

CN101935679A - Heterogenous synthetic method of hyaluronic acid based on Gram-positive safe microorganisms

Info

Publication number: CN101935679A
Application number: CN2010101178893A
Authority: CN
Inventors: 程海荣; 邓子新
Original assignee: ZIBO KERUI CONTROL SYSTEM ENGINEERING Co Ltd; Shanghai Jiaotong University
Current assignee: ZIBO KERUI CONTROL SYSTEM ENGINEERING Co Ltd; Shanghai Jiaotong University
Priority date: 2010-03-04
Filing date: 2010-03-04
Publication date: 2011-01-05

Abstract

The invention relates to a heterogenous synthetic method of hyaluronic acid based on Gram-positive safe microorganisms, comprising the following steps of: cloning a gene (from SEQ ID No.31 to SEQ ID No.43 in a sequence table) related to hyaluronic acid precursor synthesis from a Gram-positive safe microorganism host; redesigning and synthesizing a hyaluronic acid synthetase gene (from SEQ ID No.1 to SEQ ID No. 27 in the sequence table) according to gene codon usage bias of the Gram-positive safe microorganism host; combining the gene related to the hyaluronic acid precursor synthesis and the optimized hyaluronic acid synthetase gene into a gene expression box; finally, converting the gene expression box into a Gram-positive microorganism host bacterium to obtain a Gram-positive gene engineering safe host bacterium which can secrete hyaluronic acid; and obtaining the hyaluronic acid based on the Gram-positive safe microorganisms by fermentation culture. The invention greatly increases ability of synthesizing the hyaluronic acid by host cells.

Description

Hyaluronic allos synthetic method based on Gram-positive safety microorganism

Technical field

What the present invention relates to is a kind of method of gene engineering technology field, specifically is a kind of hyaluronic allos synthetic method based on Gram-positive safety microorganism.

Background technology

Hyaluronic acid (Hyaluronic Acid, hereinafter to be referred as HA) be not branch's macromolecule polysaccharide of a kind of linearity, with UDP-glucuronic acid (UDP-GlcUA) and two kinds of precursors of UDP-N-acetyl glucosamine ammonia (UDP-N-GlcNAc) through hyaluronic acid synthetase (HA synthases, HAS) catalysis is synthetic, and its molecular-weight average can be up to arriving millions of dalton.It is as a kind of multi-functional matrix, be distributed widely in human tissue organ, in the normal physiological activity of body, bring into play important effect with its distinctive molecular structure and physico-chemical property, as lubricated joint, keep the skin good elasticity, regulate vessel wall permeability, stimulate and regulate immunity system, regulate protein and Water-Electrolyte diffusion and running and promotion wound healing etc., the physiology of itself and body and the relation of pathology are very close.HA has been widely used in medicine (Mazieres, et al 2007), drug conveying carrier (Fuente, the et al 2008 of preparation treatment of joint disease; Bechara, et al 2008), dermal filler (Romagnoli, et al 2008; Tezel and Fredrickson, 2008) and medicine linking agent field of medicaments aspects such as (Leonelli, et al 2008).

The production method that two kinds of HA are arranged at present, a kind of is to extract in animal tissuess such as cockscomb, another kind is to adopt some attenuated strains (streptococcus zooepidemicus or streptococcus equi etc.) among the suis C group to ferment, and extracts from fermented liquid.Though the HA that extracts from cockscomb early approved is used for above-mentioned field of medicaments, yet therefrom the HA of Ti Quing is combined with a large amount of glycoprotein and glycolipid, make its separation and purification very difficult, yield very low (every hectogram cockscomb only can extract the pure product of 0.4 gram).And, the pollution of virokine and other virulence factor between the hyaluronic acid in cockscomb source is vulnerable to plant.Because extract the above deficiency of HA from animal tissues, people turn to sight microbial fermentation to prepare HA gradually.What research was maximum at present is exactly to adopt streptococcus zooepidemicus or class streptococcus equi to come fermentative production HA.But because above-mentioned streptococcus is in conditioned pathogen, there are potential harm in health and environment to producers, studies show that more and more such suis also can produce a certain amount of intracellular toxin (endotoxin) and other virulence factor (virulence factors) (Leonard, et al 1998; Steiner and Malke, 2002; Hashikawa, et al 2004; Lindsay, et al 2009), make the HA that from fermented liquid, extracts have the virulence factor contamination of heavy that comprises intracellular toxin.The HA of field of medicaments use at present still adopts from tissues such as cockscomb and extracts, the very limited very costliness of product price that makes in the complicated source with raw material of its extraction process.Therefore study that a kind of extracting method is simple, raw material is easy to get, the novel hyaluronic preparation method of production safety and nontoxic prime factor seems very necessary.

Find through retrieval prior art, Chinese patent literature CN1636052A, open day 2005-7-6, put down in writing a kind of " in recombinant host cell, producing hyaluronic method ", Chinese patent literature CN101426925A, open day 2009-5-6, put down in writing a kind of " in bacillus cell, producing hyaluronic method ", and american documentation literature US2002/0160489, open day 2002-10-31, put down in writing a kind of " Streptococcus equisimilis hyaluronan synthase gene andexpression thereof in Bacillus subtilis (the streptococcus equisimilis hyaluronan synthase gene of subtilis and its expression formula) ", this technology utilizes subtilis as the host, will derive from Streptococcusequisimilis hyaluronan synthase gene and regulating and controlling sequence thereof and be incorporated in the subtilis host genome and realize hyaluronic synthetic.

The general character of above-mentioned prior art is to have described the employing subtilis as the host, the promotor of synthetic hyaluronic genes involved and composing type amylase gene is constituted an artificial operon, all genes all utilize the promotor of this composing type amylase gene to start and transcribe, and hyaluronic synthetic propagation with host cell is to carry out synchronously.Though it is synthetic that above-mentioned technology can realize the allos of hyaluronic acid in subtilis, but exist conspicuous problem to be: along with hyaluronic synthetic, the viscosity of fermention medium also rises gradually, dissolved oxygen amount also descends rapidly, the ability that cell obtains oxygen also descends rapidly, the biomass of cell also increases slowly or stops to increase, and causes the synthetic hyaluronic ability of cell to descend rapidly therefrom.

Summary of the invention

The present invention is directed to the prior art above shortcomings, a kind of hyaluronic allos synthetic method based on Gram-positive safety microorganism is provided, improved the synthetic hyaluronic ability of host cell by growth greatly with hyaluronic synthetic separating with host cell, not only realize hyaluronic acid synthesizing in the gram-positive microorganism of safety, and its synthetic promptly can be composing type, also can be derivative.

The present invention is achieved by the following technical solutions, the present invention includes following steps:

The first step, from Gram-positive safety microorganism host, separate the synthetic relevant gene with hyaluronic acid precursor (being UDP-glucuronic acid and UDP-N-acetyl-glucosamine), these genes comprise: UDP-glucose dehydrogenase gene (UDP-glucose dehydrogenase gene), i.e. SEQ ID No.31, SEQ ID No.32, SEQ ID No.33, SEQID No.34; UTP-Cori ester transferase gene (UTP-glucose-1-phosphate Uridyltransferasegene), i.e. SEQ ID No.35, SEQ ID No.36, SEQ ID No.37; G-6-P mutase gene (Phosphoglucomutase gene), i.e. SEQ ID No.38, SEQ ID No.39; G-6-P isomerase gene (Phosphoglucoisomerase gene), i.e. SEQ ID No.40; Transaminase (Aminotransferase); be SEQ ID No.41, N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene (N-Acetyl-glucosamine-1-phosphate uridyltransferase gene), i.e. SEQ ID No.42, SEQ IDNo.43.

Described Gram-positive safety microorganism host is meant any in the following bacterium: Clostridium butyricum (clostridium butylicum or clostridium butyricum), Bacillus licheniformis (Bacillus licheniformis), Bacillus amyloliquefaciens (bacillus amyloliquefaciens), Bacillus cereus (useful or nontoxic bacillus cereus), Bacillus brevis (bacillus brevis), Bacillus pumilus (bacillus pumilus), Brevibacillus brevis (short genus bacillus), Bacillusstearothermophilus (bacstearothermophilus), Bacillus megaterium (bacillus megaterium), Bacillusnatto (bacillus natto), Bacillus subtilis (subtilis), Geobacillus stearothermophilus (stearothermophilus ground bacillus), Bacillus coagulans (Bacillus coagulans), Bacillus lentus (slowly genus bacillus), Bactroides amylophilus (bacteroides amylophilus).

Second step, according to the codon preference of the described Gram-positive safety of step 1 microorganism host to SEQ ID No.44, SEQ ID No.45, SEQ ID No.46, SEQ ID No.47, SEQ ID No.48 and SEQ ID No.49 carry out base replace carry out codon optimized, obtain SEQ ID No.1 respectively to SEQ ID No.27 totally 27 kinds of different sequences, these codon optimized sequences can be expressed in Gram-positive safety microorganism host better;

The described SEQ ID No.44 that contains, SEQ ID No.45, SEQ ID No.46, the microorganism of SEQ ID No.47 and SEQ ID No.48 gene respectively is: streptococcus zooepidemicus (Streptococcus zooepidemicus), class streptococcus equi (Streptococcus equisimilis), Paramecium bursaria paramecium bursaria Chlorella virus 1 (Paramecium bursaria Chlorella virus1), streptococcus pyogenes (Streptococcus pygenes) and streptococcus uberis (Streptococcus uberis).

Described Paramecium bursaria chlorella is a pair of cogeneration system, and chlorella is growth and breeding in Paramecium bursaria, can provide Paramecium bursaria needed nutrition again simultaneously.Have a kind of virus in chlorella, contain hyaluronan synthase gene in this viral genome, this expression of gene can be synthesized hyaluronic acid in chlorella.

The described base of carrying out is replaced and to be meant: the codon preference according to host genome carries out codon optimized, will be from other nonhost bacterium carry out the base replacement with the synthetic relevant gene of hyaluronic acid according to the codon preference that the gene of host bacterium is adopted when translating into protein, but do not change the amino acid whose kind of alkali yl coding, make from the gene synthetic relevant of other nonhost bacterium and can in the host bacterium, express efficiently with hyaluronic acid.

The 3rd step, will from SEQ ID No.1 in the SEQ ID No.27 any gene and SEQ ID No.31 to more than one gene and constitutive promoter or expression casette of inducible promoters composition of SEQID No.43 gene.

Described constitutive promoter is meant: the promotor that all has transcriptional activity any period that the host bacterium is being cultivated.

Described inducible promoters is meant: the specific period of cultivating the host bacterium just has the promotor of transcriptional activity, specifically comprises: chemically inducible promoter and physics inducement promotor.

Described chemically inducible promoter comprises: the promotor (Pbm-sacB) of fruit ficoll enzyme (levansucrase) gene of Bacillus megaterium (bacillus megaterium), the promotor (Pbm-xylA) of the xylose isomerase gene of Bacillus megaterium (bacillus megaterium), the promotor (Pbs-sacB) of fruit ficoll enzyme (levansucrase) gene of Bacillus subtilis (subtilis), the promotor (Pbs-xylA) of the xylose isomerase gene of Bacillus subtilis (subtilis), the pectinose of Eschelichia coli (intestinal bacteria) utilizes the promotor (Para) of operon, the promotor (Plac) of the lactose utilization operon of Eschelichia coli (intestinal bacteria), Eschelichiacoli (intestinal bacteria), the promotor (Pbm-sacB) of fruit ficoll enzyme (levansucrase) gene of preferred Bacillus megaterium (bacillus megaterium), the promotor (Pbm-xylA) of the promotor (Pbs-sacB) of fruit ficoll enzyme (levansucrase) gene of Bacillus subtilis (subtilis) and the xylose isomerase gene of Bacillus megaterium (bacillus megaterium).Most preferably bacillus megaterium the promotor (Pbm-sacB) of fruit ficoll enzyme (levansucrase) gene.

Transcribing in the following manner of described chemically inducible promoter realizes:

The promotor of described fruit ficoll enzyme (levansucrase) gene has only and adds after the sucrose just transcribing of possible initial its downstream gene, and the mass percent concentration of sucrose is 0.5% to 10%, preferred 2% to 6% (quality volume percent).

The promotor of described xylose isomerase gene have only add behind the wood sugar just may initial its downstream gene transcribe, the mass percent concentration of wood sugar is 0.5% to 8%, preferably 2%-6% (quality volume percent).

Described pectinose utilize the promotor of operon to have only to add after the pectinose just may initial its downstream gene transcribe, the mass percent concentration of pectinose is 0.5% to 8%, preferably 2%-6% (quality volume percent).

The promotor of described lactose utilization operon have only add behind the lactose just may initial its downstream gene transcribe, the mass percent concentration of lactose is 0.5% to 8%, preferably 2%-6% (quality volume percent).

The promotor of described physics inducement comprises: derive from the groESL gene of Bacillus subtilis (subtilis) heat shock promoter, derive from the dnaK gene of Bacillus subtilis (subtilis) heat shock promoter, derive from the heat shock promoter of the groE gene of Bacillus licheniformis (Bacillus licheniformis).

The 4th step, the method that adopts method that electricity transforms, prepares the method for protoplastis or prepare competent cell transform gram-positive microorganism host bacterium with expression casette, with the selective marker screening, obtain to secrete hyaluronic Gram-positive genetically engineered safety host bacterium;

Described selective marker is meant: being used for effectively screening contains the gene of host cell of the nucleic acid construct of hyaluronic acid synthesis related gene, such as: erythromycin resistance gene, chloramphenicol resistance gene, D-pectinose alcohol dehydrogenase gene, the ribitol dehydrogenase gene, spectinomycin resistance gene.

The 5th the step, Gram-positive genetically engineered safety host bacterium is carried out fermentation culture, add at cultivation stage and to induce hyaluronic acid synthetic inductor improving hyaluronic synthetic level, after the fermentation ends promptly from substratum separation and purification obtain hyaluronic acid based on Gram-positive safety microorganism.

The described hyaluronic acid synthetic inductor of inducing is meant: sucrose, wood sugar, pectinose or lactose.

Described fermentation culture is meant: join get glucose 5-20 grams per liter, yeast soaks powder 0.5-5 grams per liter, magnesium sulfate heptahydrate 0.3-3 grams per liter, potassium primary phosphate 3-8 grams per liter, Sodium phosphate dibasic 2-8 grams per liter, ammonium sulfate 2-8 grams per liter, Trisodium Citrate 2-5 grams per liter, iron vitriol 1-20 mg/litre, manganese sulfate monohydrate 1-20 mg/litre, anhydrous cupric sulfate 0.2-10 mg/litre, zinc chloride 0.2-10 mg/litre, regulates potential of hydrogen to 6.5-7.5 with citric acid or sodium hydroxide.Leavening temperature is the 28-37 degree, and preferred 30-37 degree most preferably is the 33-35 degree, and mixing speed is 300-600 rev/min.

Described hyaluronic acid is the straight chain macromole acidic mucopolysaccharide that is formed by connecting with the disaccharide units alternately by D-glucuronic acid (GlcUA) and N-ethanoyl glucosamine (GlcNAc), and its molecular weight is 50,000 to five megadaltons.

In order to strengthen the synthesis capability of hyaluronic acid at Gram-positive host mycetocyte, the present invention will be by synthesizing relevant gene (SEQ ID NO.1 to 27 with hyaluronic acid; SEQ ID No.31 to 43) makes up, constitute different expression casettes, be transformed into then in the karyomit(e) of host cell.One or more the gene of described expression casette in containing SEQ ID No.31 to 43, contain and to contain codon optimized hyaluronan synthase gene, transcribe and express under the control of constitutive promoter or inducible promoter and translate into activated zymoprotein, these zymoproteins can strengthen synthetic hyaluronic acid precursor of gram positive host cell and synthetic hyaluronic ability.Such as can be together with UDP-glucose dehydrogenase gene (UDP-glucose dehydrogenase gene), UTP-Cori ester transferase gene (UTP-glucose-1-phosphate Uridyltransferase gene) and three kinds of assortments of genes of hyaluronan synthase gene, gene adds ribosome bind site, controls this three kinds of expression of gene with composing type or inducible promoter.Can also be with UDP-glucose dehydrogenase gene (UDP-glucose dehydrogenase gene); UTP-Cori ester transferase gene (UTP-glucose-1-phosphate uridyltransferase gene); G-6-P mutase gene (Phosphoglucomutase gene); N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene (N-Acetyl-glucosamine-1-phosphate uridyltransferase gene) and five kinds of assortments of genes of hyaluronan synthase gene are together; gene adds ribosome bind site; start this five kinds of gene transcription with composing type or inducible promoter, constitute an artificial operon.Relevant assortment of genes that can also above-mentioned and hyaluronic acid synthetic is all together, primordial is because of bunch (a gene cluster).

In preferred version; the present invention is with UDP-glucose dehydrogenase gene (UDP-glucose dehydrogenase gene); be SEQ ID No.31-34; UTP-Cori ester transferase gene (UTP-glucose-1-phosphateUridyltransferase gene); be SEQ ID No.35-37; N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene (N-Acetyl-glucosamine-1-phosphate uridyltransferase gene); be SEQ ID No.43; and the hyaluronan synthase gene of optimizing (any among the SEQ ID No.1-27) constitutes an expression casette, adopts the promotor of the fruit ficoll enzyme gene of sucrose induction to start this four kinds of gene transcription.

The above-mentioned hyaluronan synthase gene that adopts all is optimized according to the codon preference of Gram-positive host bacterium.

In order further to strengthen the transcriptional activity of inducible promoters, the present invention also passes through in the inducible promoters upstream or enhanser (enhancer) is introduced in the downstream.The existence of enhanser can further strengthen the transcriptional activity of inducible promoters.Described enhanser refers to anyly can strengthen the active nucleotide sequence of the promoter transcription that is attached thereto in the present invention.

In order more effectively to obtain producing hyaluronic Gram-positive genetic engineering bacterium, when structure contains and synthesizes the expression vector of hyaluronic acid precursor and hyaluronan synthase gene, in expression vector, can introduce following selective marker: D-pectinose alcohol dehydrogenase gene (D-arabitol dehydrogenase gene), ribitol dehydrogenase gene (ribitol dehydrogenasegene), erythromycin resistance gene (erythromycin resistance gene, erm), chloramphenicol resistance gene (cat), kalamycin resistance gene (km).Because D-pectinose alcohol dehydrogenase gene is safe selective marker, the present invention preferably uses this gene as selective marker.But do not illustrate that the present invention does not use other selective marker.Can use the D-pectinose alcohol dehydrogenase gene in any source, this gene encoding production D-pectinose alcoholdehydrogenase can be converted into D-xylulose or D-ribulose with the D-arabitol in the presence of NAD (H).Can also use the ribitol dehydrogenase gene in any source, this gene encoding production ribitol dehydrogenase can change ribitol into the D-ribulose in the presence of NAD (H).

Subtilis of the present invention, Bacillus licheniformis, bacillus megaterium, bacillus amyloliquefaciens, useful or nontoxic bacillus cereus, bacillus brevis, short genus bacillus, bacstearothermophilus, bacteroides amylophilus, the stearothermophilus ground bacillus, Bacillus coagulans, slow genus bacillus, bacteroides amylophilus, the source that obtains of bacillus pumilus is Chinese common micro-organisms preservation administrative center, described streptococcus zooepidemicus, the class streptococcus equi, the preservation information of streptococcus pyogenes and streptococcus uberis, obtaining the source is: German DSMZ preserves the center.

In order to obtain more stable synthesizing hyaluronic genetically engineered Gram-positive host bacterium, the gene that the present invention will synthesize hyaluronic relevant enzyme is connected in integrated expression plasmid carrier or the additive type expression plasmid carrier.

The hyaluronic acid that adopts genetically engineered safety microorganism host fermentative preparation does not exist any intracellular toxin and any factor of curing the disease because its biological safety is very good, therefore promptly can be applied to field of food, cosmetic field and medicine field.Can make oral liquid, capsule etc. at field of food; Can make various water conservation skin care product (soothing cream, skin cream etc.) at cosmetic field; Can make the joint lubrication injection liquid at medicine field, promote the adhesive plaster of wound healing; Can also be used to modifying derivatize and make derivatives of hyaluronic acids.

Description of drawings

Fig. 1 be contain from streptococcus zooepidemicus and according to the subtilis codon preference optimize hyaluronan synthase gene, the genus bacillus integrating expression vector of wood sugar inductive promotor;

Among the figure:

LacA ' with ' lacA represents 5 ' and 3 ' end homology integration arm of beta-galactosidase gene respectively; Erm represents erythromycin resistance gene;

Szhas represents from streptococcus zooepidemicus and the hyaluronan synthase gene optimized according to the subtilis codon preference;

PxylA represents the wood sugar evoked promoter from bacillus megaterium;

Bla represents ampicillin resistance gene;

Ori is illustrated in replication initiation dna sequence dna in the intestinal bacteria.

Fig. 2 be contain from streptococcus zooepidemicus and according to the subtilis codon preference optimize the genus bacillus integrating expression vector of promotor of hyaluronan synthase gene, sucrose induction;

Among the figure:

PsacB represents the evoked promoter from the fruit ficoll enzyme gene of subtilis.

Fig. 3 be contain from streptococcus zooepidemicus and according to the subtilis codon preference optimize hyaluronan synthase gene, the genus bacillus additive type expression vector of lactose-induced promotor;

Among the figure:

SzhasA: from streptococcus zooepidemicus and the hyaluronan synthase gene optimized according to the subtilis codon preference;

Amp: ampicillin resistance gene;

Ori-Bs: the self-replicating starting point sequence of the plasmid of genus bacillus;

Ori-Ec: the self-replicating starting point sequence of colibacillary plasmid;

Cat: chloramphenicol resistance gene.

Fig. 4 be contain from streptococcus zooepidemicus and according to the subtilis codon preference optimize the additive type genus bacillus expression vector of promotor of sucrose induction of hyaluronan synthase gene, subtilis;

Among the figure:

PsacB: from the promoter sequence of the fruit ficoll enzyme gene of subtilis; All the other symbols are with shown in Figure 3 among the figure.

Fig. 5 be contain from streptococcus zooepidemicus and according to the subtilis codon preference optimize the integrated genus bacillus expression vector of promotor of sucrose induction of hyaluronan synthase gene, bacillus megaterium;

Among the figure:

LacA ' with ' lacA represents 5 ' and 3 ' end homology integration arm of beta-galactosidase gene respectively;

Erm represents erythromycin resistance gene;

Has represents from streptococcus zooepidemicus and the hyaluronan synthase gene optimized according to the subtilis codon preference;

PbmsacB represents the evoked promoter from the fruit ficoll enzyme gene of bacillus megaterium;

Bla represents ampicillin resistance gene;

Fig. 6 be contain from PBCV and according to the subtilis codon preference optimize the integrated genus bacillus expression vector of promotor of sucrose induction of hyaluronan synthase gene, bacillus megaterium;

Among the figure:

Cvhas represents from PBCV and the hyaluronan synthase gene optimized according to the subtilis codon preference.

Fig. 7 be contain from PBCV and according to the subtilis codon preference optimize the integrated genus bacillus expression vector of promotor of sucrose induction of hyaluronan synthase gene, subtilis;

Among the figure:

Rep: can be in genus bacillus the replication origin fragment of self-replicating;

ORF2: the open reading frame of unknown function;

Bla: ammonia benzyl resistant gene;

Cat: chloramphenicol resistance gene;

Cvhas:, codon optimized according to subtilis from the hyaluronan synthase gene of PBCV;

PsacB: from the promotor of the fruit ficoll enzyme gene of subtilis;

ORF3: the open reading frame of unknown function.

Fig. 8 be contain from PBCV and according to the subtilis codon preference optimize the integrated genus bacillus expression vector of promotor of sucrose induction of UDP-glucose dehydrogenase gene, bacillus megaterium of hyaluronan synthase gene, bacillus megaterium;

Among the figure:

Cvhas represents from PBCV and the hyaluronan synthase gene optimized according to the subtilis codon preference;

Pamy represents the alpha-amylase gene promotor from subtilis;

TuaD represents the UDP-glucose dehydrogenase gene from bacillus megaterium.

Fig. 9 be contain from PBCV and according to the subtilis codon preference optimize the integrated genus bacillus expression vector of promotor of sucrose induction of N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene, bacillus megaterium of UDP-glucose dehydrogenase gene, bacillus megaterium of hyaluronan synthase gene, bacillus megaterium;

Among the figure:

GcaD represents the N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene from bacillus megaterium.

Figure 10 be contain from PBCV and according to the subtilis codon preference optimize the integrated genus bacillus expression vector of promotor of sucrose induction of N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene, UTP-Cori ester uracil base transferase gene, bacillus megaterium of UDP-glucose dehydrogenase gene, bacillus megaterium of hyaluronan synthase gene, bacillus megaterium;

Among the figure:

GtaB represents UTP-Cori ester uracil base transferase gene; All the other symbols are with shown in Figure 9 among the figure.

Figure 11 be contain from PBCV and according to the subtilis codon preference optimize the promotor of sucrose induction of N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene, subtilis of UDP-glucose dehydrogenase gene, bacillus megaterium of hyaluronan synthase gene, bacillus megaterium and the integrated genus bacillus expression vector of controlling element;

Among the figure:

P43 represents the P43 gene promoter of subtilis;

Cvhas represents from PBCV and the hyaluronan synthase gene optimized according to the subtilis codon preference; DegQ and degU represent the regulatory protein gene from subtilis;

PbssacB represents the evoked promoter from the fruit ficoll enzyme gene of subtilis;

Pamy represents the alpha-amylase gene promotor from subtilis;

TuaD represents the UDP-glucose dehydrogenase gene from bacillus megaterium;

GtaB represents from bacillus megaterium UTP-Cori ester uracil base transferase gene;

Figure 12 be contain from streptococcus pyogenes and according to the subtilis codon preference optimize the promotor of sucrose induction of N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene, subtilis of UDP-glucose dehydrogenase gene, bacillus megaterium of hyaluronan synthase gene, bacillus megaterium and the integrated genus bacillus expression vector of controlling element;

Among the figure:

Pyhas represents from streptococcus pyogenes and the hyaluronan synthase gene optimized according to the subtilis codon preference.

Figure 13 be contain from streptococcus uberis and according to the subtilis codon preference optimize the promotor of sucrose induction of N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene, subtilis of UDP-glucose dehydrogenase gene, bacillus megaterium of hyaluronan synthase gene, bacillus megaterium and the integrated genus bacillus expression vector of controlling element;

Among the figure:

Puhas represents from streptococcus pyogenes and the hyaluronan synthase gene optimized according to the subtilis codon preference.

Figure 14 be contain from streptococcus zooepidemicus and according to the subtilis codon preference optimize the promotor of sucrose induction of UDP-glucose dehydrogenase gene, UTP-Cori ester uracil base transferase gene, N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene, subtilis of hyaluronan synthase gene, Bacillus licheniformis and the integrated genus bacillus expression vector of controlling element;

Among the figure:

Szhas represents from streptococcus zooepidemicus and the hyaluronan synthase gene optimized according to the subtilis codon preference; DegQ and degU represent the regulatory protein gene from subtilis;

TuaD represents the UDP-glucose dehydrogenase gene from Bacillus licheniformis;

GtaB represents from Bacillus licheniformis UTP-Cori ester uracil base transferase gene;

GcaD represents the N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene from Bacillus licheniformis.

Figure 15 be contain from PBCV and according to the subtilis codon preference optimize the D-pectinose alcohol dehydrogenase gene of alpha-amylase gene promotor, weak oxidized acetic acid bacteria of UDP-glucose dehydrogenase gene, subtilis of hyaluronan synthase gene, bacillus megaterium and the integrated genus bacillus expression vector of the promotor of the sucrose induction of subtilis;

AArDH; Expression is from the D-pectinose alcohol dehydrogenase gene of weak oxidized acetic acid bacteria;

Bla represents ampicillin resistance gene;

Ori is illustrated in replication initiation dna sequence dna in the intestinal bacteria;

Pamy represents the alpha-amylase gene promotor from subtilis;

TuaD represents the UDP-glucose dehydrogenase gene from bacillus megaterium.

Figure 16 be contain from streptococcus zooepidemicus and according to the subtilis codon preference optimize hyaluronan synthase gene, the UDP-glucose dehydrogenase gene of Bacillus licheniformis, UTP-Cori ester uracil base transferase gene, N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene, the integrated genus bacillus expression vector of the promotor of the sucrose induction of Carlos Kleiber pneumococcal D-pectinose alcohol dehydrogenase gene and subtilis and controlling element thereof;

Among the figure:

DalD represents from the pneumococcal D-pectinose of Carlos Kleiber alcohol dehydrogenase gene; P43 represents the P43 gene promoter of subtilis;

Bla represents ampicillin resistance gene; Ori is illustrated in replication initiation dna sequence dna in the intestinal bacteria;

Pamy represents the alpha-amylase gene promotor from bacillus megaterium;

TuaD represents the UDP-glucose dehydrogenase gene from Bacillus licheniformis;

Figure 17 is embodiment 3 steps (a 1) PCR checking result schematic diagram.

Figure 18 is embodiment 3 steps (a 2) PCR checking result schematic diagram.

Figure 19 is embodiment 3 steps (a 7) PCR checking result schematic diagram.

Figure 20 is embodiment 7 synoptic diagram.

Figure 21 is embodiment 8 synoptic diagram.

Embodiment

Below embodiments of the invention are elaborated, present embodiment is being to implement under the prerequisite with the technical solution of the present invention, provided detailed embodiment and concrete operating process, but protection scope of the present invention is not limited to following embodiment.

Embodiment 1: the gene relevant with synthetic hyaluronic acid precursor and the clone of promoter sequence or synthetic

(1) clone of streptococcus zooepidemicus hyaluronan synthase gene

The method of the extraction bacteria total DNA of employing document description (Cheng H and Jiang N, 2006,28:55-59 Biotechnol.Letters) extracts the total DNA of streptococcus zooepidemicus.Designing a pair of primer, is that template is carried out the PCR reaction with the total DNA of streptococcus zooepidemicus that extracts, and concrete reaction conditions is the pre-sex change of 94 degree 5 minutes, and according to 94 degree 30 seconds, 56 degree 40 seconds, totally 30 circulations in 60 seconds of 72 degree, the program of extending at last 10 minutes is carried out again.The a pair of primer sequence of design is as follows:

(5 ' end has the XbaI enzyme cutting site to 5 '-CTTCTAGAATGAGAACATTAAAAAACCTCATA-3 ', TCTAGA)

(5 ' end has the SacII restriction enzyme site to 5 '-ATCCGCGGTTATAATAATTTTTTACGTGTTCC-3 ', CCGCGG)

The hyaluronan synthase gene size of the streptococcus zooepidemicus that amplifies according to top method is 1254bp, i.e. SEQ IDNo.44.

(2) clone of streptococcus pyogenes hyaluronan synthase gene

The method of the extraction bacteria total DNA of employing document description (Cheng H and Jiang N, 2006,28:55-59 Biotechnol.Letters) extracts the total DNA of streptococcus pyogenes.Designing a pair of primer, is that template is carried out the PCR reaction with the total DNA of streptococcus pyogenes that extracts, and concrete reaction conditions is the pre-sex change of 94 degree 5 minutes, and according to 94 degree 30 seconds, 55 degree 40 seconds, totally 32 circulations in 70 seconds of 72 degree, the program of extending at last 10 minutes is carried out again.The a pair of primer sequence of design is as follows:

(5 ' end has the XbaI enzyme cutting site to 5 '-CTTCTAGAATGCTTATTTTTAAAAAAACTTTTA-3 ', TCTAGA)

(5 ' end has the SacII restriction enzyme site to 5 '-ATCCGCGGTTATTTAAAAATAGTGACCTTTTTAC-3 ', CCGCGG)

The hyaluronan synthase gene size of the streptococcus pyogenes that amplifies according to top method is 1260bp, i.e. SEQ IDNo.47.

(3) clone of streptococcus uberis hyaluronan synthase gene

The method of the extraction bacteria total DNA of employing document description (Cheng H and Jiang N, 2006,28:55-59 Biotechnol.Letters) extracts the total DNA of streptococcus uberis.Designing a pair of primer, is that template is carried out the PCR reaction with the total DNA of streptococcus uberis that extracts, and concrete reaction conditions is the pre-sex change of 94 degree 5 minutes, and according to 94 degree 30 seconds, 55 degree 40 seconds, totally 32 circulations in 70 seconds of 72 degree, the program of extending at last 10 minutes is carried out again.The a pair of primer sequence of design is as follows:

(5 ' end has the XbaI enzyme cutting site to 5 '-CTTCTAGAATGGAAAAACTAAAAAATCTCATTAC-3 ', TCTAGA)

(5 ' end has the SacII restriction enzyme site to 5 '-ATCCGCGGTTATTTACTTGTCTTTTTACGAGTTCC-3 ', CCGCGG)

The hyaluronan synthase gene size of the streptococcus uberis that amplifies according to top method is 1254bp, i.e. SEQ IDNo.48.

(4) optimization of Paramecium bursaria chlorella virus hyaluronan synthase gene is with synthetic

Paramecium bursaria Chlorella virus (the Paramecium bursaria Chlorella virus1 that openly reports according to GenBank, PBCV1) gene order (SEQ ID No.46), this genes encoding frame size are 1707 bases (beginning to finish to terminator codon TAA from initiator codon ATG).The genomic codon preference of Gram-positive host bacterium that adopts according to the present invention is optimized, the method of optimizing is to adopt online molecular biology software OptimumGene Codon Optimization Analysis, Gene Designer, Codon Optimizer or Optimizer, the result who after analyzing different software is provided revises manually, and CAI numerical value is reached more than 0.80.Entrust the synthetic department of special gene to carry out full gene then and synthesize, obtain codon optimized Paramecium bursaria chlorella virus hyaluronan synthase gene.The sequence of the Paramecium bursaria chlorella virus hyaluronan synthase gene after the optimization is SEQ ID No.15-21.

(5) clone of UDP-glucose dehydrogenase gene of bacillus megaterium and UTP-Cori ester transferase gene.

The method of the extraction bacteria total DNA of employing document description (Cheng H and Jiang N, 2006,28:55-59 Biotechnol.Letters) extracts the total DNA of bacillus megaterium.Designing a pair of primer, is that template is carried out the PCR reaction with the total DNA that extracts, and concrete reaction conditions is the pre-sex change of 94 degree 5 minutes, and according to 94 degree 30 seconds, 58 degree 40 seconds, totally 35 circulations in 100 seconds of 72 degree, the program of extending at last 10 minutes is carried out again.The a pair of primer sequence of design is as follows:

5 '-ATGGATCCGGTACCAGGAGGAAAAGTAAATGAAAATTC-3 ' (5 ' end has BamHI site GGATCC and KpnI site GGTACC)

5 '-ATCTCGAGTTATAAAGTAGAAACTTTAGAATCACC-3 ' (5 ' end has XhoI restriction enzyme site CTCGAG)

The size of the DNA that contains UDP-glucose dehydrogenase gene and two kinds of genes of UTP-Cori ester transferase gene that amplifies is 2.4kb.Its dna sequence dna is SEQ ID No:28.

(6) clone of bacillus megaterium N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene.

5 '-ATCTCGAGTAGGAGGCCTGTTATGTCAAAAAGATATGCAGTC-3 ' (5 ' end has XhoI restriction enzyme site CTCGAG and ribosome bind site AGGAGG)

5 '-ATGAGCTCTTAGGATTTTTTATTAATATCAAGC-3 ' (5 ' end has SacI restriction enzyme site GAGCTC)

The N-ethanoyl that amplifies-1-phosphoric acid-glucose ammonia-uracil base transferase gene size is 1380bp.Its dna sequence dna is SEQ ID No:29.

(7) clone of bacillus megaterium alpha-amylase gene promoter sequence.

Total DNA is a template with bacillus megaterium, designs a pair of primer and carries out pcr amplification, and the PCR reaction conditions is: the pre-sex change of 94 degree 5 minutes, according to 94 degree 30 seconds, 58 degree 40 seconds, totally 35 circulations in 30 seconds of 72 degree, extended at last 10 minutes again.Obtain the alpha-amylase gene promoter sequence that size is about 390bp.The primer sequence of design is:

5 '-CTTCTAGACATCGTTTCATCCCCTTTTTTTTGCAA-3 ' (5 ' end has XbaI enzyme cutting site TCTAGA)

5 '-CTGGATCCTTGCAGATAGTAAATAAAATTCAA-3 ' (5 ' end has BamHI restriction enzyme site GGATCC)

The bacillus megaterium alpha-amylase gene promoter sequence that obtains is SEQ ID No:30.

(8) clone of subtilis fruit ficoll enzyme gene promoter sequence.

The following a pair of primer of design:

5’-AAGCGAAAACATACCACCTATCAGATCCTTTTTAACCCATCACATATACCTG-3’

5 '-CTTCTAGACATATAAAACACCTCCTTTTTTATGTACTGTGTTAGCGG-3 ' (5 ' end has XbaI enzyme cutting site TCTAGA)

With above-mentioned a pair of primer, be that template is carried out PCR with the total DNA of subtilis, obtain the fruit ficoll enzyme gene promoter dna fragmentation of about 450bp.The condition of PCR reaction is: the pre-sex change of 94 degree 5 minutes, according to 94 degree 30 seconds, 56 degree 30 seconds, totally 35 circulations in 30 seconds of 72 degree, extended at last 10 minutes again.

(9) clone of bacillus megaterium fruit ficoll enzyme gene promoter sequence.

The following a pair of primer of design:

5’-AAGCGAAAACATACCACCTATCACTGATTCCAGCCGTGAAGGAAAAG-3’

5 '-CTTCTAGA ATGTTTTCTCCTTTTGTGTTAGTAAAG-3 ' (5 ' end has XbaI enzyme cutting site TCTAGA)

With above-mentioned a pair of primer, be that template is carried out PCR with the total DNA of subtilis, obtain the fruit ficoll enzyme gene promoter dna fragmentation of about 630bp.The condition of PCR reaction is: the pre-sex change of 94 degree 5 minutes, according to 94 degree 30 seconds, 56 degree 30 seconds, totally 35 circulations in 30 seconds of 72 degree, extended at last 10 minutes again.

(10) clone of subtilis P43 gene promoter.

The following a pair of primer of design:

5’-CAATTGTTTTACTTCTTCAAGTTTCTTTTCCATGTGTACATTCCTCTCTTACCTATAATG-3’

5’-CAGGTATATGTGATGGGTTAAAAAGGATCTGATAGGTGGTATGTTTTCGCTT-3’

With above-mentioned a pair of primer, be that template is carried out PCR with the total DNA of subtilis, obtain the fruit ficoll enzyme gene promoter dna fragmentation of about 300bp.The condition of PCR reaction is: the pre-sex change of 94 degree 5 minutes, according to 94 degree 30 seconds, 56 degree 30 seconds, totally 35 circulations in 30 seconds of 72 degree, extended at last 10 minutes again.

(11) clone of subtilis degQ sequence.

The following a pair of primer of design:

5’AT GGATCC

TCACGCAATTTTCATTGCATAATTGTATTTATCG?3’

Wherein 5 ' end underscore is represented BamHI recognition sequence (GGATCC), and band frame base is represented the complementary strand sequence (AAAAAAGCCCGCTCATTAGGCGGGCTGC) of intestinal bacteria trpA terminator.

5’CATTATAGGTAAGAGAGGAATGTACACATGGAAAAGAAACTTGAAG?AAGTAAAACAATTG-3’

With above-mentioned a pair of primer, be that template is carried out PCR with the total DNA of subtilis, obtain the dna fragmentation of the degQ of about 200bp.The condition of PCR reaction is: the pre-sex change of 94 degree 5 minutes, according to 94 degree 30 seconds, 56 degree 30 seconds, totally 35 circulations in 20 seconds of 72 degree, extended at last 10 minutes again.

Embodiment 2: the structure that contains the expression vector of relevant gene of synthetic hyaluronic acid and promoter sequence

(1) contain from streptococcus zooepidemicus and according to subtilis codon optimized the structure of integrating expression vector of hyaluronan synthase gene.

After being optimized according to the subtilis codon preference from the hyaluronan synthase gene of streptococcus zooepidemicus, behind BamHI and SacII double digestion, the hyaluronan synthase gene glue of double digestion is reclaimed, be connected among the integrated expression plasmid carrier pAX01 with BamHI and SacII double digestion, constitute the new integrated expression vector pAX-szhas1 that contains the streptococcus zooepidemicus hyaluronan synthase gene of optimizing according to the subtilis codon preference.Carrier collection of illustrative plates such as description of drawings 1.

(2) contain from streptococcus zooepidemicus and according to subtilis codon optimized hyaluronan synthase gene and the structure of the integrating expression vector of subtilis fruit ficoll enzyme gene promoter.

After being optimized according to the subtilis codon preference from the hyaluronan synthase gene of streptococcus zooepidemicus, behind BamHI and SacII double digestion, the hyaluronan synthase gene glue of double digestion is reclaimed, be connected among the integrated expression plasmid carrier pAX01 with BamHI and SacII double digestion, constitute the new integrated expression vector pAX-szhas1 (collection of illustrative plates such as Fig. 1) that contains the streptococcus zooepidemicus hyaluronan synthase gene of optimizing according to the subtilis codon preference, use SpeI and XhoI double digestion pAX-szhas1 then, glue reclaims and obtains the carrier-pellet segment DNA.Will be from subtilis fruit ficoll enzyme gene promoter SpeI and XhoI double digestion, be connected with the carrier pAX-szhas1 of XhoI double digestion with SpeI, obtain new integrating expression vector pAX-szhas2, this carrier contains the promotor of the hyaluronan synthase gene and the derivable saccharase gene of optimization.The collection of illustrative plates of carrier pAX-szhas2 such as Fig. 2.

(3) contain from streptococcus zooepidemicus and according to subtilis codon optimized hyaluronan synthase gene and the structure of the additive type expression vector of subtilis fruit ficoll enzyme gene promoter.

After being optimized according to the subtilis codon preference from the hyaluronan synthase gene of streptococcus zooepidemicus, behind KpnI and SacI double digestion, the hyaluronan synthase gene glue of double digestion is reclaimed, be connected among the integrated expression plasmid carrier pNW33N with KpnI and SacI double digestion, constitute the new additive type expression vector pNW-szhas1 (collection of illustrative plates such as Fig. 3) that contains the streptococcus zooepidemicus hyaluronan synthase gene of optimizing according to the subtilis codon preference, use BamHI and this carrier of KpnI double digestion again, use BamHI and KpnI double digestion from subtilis fruit ficoll enzyme gene promoter simultaneously, the two connects, and constitutes the new additive type expression vector pNW-szhas2 (collection of illustrative plates such as Fig. 4) of the streptococcus zooepidemicus hyaluronan synthase gene contain subtilis fruit ficoll enzyme gene promoter and to optimize according to the subtilis codon preference.

(4) contain from streptococcus zooepidemicus and according to subtilis codon optimized hyaluronan synthase gene and the structure of the integrated expression vector of bacillus megaterium fruit ficoll enzyme gene promoter.

After will being optimized according to the subtilis codon preference from the hyaluronan synthase gene of streptococcus zooepidemicus, behind SpeI and BamHI double digestion, the hyaluronan synthase gene glue of double digestion is reclaimed, be connected among the integrated expression plasmid carrier pAX01 with SpeI and BamHI double digestion, constitute carrier pAX-has1, use BamHI and SacII double digestion pAX-has1 again, and connect and compose integrated expression vector pAX-has2 (collection of illustrative plates such as Fig. 5) with the bacillus megaterium of BamHI and SacII double digestion fruit ficoll enzyme gene promoter DNA.This integrated expression vector contain bacillus megaterium fruit ficoll enzyme gene promoter and from streptococcus zooepidemicus and according to subtilis codon optimized hyaluronan synthase gene.

(5) contain from PBCV and according to the structure of the integrated expression vector of the codon optimized hyaluronan synthase gene of subtilis.

After will being optimized according to the subtilis codon preference from the hyaluronan synthase gene of PBCV, behind SpeI and SacII double digestion, the hyaluronan synthase gene glue of double digestion is reclaimed, be connected among the integrated expression plasmid carrier pAX01 with SpeI and SacII double digestion, constitute the new integrated expression vector pAX-cvhas1 that contains the streptococcus zooepidemicus hyaluronan synthase gene of optimizing according to the subtilis codon preference, use SpeI and XhoI double digestion pAX-cvhas1 then, glue reclaims and obtains the carrier-pellet segment DNA.Will be from bacillus megaterium fruit ficoll enzyme gene promoter SpeI and XhoI double digestion, be connected with the carrier pAX-cvhas1 of XhoI double digestion with SpeI, obtain new integrating expression vector pAX-cvhas2, this carrier contains the promotor from the induced saccharase gene of the hyaluronan synthase gene of PBCV and bacillus megaterium of optimization.The collection of illustrative plates of carrier pAX-cvhas2 such as Fig. 6.

(6) contain from PBCV and according to the structure of the additive type expression vector of codon optimized hyaluronan synthase gene of subtilis and subtilis fruit ficoll enzyme gene promoter.

Will be from PBCV and according to subtilis codon optimized hyaluronan synthase gene SpeI and SacI double digestion, glue reclaims the dna fragmentation that enzyme is cut 1.7kb.With SpeI and SacI double digestion carrier pHCMC04, the two connects and obtains the new carrier that contains hyaluronan synthase gene, use BamHI and this carrier of SpeI double digestion again, be connected with subtilis fruit ficoll enzyme gene promoter, constitute new additive type expression plasmid carrier pHC-cvhas2 (collection of illustrative plates such as Fig. 7) with BamHI and SpeI double digestion.

(7) contain from PBCV and according to the codon optimized hyaluronan synthase gene of subtilis and from the structure of the integrated expression vector of the fruit ficoll enzyme gene promoter of the glucose-6-phosphate dehydrogenase gene of bacillus megaterium and bacillus megaterium.

The pAX-cvhas2 expression vector (as Fig. 6) that makes up is obtained big fragment linear carrier fragment with XhoI and SacI double digestion, and glue reclaims.Will be from the alpha-amylase gene promoter sequence directed cloning of subtilis XhoI and BamHI site to cloned plasmids carrier pBlueScriptSK (-), constitute carrier pBS-Amy, use BamHI and this carrier of SacI double digestion again, to constitute new carrier pBS-AG from the glucose-6-phosphate dehydrogenase gene directed cloning of bacillus megaterium to in BamHI and this carrier of SacI double digestion.Use XhoI and SacI double digestion pBS-AG again, reclaiming size is the dna fragmentation of 1.9kb, is connected with the pAX-cvhas2 expression vector of SacI double digestion with XhoI, constitutes the integrated expression vector pAX-AGH2 of new genus bacillus.Glucose-6-phosphate dehydrogenase gene in this carrier is to utilize the control of alpha-amylase gene promotor to carry out composing type to transcribe, and hyaluronan synthase gene is then transcribed under inducible promoters PsacB control.Can realize hyaluronic induce synthetic.The collection of illustrative plates of this carrier such as Fig. 8.

(8) contain from PBCV and according to the codon optimized hyaluronan synthase gene of subtilis and from the structure of the integrated expression vector of the fruit ficoll enzyme gene promoter of the glucose-6-phosphate dehydrogenase gene of bacillus megaterium and the N-ethanoyl of bacillus megaterium-1-phosphoric acid-glucose ammonia-uracil base transferase gene and bacillus megaterium.

Will be from the alpha-amylase gene promoter sequence directed cloning of subtilis XhoI and HindIII site to cloning vector pBlueScriptSK (-); constitute carrier pBS-Amy2; use HindIII and this carrier of BamHI double digestion again; glucose-6-phosphate dehydrogenase gene directed cloning from bacillus megaterium is used in HindIII and this carrier of BamHI double digestion to this; constitute novel vector pBS-AU2; use BamHI and SacI double digestion pBS-AU2 again; the N-of bacillus megaterium ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene directed cloning in this carrier; use XhoI and this carrier of SacI double digestion again; reclaim the dna fragmentation of 3.3kb; be connected in the pAX-cvhas2 carrier with XhoI and SacI double digestion, constitute new genus bacillus integrating expression vector pAX-cvhas3.The hyaluronan synthase gene of this carrier promotor inducible transcription of fruit ficoll enzyme gene; and glucose-6-phosphate dehydrogenase gene and N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene is transcribed with constitutive promoter control, therefore hyaluronic synthetic the inducing of sucrose that be subjected to.The collection of illustrative plates of carrier pAX-cvhas3 such as Fig. 9.

(9) contain from PBCV and according to the structure of the integrated expression vector of the fruit ficoll enzyme gene promoter of the codon optimized hyaluronan synthase gene of subtilis, glucose-6-phosphate dehydrogenase gene, UTP-Cori ester uracil base transferase gene, N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene and bacillus megaterium.

Will be from the alpha-amylase gene promoter sequence directed cloning of subtilis XhoI and HindIII site to cloning vector pBlueScriptSK (-); constitute carrier pBS-Amy2; with HindIII and this carrier of BamHI double digestion; with the glucose-6-phosphate dehydrogenase gene directed cloning of subtilis in this carrier; constitute pBS-AU3; with BamHI and SpeI double digestion pBS-AU3; with UTP-Cori ester transferase gene directed cloning in this carrier; constitute the pBS-AUT1 carrier; use SpeI and this carrier of SacI double digestion again; with N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene directed cloning in this carrier; constitute the pBS-AUTG carrier; use XhoI and this carrier of SacI double digestion again; reclaim the dna fragmentation of 4.3kb; with be connected with the pAX-cvhas2 carrier of SacI double digestion with XhoI, constitute new integrated expression vector pAX-cvhas4.The hyaluronan synthase gene of this carrier is transcribed under the fruit ficoll enzyme gene promoter control of bacillus megaterium, carries out abduction delivering.Glucose-6-phosphate dehydrogenase gene, UTP-Cori ester transferase gene, N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene then carry out composing type and transcribe under the alpha-amylase gene promotor control of subtilis.Therefore hyaluronic synthetic the inducing of sucrose that be subjected to.The collection of illustrative plates of integrated expression vector pAX-cvhas4 such as Figure 10.

(10) contain from PBCV and according to the codon optimized hyaluronan synthase gene of subtilis and from the structure of the integrated expression vector of the fruit ficoll enzyme gene promoter of the glucose-6-phosphate dehydrogenase gene of bacillus megaterium and the N-ethanoyl of bacillus megaterium-1-phosphoric acid-glucose ammonia-uracil base transferase gene and subtilis and regulating and controlling sequence thereof.

The promotor of the fruit ficoll enzyme gene among the carrier pAX-cvhas3 is replaced with containing the fruit ficoll enzyme gene promoter that strengthens element.With carrier pAX-cvhas3 SpeI and XhoI double digestion, glue reclaims large fragment DNA.With embodiment 1 clone's P43 gene promoter, degQ gene and degU gene according to SOE (spicing overlap extension PCR) technical combinations together (with reference to Heckman and Pease, 2007, Vol 2 (4), Nature Protocols), wherein degQ and degU start by force under the control of p43 gene promoter and transcribe.Obtain the expression cassette of P43-degQ-degU, this expression cassette directed cloning in the pAX-cvhas3 carrier of SpeI and XhoI double digestion, is constituted new genus bacillus expression vector pAX-cvhas5.The fruit ficoll enzyme gene promoter of this carrier is subjected to the enhancing of degQ and degU, so the hyaluronan synthase gene in its downstream is transcribed stronger.The collection of illustrative plates of carrier pAX-cvhas5 such as Figure 11.

(11) contain from streptococcus pyogenes and according to the codon optimized hyaluronan synthase gene of bacillus megaterium and from the structure of the integrated expression vector of the fruit ficoll enzyme gene promoter of the glucose-6-phosphate dehydrogenase gene of bacillus megaterium and the N-ethanoyl of bacillus megaterium-1-phosphoric acid-glucose ammonia-uracil base transferase gene and bacillus megaterium and regulating and controlling sequence thereof.

Get final product replacing to from streptococcus pyogenes and according to the codon optimized hyaluronan synthase gene of bacillus megaterium from PBCV and according to the codon optimized hyaluronan synthase gene of subtilis among the carrier pAX-cvhas5, constitute new integrating expression vector pAX-sphas1.Collection of illustrative plates such as Figure 12.

(12) contain from streptococcus uberis and according to the codon optimized hyaluronan synthase gene of subtilis and from the structure of the integrated expression vector of the fruit ficoll enzyme gene promoter of the glucose-6-phosphate dehydrogenase gene of bacillus megaterium and the N-ethanoyl of bacillus megaterium-1-phosphoric acid-glucose ammonia-uracil base transferase gene and bacillus megaterium and regulating and controlling sequence thereof.

With replacing to from streptococcus uberis and according to the codon optimized hyaluronan synthase gene of subtilis among the integrating expression vector pAX-sphas1, constitute new integrating expression vector pAX-suhas1 from streptococcus pyogenes and according to the codon optimized hyaluronan synthase gene of bacillus megaterium.Collection of illustrative plates such as Figure 13.

(13) contain from streptococcus zooepidemicus and according to the codon optimized hyaluronan synthase gene of Bacillus licheniformis and from the structure of the integrated expression vector of the fruit ficoll enzyme gene promoter of glucose-6-phosphate dehydrogenase gene, UTP-Cori ester uracil base transferase gene, N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene and the subtilis of Bacillus licheniformis and controlling element thereof.

Will be from the alpha-amylase gene promoter sequence directed cloning of bacillus megaterium XhoI and HindIII site to cloning vector pBlueScriptSK (-); constitute carrier pBS-Amy3; with HindIII and this carrier of BamHI double digestion; with the glucose-6-phosphate dehydrogenase gene directed cloning of Bacillus licheniformis in this carrier; constitute pBS-AU4; with BamHI and SpeI double digestion pBS-AU4; with UTP-Cori ester uracil base transferase gene directed cloning in this carrier; constitute the pBS-AUT2 carrier; use SpeI and this carrier of SacI double digestion again; with N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene directed cloning in this carrier; constitute the pBS-AUTG2 carrier; use XhoI and this carrier of SacI double digestion again; reclaim the dna fragmentation of 4.3kb; with be connected with the pAX-szhas2 carrier of SacI double digestion with XhoI, constitute new integrated expression vector pAX-szhas3.Use BamHI and SacII double digestion pAX-szhas3 again, use the hyaluronan synthase gene of the streptococcus zooepidemicus of optimizing according to the Bacillus licheniformis codon preference to replace the streptococcus zooepidemicus hyaluronan synthase gene of optimizing according to the subtilis codon preference, constitute new carrier pAX-szhas5.The hyaluronan synthase gene of this carrier is transcribed under the fruit ficoll enzyme gene promoter control of subtilis, carries out abduction delivering.Glucose-6-phosphate dehydrogenase gene, UTP-Cori ester transferase gene, N-ethanoyl 1-phosphoric acid-glucose ammonia-uracil base transferase gene then carry out composing type and transcribe under the alpha-amylase gene promotor control of bacillus megaterium.Therefore hyaluronic synthetic the inducing of sucrose that be subjected to.The collection of illustrative plates of integrated expression vector pAX-szhas5 such as Figure 14.

(14) contain from streptococcus zooepidemicus and according to the codon optimized placed in-line hyaluronan synthase gene of subtilis and from the structure of the integrated expression vector of the fruit ficoll enzyme gene promoter of glucose-6-phosphate dehydrogenase gene, UTP-Cori ester transferase gene, N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene and the bacillus megaterium of Bacillus licheniformis.

With the fruit ficoll enzyme gene promoter directed cloning of bacillus megaterium BamHI and XbaI site to pBlueScript SK (-), and then will from streptococcus zooepidemicus and according to the codon optimized hyaluronan synthase gene directed cloning of subtilis to XbaI and NotI site, again with same copy from streptococcus zooepidemicus and according to the codon optimized hyaluronan synthase gene directed cloning of subtilis to NotI and SacII site.Two parts of genes are added with ribosome bind site sequence A GGAGGTG.Like this, promptly there are 2 parts of same hyaluronan synthase genes under the control of same promotor, to transcribe.Downcut and recovery PsacB-szhas-szhas expression cassette with BamHI and SacII, be connected to, replace the PsacB-szhas expression cassette among the pAX-szhas5, constitute new carrier pAX-szhas6 with in BamHI and the SacII double digestion pAX-szhas5 carrier.Compare with pAX-szhas5, pAX-szhas6 has increased a hyaluronan synthase gene.

(15) contain from PBCV and according to the codon optimized hyaluronan synthase gene of subtilis, from the D-pectinose alcohol dehydrogenase gene of weak oxidized acetic acid bacteria, from the structure of the integrated expression vector of the fruit ficoll enzyme gene promoter of the glucose-6-phosphate dehydrogenase gene of bacillus megaterium and bacillus megaterium.

On the basis of expression vector pAX-AGH2, use D-pectinose alcohol dehydrogenase gene to replace erythromycin resistance gene from weak oxidized acetic acid bacteria.With SnaBI and SacII double digestion pAX-AGH2, D-pectinose alcohol dehydrogenase gene directed cloning in the carrier of this double digestion, is obtained carrier pAX-AGH3, its collection of illustrative plates such as Figure 15.

(16) contain from streptococcus zooepidemicus and according to subtilis codon optimized hyaluronan synthase gene and from the structure of the integrated expression vector of the fruit ficoll enzyme gene promoter of glucose-6-phosphate dehydrogenase gene, UTP-Cori ester transferase gene, N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene and the subtilis of Bacillus licheniformis and its regulating and controlling sequence and D-pectinose alcohol dehydrogenase gene.

On the basis of expression vector pAX-szhas5, use from streptococcus zooepidemicus and according to subtilis codon optimized hyaluronan synthase gene replace among the pAX-szhas5 according to the codon optimized hyaluronan synthase gene of Bacillus licheniformis, use SacII and SnaBI double digestion again, will be from the pneumococcal D-pectinose of Carlos Kleiber alcohol dehydrogenase gene directed cloning to SacII and SnaBI site.Constitute new carrier pAX-szhas6.Need not adopt erythromycin resistance screening mark behind this carrier transformed host cell, but adopt the D-pectinose alcoholdehydrogenase metabolic marker of safety.The collection of illustrative plates of pAX-szhas6 such as Figure 16.

Embodiment 3: the expression vector that embodiment 2 is made up is transformed among the different gram-positive cell hosts

This embodiment describes several expression vectors that embodiment 2 is made up and is transformed into the method that thereby acquisition can be synthesized hyaluronic host cell among the gram-positive cell host.List in the present embodiment with bacillus subtilis mycetocyte, Bacillus licheniformis cell, bacillus megaterium cell, short bacillus cell as synthetic hyaluronic host, but do not illustrate that the present invention does not use other unlisted gram positive host cell.

The integrated expression vector carrier pAX-cvhas2 that (1) will make up is transformed in the bacillus subtilis mycetocyte.

The competence for preparing subtilis in accordance with the following methods: subtilis rule on the LB flat board obtains single bacterium colony, again single colony inoculation is spent shaking culture 5 hours 37 in 3 milliliters of liquid LB substratum, take out 500 microlitres and be inoculated in 10 milliliters of SPI liquid nutrient mediums, arrived logarithmic phase in 5 hours in 37 degree shaking culture.From then on cultivated 90 minutes for 150 rev/mins at 37 degree in sucking-off 200 microlitres to the 2 milliliter SPII liquid nutrient medium in the SPI substratum of mycetome again, the EGTA that adds 20 microlitre 10mmol/L again, cultivated 10 minutes for 150 rev/mins at 37 degree, be distributed into 200 microlitres, one pipe again, the plasmid vector pAX-cvhas2 that adds 1 microgram spends shaking culture 90 minutes 37, and bacterium liquid all is coated on the LB flat board that contains 4 mcg/ml erythromycin, cultivated 48 hours at 37 degree, obtain 65 single bacterium colonies.Picking 5 strain bacterium are extracted total DNA, with the following a pair of primer cvhasA gene that increases.Obtain size for the DNA band of 1.7kb, consistent with the actual size from the hyaluronan synthase gene of PBCV, PCR verifies the result as shown in figure 17.

Swimming lane

1,2,3,5 among Figure 17 and 6 is the DNA of 1.7kb for the total DNA with single bacterium colony of anti-erythromycin does the size that obtains behind the PCR.

Swimming lane 4 is for contrasting the situation after the total DNA of bacterium (not single bacterium colony of anti-erythromycin) is PCR, and there do not have DNA to take out of to be existing.

M is the dna molecular amount contrast of 500bp gap size.Be followed successively by from bottom to top: 500bp, 1000bp, 1500bp, 2000bp (a brightest band), 2500bp, 3000bp etc.

Used a pair of primer is:

5’-CT?TCT?AGA?ATG?GGA?AAA?AAC?ATC?ATC?ATC?ATG?G-3’

5’-CT?CCGCGG?TTA?TAC?AGA?CTG?GGC?GTT?CGT?TGT?AGC-3’

Amplification condition is:

94 degree sex change 40 seconds, 58 degree annealing 40 seconds, 72 degree extended totally 35 circulations 90 seconds.

The compound method of solution is:

SPI solution: add 50% glucose of 1% volume and 100 times CAFE solution of 1% volume in the SP salts solution; Wherein SP salts solution composition is: 0.2% ammonium sulfate, 1.4% dipotassium hydrogen phosphate (being with 3 crystal water), 0.6% potassium primary phosphate, 0.02% magnesium sulfate heptahydrate, 0.1% Trisodium Citrate.100 times CAFE solution composition is: 2% hydrolysis tyrosine, 10% yeast soaks powder.

SPII solution: the magnesium chloride solution of the 250mmol/L of the calcium chloride solution of the 50mmol/L of adding 1% volume and 1% volume in the SPI solution.

(2) carrier pHC-cvhas2 is transformed in the short genus bacillus.

The method of describing according to disclosed document (Zhou Haiyan etc., journal of Zhejiang university (agricultural and life science version), 34 (4): 389-394,2008) is transformed into additive type plasmid pHC-cvhas2 in the short genus bacillus.Be coated on then on the nutrition nutrient agar screening flat board that contains 10 mcg/ml paraxin and 50 mcg/ml penbritins, cultivated 24-36 hour at 37 degree.The resistance bacterium colony that grows is extracted plasmid as template, the a pair of primer of describing with above-mentioned (1) carries out pcr amplification under similarity condition, obtain size and be the specific DNA band of 1.7kb, consistent with the hyaluronan synthase gene actual size from PBCV, PCR checking result as shown in figure 18.

Swimming lane

2,3,4,5 among Figure 18 and 6 is the DNA of 1.7kb for the total DNA with single bacterium colony of chloramphenicol resistance and penbritin does the size that obtains behind the PCR.

Swimming lane 1 is for contrasting the situation after the total DNA of bacterium (not single bacterium colony of chloramphenicol resistance and penbritin) is PCR, and there do not have DNA to take out of to be existing.

Show that carrier pHC-cvhas2 is transformed in the short genus bacillus.

(3) carrier pAX-cvhas5 is transformed in the Bacillus licheniformis cell.

According to disclosed document (Mo Jingyan etc., biotechnology, 19 (5); 75-77,2009) method of describing is transformed into integrative plasmid carrier pAX-cvhas5 in the Bacillus licheniformis cell.Be coated on then on the LB screening flat board that contains 4 mcg/ml erythromycin and 50 mcg/ml penbritins, cultivated 24-36 hour at 37 degree.The resistance bacterium colony that grows is extracted total DNA as template, and a pair of primer of describing with above-mentioned (1) carries out pcr amplification under similarity condition, obtains size and is the specific DNA band of 1.7kb, and is consistent with the hyaluronan synthase gene actual size from PBCV.Show that carrier pAX-cvhas5 is transformed in the Bacillus licheniformis cell.

(4) additive type expression vector pNW-szhas2 is transformed in the Bacillus coagulans (Bacillus coagulans).

According to disclosed document (Moro A et al, Biotechnology Techniques, 1995, Vol9 (8), pp.589-590) method of describing is cultivated Bacillus coagulans, in containing the substratum of bacterium, add plasmid pNW-szhas2 then, under the condition of 1500V voltage, 25 μ F electric capacity and 200 ohmic resistances, carry out electroporation and transform (used instrument is Bio-Rad Gene Pulser).Sucking-off bacterium liquid adds the rich medium mixing, is coated in the rich medium that contains 15 μ g/ml paraxin to cultivate 2 days at 37 ℃.The bacterium colony of looking is extracted plasmid, be transformed into again in the bacillus coli DH 5 alpha, in the rich medium that contains 50 μ g/ml, cultivate and extract plasmid, for carrying out PCR, obtain the DNA of 1.2kb with following a pair of primer.

5’-CTTTCTAGAATGCGTACACTGAAAAATCTTATTACGG-3’

5’-ATCCGCGG?TTACAATAATTTTTTGCGCGTTCCCC-3’

Show that carrier pNW-szhas2 is transformed in the Bacillus coagulans genome.

(5) additive type expression vector pNW-szhas1 is transformed in the bacillus natto (Bacillus natto).

According to disclosed document (Moro A et al, Biotechnology Techniques, 1995, Vol9 (8), pp.589-590) method of describing is cultivated bacillus natto, in containing the substratum of bacterium, add plasmid pNW-szhas1 then, under the condition of 1200V voltage, 25 μ F electric capacity and 200 ohmic resistances, carry out electroporation and transform (used instrument is Bio-Rad Gene Pulser).Sucking-off bacterium liquid adds the rich medium mixing, is coated in the rich medium that contains 15 μ g/ml paraxin to cultivate 2 days at 37 ℃.The bacterium colony of looking is extracted plasmid, be transformed into again in the bacillus coli DH 5 alpha, in the rich medium that contains 50 μ g/ml, cultivate and extract plasmid, for carrying out PCR, obtain the DNA of 1.2kb with following a pair of primer.

5’-CTTTCTAGAATGCGTACACTGAAAAATCTTATTACGG-3’

5’-ATCCGCGG?TTACAATAATTTTTTGCGCGTTCCCC-3’

The result proves that expression vector pNW-szhas1 is transformed in the bacillus natto genome.

(6) integrated expression vector pAX-szhas6 is transformed bacstearothermophilus.

According to disclosed document (Moro A et al, Biotechnology Techniques, 1995, Vol9 (8), pp.589-590) method of describing is cultivated bacstearothermophilus, in containing the substratum of bacterium, add plasmid pAX-szhas6 then, under the condition of 1500V voltage, 25 μ F electric capacity and 200 ohmic resistances, carry out electroporation and transform (used instrument is Bio-Rad GenePulser).Sucking-off bacterium liquid adds the rich medium mixing, is coated in the rich medium that contains 4 μ g/ml erythromycin to cultivate 2 days at 37 ℃.The bacterium colony of looking is extracted total DNA, for carrying out PCR, obtain the DNA of 1.2kb with following a pair of primer.

5’-CTTTCTAGAATGCGTACACTGAAAAATCTTATTACGG-3’

5’-ATCCGCGG?TTACAATAATTTTTTGCGCGTTCCCC-3’

The result proves that expression vector pAX-szhas6 has been transformed in the bacstearothermophilus genome.

(7) carrier pAX-szhas5 is transformed in the bacillus megaterium.

The method of describing according to disclosed document (Zhang Xinjian etc., Yunnan plant research, 29 (6): 666-670,2007) is transformed into integrative plasmid carrier pAX-szhas5 in the bacillus megaterium cell.Be coated on then on the LB screening flat board that contains 4 mcg/ml erythromycin and 50 mcg/ml penbritins, cultivated 24-36 hour at 37 degree.The resistance bacterium colony that grows is extracted total DNA as template, carry out pcr amplification in order to following a pair of primer, obtain size and be the specific DNA band of 1.2kb, consistent with the hyaluronan synthase gene actual size from streptococcus zooepidemicus, PCR checking result as shown in figure 19.

Swimming lane

1,2,3,4,5 among Figure 19 and 6 is the DNA of 1.2kb for the total DNA with single bacterium colony of anti-erythromycin does the size that obtains behind the PCR.

Used a pair of primer is:

5’-CTTTCTAGAATGCGTACACTGAAAAATCTTATTACGG-3’

5’-ATCCGCGG?TTACAATAATTTTTTGCGCGTTCCCC-3’

The condition of pcr amplification is:

94 degree sex change 40 seconds, 58 degree annealing 40 seconds, 72 degree extended totally 35 circulations 60 seconds.

Proof carrier pAX-szhas5 has been transformed in the bacillus megaterium genome.

Embodiment 4: the genetically engineered gram-positive microorganism produces hyaluronic lactose-induced fermentation test

With the single bacterium colony that obtains chloramphenicol resistance behind the plasmid vector pNW-szhas1 conversion bacillus natto cell, the resistance bacterium colony contains hyaluronan synthase gene after the empirical tests, and picking one strain bacterium carries out the shake flask fermentation test.The overnight incubation of earlier inoculation (being added the paraxin of 15 micrograms/microlitre) in 2 milliliters of LB substratum, again 1 milliliter of bacterium liquid is inoculated into that (composition is: KH2PO4 7.0g/L in 500 ml shake flasks that contain 100 milliliters of minimum mediums, Na2HPO4 5.0g/L, (NH4) 2SO4 5.0g/L, trisodium citrate 2.5g/L, MgSO4.7H2O 2.5g/L, CaCl2.2H2O 0.25g/L, glucose 10g/L, 5 milliliters of micro-mother liquors; The trace element mother liquor composition is: citric acid 50g/L, FeSO4.7H2O 10g/L, MnSO4.H2O 5g/L, CuSO4.5H2O 1g/L, ZnCl2 2g/L).Cultivation for some time runs out of entirely substantially until glucose earlier under 37 degree, 7.0,200 rev/mins of conditions of pH value, adding final concentration again is that 1% lactose was induced 36 hours as inductor, after the fermentation ends, the dehydrated alcohol adularescent flocks that the centrifuging and taking supernatant adds 3 times of volumes produces.

Illustrate that lactose can induce hyaluronic synthetic.

Embodiment 5: the genetically engineered gram-positive microorganism produces hyaluronic wood sugar and induces fermentation test

With the single bacterium colony that obtains anti-erythromycin after the plasmid vector pAX-szhas1 conversion Bacillus amyloliquefaciens, the resistance bacterium colony contains hyaluronan synthase gene after the empirical tests, and picking one strain bacterium carries out the shake flask fermentation test.The overnight incubation of earlier inoculation (being added the erythromycin of 4 micrograms/microlitre) in 2 milliliters of LB substratum, again 1 milliliter of bacterium liquid is inoculated into that (composition is: KH2PO4 7.0g/L in 500 ml shake flasks that contain 100 milliliters of minimum mediums, Na2HPO4 5.0g/L, (NH4) 2SO4 5.0g/L, trisodium citrate 2.5g/L, MgSO4.7H2O 2.5g/L, CaCl2.2H2O 0.25g/L, glucose 10g/L, 5 milliliters of micro-mother liquors; The trace element mother liquor composition is: citric acid 50g/L, FeSO4.7H2O 10g/L, MnSO4.H2O 5g/L, CuSO4.5H2O 1g/L, ZnCl2 2g/L).Cultivation for some time runs out of entirely substantially until glucose earlier under 37 degree, 7.0,200 rev/mins of conditions of pH value, adding final concentration again is that 0.5% wood sugar was induced 48 hours as inductor, after the fermentation ends, the dehydrated alcohol adularescent flocks that the centrifuging and taking supernatant adds 3 times of volumes produces.

Illustrate that wood sugar can induce hyaluronic synthetic.

Embodiment 6: the genetically engineered gram-positive microorganism produces hyaluronic sucrose induction fermentation test

With the single bacterium colony that obtains anti-erythromycin behind the plasmid vector pAX-cvhas5 conversion Bacillus licheniformis cell, the resistance bacterium colony contains hyaluronan synthase gene after the empirical tests, and picking one strain bacterium carries out the shake flask fermentation test.The overnight incubation of earlier inoculation (being added the erythromycin of 4 micrograms/microlitre) in 2 milliliters of LB substratum, again 1 milliliter of bacterium liquid is inoculated into that (composition is: KH2PO4 7.0g/L in 500 ml shake flasks that contain 100 milliliters of minimum mediums, Na2HPO4 5.0g/L, (NH4) 2SO4 5.0g/L, trisodium citrate 2.5g/L, MgSO4.7H2O 2.5g/L, CaCl2.2H2O 0.25g/L, glucose 5g/L, 5 milliliters of micro-mother liquors; The trace element mother liquor composition is: citric acid 50g/L, FeSO4.7H2O 10g/L, MnSO4.H2O 5g/L, CuSO4.5H2O 1g/L, ZnCl2 2g/L).Cultivation for some time runs out of entirely substantially until glucose earlier under 37 degree, 7.0,200 rev/mins of conditions of pH value, and adding final concentration again is that 2% sucrose is induced hyaluronic synthesizing as inductor, continues to cultivate until fermentation ends.After the fermentation ends, the dehydrated alcohol adularescent flocks that the fermented liquid comparatively thickness that becomes, centrifuging and taking supernatant add 3 times of volumes produces.

Illustrate that sucrose can induce hyaluronic synthetic.

Embodiment 7: the genetically engineered gram-positive microorganism produces hyaluronic ferment tank test

With the bacterium colony that obtains anti-erythromycin behind the integrating expression vector pAX-szhas6 conversion bacillus subtilis mycetocyte, the resistance bacterium colony contains hyaluronan synthase gene after the empirical tests, and picking one strain bacterium carries out the ferment tank test.Overnight incubation obtains one-level test tube seed earlier inoculation (to be added the erythromycin of 4 micrograms/microlitre) in 4 milliliters of LB substratum, again 1 milliliter of bacterium liquid is inoculated in 500 ml shake flasks that contain 100 milliliters of minimum mediums to cultivate and obtains the secondary shake-flask seed, cultivate 400 milliliters secondary seed altogether.All insert 400 ml shake flask seeds in the fermentor tank that contains 3.0 liters, cultivation for some time runs out of entirely substantially until glucose earlier under 37 degree, 7.0,600 rev/mins of conditions of pH value, mixing speed is reduced to 400 rev/mins, adding sucrose again makes final concentration reach 2.5%, add yeast simultaneously and soak powder, continue to cultivate until fermentation ends as nitrogenous source.After the fermentation ends, the fermented liquid comparatively thickness that becomes is got 10 milliliters of fermented liquids, and the dehydrated alcohol adularescent flocks that the centrifuging and taking supernatant adds 3 times of volumes produces, and white flocks such as Figure 20 of being produced are kept at this white flocks in the dehydrated alcohol.

The minimum medium composition is: KH ₂PO ₄7.0g/L, Na ₂HPO ₄5.0g/L, (NH4) ₂SO ₄5.0g/L, trisodium citrate 2.5g/L, MgSO ₄.7H ₂O 2.5g/L, CaCl ₂.2H ₂O 0.25g/L, glucose 5g/L, 5 milliliters of micro-mother liquors; The trace element mother liquor composition is: citric acid 50g/L, FeSO ₄.7H ₂O 10g/L, MnSO ₄.H ₂O 5g/L, CuSO ₄.5H ₂O1g/L, ZnCl ₂2g/L.The concentration of sucrose fluid infusion bottle is 50% (quality volume percent), and the concentration that yeast soaks powder fluid infusion bottle is 20% (quality volume percent).

Hyaluronic refining in embodiment 8 fermented liquids

Get embodiment 7 and obtain fermented liquid 800mL, add chlorobenzene while stirring, add 200 milliliters altogether,, remove bacterial sediment with the centrifugal 10min of 5000rpm, adding people 10g sodium-chlor in supernatant liquor fully dissolves, to 95% the ethanol that wherein adds 3 times of volumes, mixing also stirs, and leaves standstill 30 minutes again, with the centrifugal 10min of 3000rpm, obtain white depositions and be the HA extract.

With concentration is that the NaHCO3 aqueous solution 450mL of 4.2g/L and Na2 CO3 aqueous solution 50mL that concentration is 5.3g/L add in the said extracted thing, the every mg protein of trypsin that adds 20mg again adds the enzyme amount of 100 unit of activity), under 35 ℃, 120rpm, stir hydrolysis 2h.Add sodium-chlor again and reach 10g/L and stir to concentration in the above-mentioned solution and make it to dissolve fully, add 95% ethanol of 3 times of volumes then, leave standstill coagulative precipitation 1h, obtain hyaluronic precipitation so that 3000rpm is centrifugal.

This precipitation that obtains is added to contain NaCl concentration be that 10g/L, Na2HPO4 concentration are that 0.2g/L, NaH2 PO4 concentration are in the 500mL aqueous solution of 0.06g/L, stirring and dissolving, to 95% ethanol that wherein adds 3 times of volumes, mixing stirs, the centrifugal recovery of 3000rpm obtains the hyaluronic acid precipitation, and with the washing with alcohol of 30mL 80%, drying obtains the acid of solid transparent matter.It is that 0.1g/L, NaH2PO4 concentration are 0.05g/L that the above-mentioned solid HA that obtains is dissolved in Na2HPO4 concentration, NaCl concentration is in the 400mL aqueous solution of 10g/L, stirring and dissolving, in solution, add then with sour pretreated 5g gac and with 80rpm, 50 ℃ are stirred 1h, through the filter membrane suction filtration of 0.22m, obtain clarifying filtrate then.Use the 1000mL deionized water 4 ℃ of dialysed overnight through the 35000Da dialysis tubing this filtrate.95% ethanol that adds 3 times of volumes in dialysis tubing, mixing stir and obtain cotton-shaped hyaluronic acid, and the centrifugal precipitation that obtains is with 20mL washing with acetone precipitation.Solid HA grinds through freezing, vacuum-drying and obtains white powder hyaluronic acid highly finished product.

Employed medicine is the medicine of medical grade, operates in the purifying air rank is 10,000 clean environment.

Adopt this method can from fermented liquid, prepare the pure product of the hyaluronic acid that meets makeup rank and medical external application.

Embodiment 9: the hyaluronic infrared detection of genetically engineered gram-positive microorganism fermentative preparation is identified

The white hyaluronic acid that embodiment 8 is obtained carries out pressing potassium bromide troche, carry out the infrared spectra check and analysis again, obtain the characteristic infrared absorption spectrogram, compare with the characteristic infrared absorption spectrogram of standard transparent matter acid, the result as can be seen, the white flocks that genetically engineered produces is hyaluronic acid.Infrared absorpting light spectra such as Figure 21 of the white flocks that the secretion of genetically engineered gram-positive microorganism produces.

As seen from Figure 21, at 3400cm ^-1Near intensive O-H stretching vibration is arranged, show that this material has the poly-hydroxy structure, and hyaluronic acid belongs to and contains polyhydric mucopolysaccharide.1620,1043 and 1542cm ^-1There is stronger absorption at the place, shows and contains C=O, C-N stretching vibration and N-H flexural vibration, show that this material contains the structure of kharophen, and hyaluronic acid contains kharophen.At 1427cm ^-1There is O=C-O stretching vibration absorption band at the place, shows to have dissociated carboxyl and hydroxyl structure on the glucuronic acid.1240,800-850cm ^-1Locate no absorption band, show not sulfur-bearing acidifying group of this material.The infrared absorption peak of this material and hyaluronic acid standard feature absorption peak fit like a glove, and show that the white flocks that the genetically engineered gram-positive microorganism produces is the hyaluronic acid mucopolysaccharide.

This method can prove that the white flocks that the genetically engineered gram-positive microorganism produces is hyaluronic acid.

Embodiment 10: the preparation that contains the hyaluronic skin cream of genetically engineered Gram-positive safety microorganisms makes according to following prescription and contains hyaluronic skin cream: (unit is the quality volume percent)

Composition	Content
		Fat-soluble Radix Glycyrrhizae extract	0.1％
Tegosept M	0.05％
		Linolic acid	0.5％
Citric acid	0.05％
		Linolenic acid	0.5％
Trisodium Citrate	0.05％

Glycerine	6.0％
		Essence	0.1％
Ethanol	5.0％
		Water-soluble intacellin	1.0％
The hydrogenated castor oil Soxylat A 25-7	0.8％
		Coenzyme Q10 99.0	0.3％
The hyaluronic acid of embodiment 8 preparations	1.0％
		Deionized water	85.0％

The skin cream that uses this method to prepare can effectively prevent the drying of skin, keeps the lubricated of skin.

Embodiment 11: the preparation that contains the hyaluronic skin moisten face cream of genetically engineered Gram-positive safety microorganisms makes according to the prescription of following table and contains hyaluronic skin moisten face cream: (unit is the quality volume percent)

Composition	Content (%)
		A group: lanolin	10.00
Mineral spirits	13.00
		Lipid acid	3.00
Glyceryl monostearate	3.00
		Hexadecanol	4.00
Polysorbate85	1.00
		Propylparaben	0.10
Methyl p-hydroxybenzoate	0.15
		B group: polyacrylic resin (solution of Carbopol 940,3%)	5.00
Deionized water	52.25
		Propylene glycol	5.00

C group: trolamine (85～87%)	1.00
		The hyaluronic acid of embodiment 8 preparations	1.5

Polyacrylic resin is added in the water, thorough mixing, and then add propylene glycol; Composition in the A group prepared according to relation with contents be heated to 80 ℃, the composition in the B group is prepared according to relation with contents be heated to 80 ℃.Be added in the B group A group and mixing then.Again the composition in the C group is added and also stir cooling in the mixture that A organizes and B organizes.

The skin moisten face cream that uses this method to prepare effectively prevents the drying of skin, can keep the smooth profit of skin clean.

Embodiment 12: the preparation that contains the hyaluronic profit eye liquid of genetically engineered Gram-positive safety microorganisms makes according to the prescription of following table and contains a hyaluronic profit liquid: (unit is the quality volume percent)

Composition	Content
		The Herba Centellae extracting solution	0.25ml
The pearl extracting solution	0.25ml
		Semen Cassiae extract	0.025g
Vitamins B ₆	0.005g
		Taurine	0.01g
Aspartic Acid	0.005g
		The hyaluronic acid that embodiment 8 makes	0.010g
Mentha camphor	0.005g
		Aseptic deionized water	14.5ml

Use the eye drop of embodiment 12 preparations can effectively alleviate the dry and astringent of eye.

Claims

1. hyaluronic allos synthetic method based on Gram-positive safety microorganism is characterized in that: may further comprise the steps:

The first step, separation and hyaluronic acid precursor from Gram-positive safety microorganism host, it is the synthetic relevant gene of UDP-glucuronic acid and UDP-N-acetyl-glucosamine, comprise: UDP-glucose dehydrogenase gene, i.e. SEQ ID No.31, SEQ ID No.32, SEQ ID No.33, SEQ ID No.34; UTP-Cori ester transferase gene, i.e. SEQ ID No.35, SEQ ID No.36, SEQ ID No.37; G-6-P mutase gene, i.e. SEQ ID No.38, SEQ ID No.39; G-6-P isomerase gene, i.e. SEQ ID No.40; Transaminase, i.e. SEQ ID No.41 and N-ethanoyl-1-phosphoric acid-glucose ammonia-uracil base transferase gene, i.e. SEQ ID No.42 and SEQ ID No.43;

Second step, according to the codon preference of the described Gram-positive safety of step 1 microorganism host SEQ ID No.44, SEQ ID No.45, SEQ ID No.46, SEQ ID No.47, SEQ ID No.48 are carried out base and replace, obtain SEQ IDNo.1 respectively to SEQ ID No.27 totally 27 kinds of different sequences;

The 3rd step, will from SEQ ID No.1 in the SEQ ID No.27 any gene and SEQ ID No.31 to more than one gene and constitutive promoter or expression casette of inducible promoters composition of SEQ IDNo.43 gene;

The 5th the step, Gram-positive genetically engineered safety host bacterium is carried out fermentation culture, add at cultivation stage and to induce hyaluronic acid synthetic inductor improving hyaluronic synthetic level, after the fermentation ends promptly from substratum separation and purification obtain hyaluronic acid based on Gram-positive safety microorganism;

The straight chain macromole acidic mucopolysaccharide that described hyaluronic acid is formed by connecting with the disaccharide units alternately by D-glucuronic acid and N-ethanoyl glucosamine, its molecular weight is 50,000 to five megadaltons.

2. the hyaluronic allos synthetic method based on Gram-positive safety microorganism according to claim 1, it is characterized in that described Gram-positive safety microorganism host is meant any in the following bacterium: clostridium butylicum or clostridium butyricum, Bacillus licheniformis, bacillus amyloliquefaciens, useful or nontoxic bacillus cereus, bacillus brevis, bacillus pumilus, short genus bacillus, bacstearothermophilus, bacillus megaterium, bacillus natto, subtilis, the stearothermophilus ground bacillus, Bacillus coagulans, slow genus bacillus or bacteroides amylophilus.

3. the hyaluronic allos synthetic method based on Gram-positive safety microorganism according to claim 1, it is characterized in that the microorganism of the described SEQ of containing ID No.44, SEQ ID No.45, SEQ ID No.46, SEQ ID No.47, SEQ ID No.48 gene respectively is: streptococcus zooepidemicus, class streptococcus equi, Paramecium bursaria paramecium bursaria Chlorella virus 1, streptococcus pyogenes and streptococcus uberis.

4. the hyaluronic allos synthetic method based on Gram-positive safety microorganism according to claim 1, it is characterized in that, the described base of carrying out is replaced and to be meant: carry out codon optimizedly according to the codon preference of host genome, will carry out the base replacement according to the codon preference that the gene of host bacterium is adopted when translating into protein from the gene synthetic relevant with hyaluronic acid of other nonhost bacterium.

5. the hyaluronic allos synthetic method based on Gram-positive safety microorganism according to claim 1 is characterized in that, comprises constitutive promoter or chemically inducible promoter in the described expression casette, wherein:

Constitutive promoter is meant: the promotor that all has transcriptional activity any period that the host bacterium is being cultivated; Described inducible promoters is meant: the specific period of cultivating the host bacterium just has the promotor of transcriptional activity, specifically comprises: chemically inducible promoter and physics inducement promotor.

6. the hyaluronic allos synthetic method based on Gram-positive safety microorganism according to claim 5, it is characterized in that described chemically inducible promoter comprises: the promotor of the promotor of the promotor of the fruit ficoll enzyme gene of bacillus megaterium, the xylose isomerase gene of bacillus megaterium, the fruit ficoll enzyme gene of subtilis, the promotor of the xylose isomerase gene of subtilis, promotor, the promotor of colibacillary lactose utilization operon, the intestinal bacteria that colibacillary pectinose utilizes operon.

7. the hyaluronic allos synthetic method based on Gram-positive safety microorganism according to claim 6 is characterized in that transcribing of described chemically inducible promoter is meant:

The promotor of described fruit ficoll enzyme gene has only and adds after the sucrose just transcribing of possible initial its downstream gene, and concentration of sucrose is 0.5% to 10%;

The promotor of described xylose isomerase gene has only and adds behind the wood sugar just transcribing of possible initial its downstream gene, and the mass percent concentration of wood sugar is 0.5% to 8%;

Described pectinose utilizes the promotor of operon to have only to add after the pectinose just transcribing of possible initial its downstream gene, and the mass percent concentration of pectinose is 0.5% to 8%;

The promotor of described lactose utilization operon has only and adds behind the lactose just transcribing of possible initial its downstream gene, and the mass percent concentration of lactose is 0.5% to 8%.

8. the hyaluronic allos synthetic method based on Gram-positive safety microorganism according to claim 5, it is characterized in that the promotor of described physics inducement comprises: derive from the heat shock promoter of the groESL gene of subtilis, the heat shock promoter of dnaK gene that derives from subtilis and the heat shock promoter that derives from the groE gene of Bacillus licheniformis.

9. the hyaluronic allos synthetic method based on Gram-positive safety microorganism according to claim 1, it is characterized in that described selective marker is meant: being used for effectively screening contains the gene of the Gram-positive safety microorganism host of hyaluronic acid synthesis related gene.

10. the hyaluronic allos synthetic method based on Gram-positive safety microorganism according to claim 1, it is characterized in that, described fermentation culture is meant: join and get glucose 5-20 grams per liter, yeast soaks powder 0.5-5 grams per liter, magnesium sulfate heptahydrate 0.3-3 grams per liter, potassium primary phosphate 3-8 grams per liter, Sodium phosphate dibasic 2-8 grams per liter, ammonium sulfate 2-8 grams per liter, Trisodium Citrate 2-5 grams per liter, iron vitriol 1-20 mg/litre, manganese sulfate monohydrate 1-20 mg/litre, anhydrous cupric sulfate 0.2-10 mg/litre, zinc chloride 0.2-10 mg/litre is regulated potential of hydrogen to 6.5-7.5 with citric acid or sodium hydroxide; Leavening temperature is the 28-37 degree, and mixing speed is 300-600 rev/min.