CN101935649B - SiRNA (Small Interfering RNA) molecule capable of suppressing Survivin expression and application thereof - Google Patents
SiRNA (Small Interfering RNA) molecule capable of suppressing Survivin expression and application thereof Download PDFInfo
- Publication number
- CN101935649B CN101935649B CN2009100543740A CN200910054374A CN101935649B CN 101935649 B CN101935649 B CN 101935649B CN 2009100543740 A CN2009100543740 A CN 2009100543740A CN 200910054374 A CN200910054374 A CN 200910054374A CN 101935649 B CN101935649 B CN 101935649B
- Authority
- CN
- China
- Prior art keywords
- sirna
- survivin
- gene
- rna
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention relates to a double-stranded siRNA (Small Interfering RNA) molecule capable of suppressing Survivin expression and application thereof in preparing antitumor drugs. The siRNA molecule has a positive-sense strand of SEQ ID NO:2 and an antisense strand of SEQ ID NO:3, wherein the antisense strand can specifically combine with mRNA (Messenger RNA) of a Survivin gene to degrade the mRNAso as to interfere a transcription posttranslational process, therefore the purpose of treating tumors is achieved.
Description
Technical field
The present invention relates to siRNA molecule and the application in the preparation antitumor drug thereof that a kind of Survivin of inhibition expresses.
Background technology
Survivin (Survivn) is that (Inhibitorofapoptosis, the IAP) newcomer of family are to find the strongest survivin at present to IAP.The Survivin function is complicated, has the inhibition apoptosis, promotes cell transformation and participates in mitotic division, the generation of blood vessel and the effects such as generation of tumor cell drug resistance of cell.The Survivin gene is (Nature Med such as Ambrosini; 1997,3 (8): what 917-921) screening and cloning arrived in the human genomic library, this full length gene 15KB; Be positioned 17q25; Contain 4 exons and 3 introns, the albumen that the Survivin gene encoding production is made up of 142 amino acid, molecular weight 16.2KD.Research shows that the high expression level of Survivin can suppress the multiple factor such as inductive apoptosis such as p53, caspases.It is the same with other member of IAP family to confirm that through transgenic technology Survivin suppresses mechanism of apoptosis, can directly act on Lrax from the latter stage of plastosome to the process of kytoplasm release.Have now found that the Survivin gene is generally expressed, like mammary cancer, cancer of the stomach, kidney, malignant melanoma, intestinal cancer, nerve metrocyte carcinoma and ovarian cancer etc. in embryonic tissue and malignant tumour; Do not express but in the tissue (having the trace expression) of differentiation and maturation and the other healthy tissues of cancer, have except that placenta, proliferative stage of endometrium, secretory endometrium.Its this characteristic makes and the immunotherapy of target Survivin and the apoptosis that gene therapy can promote tumour cell suppresses its propagation, and healthy tissues but can injury-free and influence.
The RNA perturbation technique is the biotechnology of rising in recent years, this technology be found to be disease treatment especially treatment for cancer opened up brand-brand-new way, for researcher provides a brand-new gene therapy theory.Disturbing the expression of specific gene with siRNA is the important component part of gene therapy.(RNA interference is by double-stranded RNA (double-stranded RNA, the PTGS that dsRNA) causes mechanism RNAi) in the RNA interference.Its principle is: the Dicer of RNase III ribozyme family, combine with double-stranded RNA, and it is cut into siRNA (the smallinterfering RNA that 21-23nt and 3 ' distal process go out; SiRNA); SiRNA and RNA induce reticent mixture (RNA-induced silencingcomplex RISC) combine, and untwists into strand subsequently; Activatory RISC receives to become the siRNA of strand to guide; Be combined on the said target mrna and sequence-specific and cut off, cause the specificity of said target mrna and decompose it, thus the PTGS mechanism that the blocking-up corresponding gene is expressed.RNAi is as a kind of technology of simple and effective gene knockout, is widely used in the research of functional genomics research and antiviral, antineoplaston.
RNA The Study of Interference progress to Survivin is rapid at present, and experiment in vitro has shown good effect.A lot of bibliographical informations are arranged, suppress the Survivin expression of gene with RNA interferential technology, Carvalho etc. are with small molecules interference RNA (small interfering RNA; SiRNA) transfection HeLa cell, the Western blot result shows the expression that has detected in the treatment group less than Survivin behind the 60h, cell proliferation obviously receives to press down; The part cell mitogen is blocked; Apoptosis (J CellSci, 2003,116 (14): 2987-2998) appear.Use the RNA perturbation technique;, disturb after gene transcription as targeted drug with the siRNA of target to Survivin gene, thus inducing apoptosis of tumour cell; Suppress the mitotic division of tumour cell; Vascularization when suppressing metastases and the tolerance that reduces the tumour cell chemicotherapy suppress tumour, possibly become a kind of new tumor therapeuticing method in the near future.
Summary of the invention
The double-stranded siRNA molecule that the object of the present invention is to provide a kind of suppressed Survivin that goes out through siRNA library of molecules technology screening to express, its following positive-sense strand and antisense strand are formed:
Positive-sense strand: 5 '-GAGCUGGAAGGCUGGGAGCCAGANn-3 ' (SEQ ID NO:2)
Antisense strand: 5 '-UCUGGCUCCCAGCCUUCCAGCUCNn-3 ' (SEQ ID NO:3)
Wherein, N is any in 4 kinds of DNA bases and the deoxidation form thereof, i.e. cytosine(Cyt) C, guanine G, VITAMIN B4 A, thymus pyrimidine T, deoxidation cytosine(Cyt) dC, deoxy-guanine dG, deoxyadenine dA or deoxythymidine dT; N is 0~2 integer.
In other words, the backbone sequences of this two strands siRNA molecule does
Positive-sense strand: 5 '-GAGCUGGAAGGCUGGGAGCCAGA-3 ' (SEQ ID NO:4)
Antisense strand: 5 '-UCUGGCUCCCAGCCUUCCAGCUC-3 ' (SEQ ID NO:5)
One preferred embodiment in, in the above-mentioned sequence 3 ' end " Nn " be two deoxythymidine dTdT.
Another object of the present invention is to provide the application of above-mentioned siRNA molecule in the preparation antitumor drug.
Experiment in vitro proves; The antisense strand of siRNA molecule of the present invention can combine with the mRNA of Survivin gene specifically; Degraded mRNA; Transcribe the back translation process thereby disturb, inducing apoptosis of tumour cell, to suppress tumour cell division, suppress tumor vascular generation, to reach the purpose of treatment tumour.
Description of drawings
Fig. 1 is synthetic Survivin gene ORFs agarose gel electrophoresis detection figure, and the dna fragmentation for preparing size is 429bp.The right side band is Marker (standard reference).
Fig. 2 is that the siRNA library of molecules makes up schematic flow sheet.
Fig. 3 is that U6-siRNA transcribes template-H1 expression cassette structural representation.
Fig. 4 is that the U6-siRNA of PCR preparation transcribes agarose gel electrophoresis detection figure behind template-H1 expression cassette purifying.Among the figure, leftmost side band is Marker (standard reference); SiRNA3 is the siRNA of 23bp of the present invention; And siRNA1, siRNA2 are respectively that screening obtains two other siRNA that length is 19bp and 22bp from the siRNA library of molecules.
Fig. 5 is that real-time quantitative PCR detects Survivin mRNA expression amount column diagram behind the expression cassette transfectional cell, the ordinate zou table not Survivin with respect to the mRNA expression level of GAPDH; X-coordinate representes respectively to handle experimental group, and wherein siRNA1-siRNA8 is 8 experimental group of siRNA transfection, and " untransfected " is normal cell untransfected group.
Fig. 6 is that real-time quantitative PCR detects Survivin mRNA expression amount column diagram behind the siRNA transfectional cell of chemosynthesis; Ordinate zou is represented the mRNA expression level of Survivin with respect to GAPDH; X-coordinate representes respectively to handle experimental group; Wherein siRNA2 is a siRNA transfection experiment group of the present invention, and " untransfected " is normal cell untransfected group.
Embodiment
For simplicity, hereinafter, term " siRNA ", " siRNA sequence " or " siRNA molecule " can be exchanged, and the meaning of their expressions is identical with scope.
Wherein, the siRNA sequence can be a single-stranded structure, also can be duplex structure.
SiRNA molecule of the present invention derives from the siRNA library of molecules for preparing to the function conserved regions of Survivin gene ORFs; The used siRNA library of molecules of the present invention technology is that (the Chinese invention patent application number is: 200710024217.6 for the patented technology of Biomics Bioisystech Co., Ltd; Patent name: PCR high flux construction siRNA whole site molecule library preparation method); Its advantage is that the prepared siRNA that obtains is randomly distributed in Survivin ORFs section; Length controlled property is distributed in 19-23bp, can improve the hit rate of effective target site.
The preparation of siRNA can be adopted several different methods; Such as: chemical synthesis, in-vitro transcription, enzyme are cut long-chain dsRNA, vector expression siRNA, the synthetic siRNA Expression element of PCR etc.; The investigator that appears as of these methods provides selectable space, can obtain gene silencing efficient better.
SiRNA molecule of the present invention can be used as the effective constituent of antitumor drug.Tumor disease comprises liver cancer, lung cancer, white blood disease, cancer of the stomach, cervical cancer, multiple myeloma, skin squama cancer, colorectal carcinoma, melanoma, bladder cancer, osteosarcoma.Medicine of the present invention is especially obvious to the restraining effect of liver cancer.
As a kind of expression-form of this siRNA molecule, can it be prepared into DNA expression cassette form, such as: U6 promotor-siRNA transcribes template-H1 promotor.
For the purpose of concise and to the point, hereinafter " U6 promotor-siRNA transcribes template-H1 promotor " is abbreviated as " U6-siRNA transcribes template-H1 " or " U6-siRNA-H1 ", the meaning of their expressions is identical with scope.
From application purpose, can with the siRNA molecule, express the siRNA molecule the DNA expression cassette, or the plasmid that comprises siRNA developed by molecule frame directly deliver medicine to the person that receives medicine privileged site on one's body as medicine, such as tumor tissues.
The formulation of medicine of the present invention can be various ways, as long as be suitable for the administration of corresponding disease and keep the activity of siRNA molecule rightly.Such as, for the injection drug delivery system, formulation can be a lyophilized powder.
Randomly, can comprise the acceptable auxiliary of any pharmacy in the said medicine formulation, as long as its activity that is suitable for corresponding drug delivery system and keeps the siRNA molecule rightly.
In order to realize the antitumous effect of the siRNA that design philosophy of the present invention and checking screening obtain, designed following experimental program:
(1) make up the siRNA library of molecules of survivin Survivin gene ORFs, comprise the siRNA effector molecule of target to Survivin gene in this library of molecules, length distribution is in 19-23bp.
(2) prepare the siRNA expression cassette with respective effects, its structure is that U6 promotor-siRNA transcribes template-H1 promotor, makes it be easier to in-vitro screening.
(3) utilization real-time quantitative PCR technology detects effect siRNA molecule that above-mentioned siRNA expression cassette records out at the transit cell restraining effect to the Survivin gene.
(4) the chemosynthesis aforesaid method screens the optimum target-spot siRNA that obtains, and in the cell in vitro experiment, further uses the mRNA expression level of real-time quantitative PCR technology for detection Survivin gene.
Following embodiment only is used to illustrate the present invention, is not to be to limit the invention.
Need to prove that dated especially as not having, the degree among the following embodiment is all weight percentage wt%.
Embodiment 1
The preparation of siRNA library of molecules
1. key instrument, reagent and material
1.1 instrument: PCR appearance (ABI company); Electroporation (BIO-RAD, MicroPulser); Whizzer (Eppendorf), long wavelength ultraviolet lamp etc.
1.2 material and reagent: 1kb plus DNA Ladder (invitrogen); DNase I (Roche); MnCl
2(BBI); Phosphoric acid joint (Sigma-aldrich); ATP (BBI); BSA (NEB); BmsbI (NEB); T4 dna ligase (NEB); Tag archaeal dna polymerase (Biomics Bioisystech Co., Ltd); Agarose (BBI); DNTP (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd); Phenol chloroform extraction agent (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd); Low-molecular-weight dna Ladder (NEB); EcoP15I (NEB); T4 archaeal dna polymerase (NEB); FokI enzyme (NEB); SfiI enzyme (NEB); Competent cell (invitrogen); The pU6H1-GFP expression vector (NT Oimcs, USA).Gel extraction agent box: QIAEX II Gel Extration Kit (QIAGEN); Plasmid extraction test kit (Biomics Bioisystech Co., Ltd).Other biochemical reagents are all purchased in Sigma-aldrich.
2.siRNA the structure of library of molecules
2.1 the acquisition of Survivin gene ORFs: by synthetic Survivin (GenBankAccessionnumber:NM 001168) ORFs (ORF) of the full gene of Biomics Bioisystech Co., Ltd, mrna length is: 429bp (Fig. 1).
122 atgggtgcc?ccgacgttgc?cccctgcctg?gcagcccttt?ctcaaggacc?accgcatctc
181?tacattcaag?aactggccct?tcttggaggg?ctgcgcctgc?accccggagc?ggatggccga
241?ggctggcttc?atccactgcc?ccactgagaa?cgagccagac?ttggcccagt?gtttcttctg
301?cttcaag
gag?ctggaaggct?gggagccaga?tgacgacccc?atagaggaac?ataaaaagca
361?ttcgtccggt?tgcgctttcc?tttctgtcaa?gaagcagttt?gaagaattaa?cccttggtga
421?atttttgaaa?ctggacagag?aaagagccaa?gaacaaaatt?gcaaaggaaa?ccaacaataa
481?gaagaaagaa?tttgaggaaa?ctgcggagaa?agtgcgccgt?gccatcgagc?agctggctgc
541?catggattga (SEQ?ID?NO:1)
2.2 the siRNA library of molecules makes up: (number of patent application is: 200710024217.6 with the patented technology structure siRNA library of molecules of Biomics Bioisystech Co., Ltd; Patent name: PCR high flux construction siRNA whole site molecule library preparation method), make up flow process and see Fig. 2.
Success makes up the siRNA library of molecules of Survivin ORFs, and the picking clone checks order at random, and its sequence length controllability is distributed between the 19-23bp, demonstrates the variety of site and length.
Embodiment 2
The preparation of siRNA expression cassette and target site screening
1. key instrument, reagent and material
1.1 instrument: PCR appearance (ABI); Real-time quantitative PCR appearance (Bio-Rad); Gel electrophoresis equipment (Liuyi Instruments Plant, Beijing); Long wavelength ultraviolet lamp; Cell culture incubator (Thermo) etc.
1.2 material and reagent: 1kb plus DNA Ladder (invitrogen); Pfu archaeal dna polymerase (Biomics Bioisystech Co., Ltd); Agarose (BBI); DNTP (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd); Sepharose purification kit (Biomics Bioisystech Co., Ltd), Lipofectamin
TM2000 (invitrogen), DMEM substratum (Gibco), TurboCapture mRNA kit (QIAGEN), SensiMix
TMOne-Step Kit (Quantace) etc.Other biochemical reagents are all purchased in Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
1.3PCR primer (Biomics Bioisystech Co., Ltd is synthetic):
5 ' U6 promoter primer: 5 '-AAGGTCGGGCAGGAAGAGGGC-3 '
3 ' H1 promoter primer: 5 '-TATTTGCATGTCGCTATGTGTTCT-3 '
Survivin forward primer: 5 '-CGACGTTGCCCCCTGCCTG-3 '
Survivin reverse primer: 5 '-AAGGAAAGCGCAACCGGACGA-3 '
GAPDH forward primer: 5 '-GAAGGTGAAGGTCGGAGTC-3 '
GAPDH reverse primer: 5 '-GAAGATGGTGATGGGATTTC-3 '
2.siRNA the preparation of expression cassette
2.1PCR amplification preparation U6-siRNA transcribes template-H1 expression cassette: choosing 8 routine Survivin siRNA positive colony plasmids is template, prepares U6-siRNA with the method amplification of high-fidelity enzyme Pfu archaeal dna polymerase through PCR and transcribes template-H1 expression cassette (Fig. 3 is the expression cassette synoptic diagram).
Each PCR reaction system is the reaction system of 50 μ l: 0.5 μ l template DNA (10-50ng), and 1 μ l5 ' U6 promoter primer (10 μ M), 1 μ l3 ' H1 promoter primer (10 μ M), 1 μ ldNTP (10mM), 0.5 μ lPfuDNA polysaccharase is used ddH
2O supplies 50 μ l.Reaction conditions is: 95 ℃ of preparatory sex change of 1min, and 95 ℃ of 15sec sex change, 58 ℃ of 30sec annealing, 72 ℃ of 30sec extend 20 circulations.1% agargel electrophoresis detects, and PCR product band is single, and clip size meets requirement of experiment.
2.2 expression cassette PCR product purification: 1.0% agarose gel electrophoresis separates the expression cassette that pcr amplification obtains, and with sepharose purification kit purifying jel product.DNA behind the purifying carries out 1.0% agarose gel electrophoresis once more and detects, and the U6-siRNA behind the purifying transcribes template-H1 expression cassette purity and concentration meets the requirements, and is as shown in Figure 4.The expression cassette concentration of using ultraviolet spectrophotometer to record after the preparation simultaneously is 200-420ng/ μ l.
3. target site screening
3.1 cell cultures: liver cancer cell SMMC-7721 in containing the DMEM substratum of 10%FBS, 37 ℃, 5%CO
2Incubator is cultivated.
3.2 cell bed board and transfection: cell is pressed 1 * 10
5/ hole is inoculated in the 96 porocyte culture plates, contains in the DMEM substratum of 10%FBS 37 ℃, 5%CO in nonreactive
2The incubator overnight cultures.
Transfection is according to Lipofectamin
TM2000 specification sheets transfection, U6-siRNA transcribes template-H1 expression cassette DNA amount and adds by 0.2 μ g/ hole.
3.3 real-time quantitative PCR detects Survivin gene mRNA level: extract purification kit TurboCapture mRNA kit with mRNA and extract purifying cells RNA; Operation is undertaken by the test kit specification sheets; Do not have RNase water/hole dissolving RNA by 80 μ l, getting 4 μ lRNA is that template is carried out the real-time quantitative PCR reaction.
Detect Survivin mRNA expression level in the sample with gene-specific primer, the house-keeping gene GAPDH that increases simultaneously contrasts as confidential reference items.3 parallel laboratory tests are done in each reaction.Set up following 25 μ l reaction systems: 4 μ l template ribonucleic acids, 12.5 μ l2 * SensiMix One-Step, 1 μ l5 ' forward primer (6 μ M), 1 μ l3 ' reverse primer (6 μ M), 0.5 μ l50 * SYBR GreenI supplies system to 25 μ l with no RNase water.Reaction conditions: 40 ℃ of reverse transcription 30min, 95 ℃ of preparatory sex change 7min, 95 ℃ of sex change 20sec, 60 ℃ of annealing 30sec, 72 ℃ are extended 30sec, circulate 45 times.
3.4 interpretation of result: with real-time quantitative PCR 2
-Δ Δ ctMethod is analyzed experimental result, and makes histogram, and is as shown in Figure 5; The result shows that the siRNA corresponding to many sites of Survivin all presents reticent preferably effect; Especially siRNA3, with respect to the untransfected group, its reticent effect to the Survivin gene reaches 81%.
Especially must need to prove that siRNA3 positive-sense strand sequence is corresponding with the 308-330 position (underscore part gagctggaaggctgggagccaga) in the Survivin gene ORFs.
Chemosynthesis siRNA verifies reticent effect
1. key instrument, reagent and material
1.1 instrument: nucleic acid synthesizer (GE company), PCR appearance (ABI company); Real-time quantitative PCR appearance (Bio-Rad); Cell culture incubator (Thermo) etc.
1.2 material and reagent: Lipofectamin
TM2000 (invitrogen), DMEM substratum (Gibco), TurboCapturemRNA kit (QIAGEN), SensiMix
TMOne-Step Kit (Quantace) etc.Other biochemical reagents are all purchased in Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
1.3PCR primer (Biomics Bioisystech Co., Ltd is synthetic):
Survivin forward primer: 5 '-CGACGTTGCCCCCTGCCTG-3 '
Survivin reverse primer: 5 '-AAGGAAAGCGCAACCGGACGA-3 '
GAPDH forward primer: 5 '-GAAGGTGAAGGTCGGAGTC-3 '
GAPDH reverse primer: 5 '-GAAGATGGTGATGGGATTTC-3 '
2. chemosynthesis prepares siRNA
The nucleic acid synthesizer (U.S. GE company) that utilizes Biomics Bioisystech Co., Ltd to have synthesizes the positive-sense strand (sense strand) of siRNA3 and the RNA of antisense strand (antisense strand) respectively.And carry out purifying, and positive-sense strand and corresponding antisense strand are annealed into siRNA two strands (duplex), packing 1OD/ pipe, last lyophilize, transfection is preceding with no RNase water dissolution to 20 μ M.
3. reticent efficient checking
3.1 cell cultures: liver cancer cell SMMC-7721 in containing the DMEM substratum of 10%FBS, 37 ℃, 5%CO
2Incubator is cultivated.
3.2 cell bed board and transfection: cell is pressed 1 * 10
5/ hole is inoculated in the 96 porocyte culture plates, contains in the DMEM substratum of 10%FBS 37 ℃, 5%CO in nonreactive
2The incubator overnight cultures.
Transfection is according to Lipofectamin
TM2000 specification sheets transfection, RNA presses the 10nM/ hole and adds.
3.3 real-time quantitative PCR detects Survivin gene mRNA level: extract purification kit TurboCapture mRNA kit with mRNA and extract purifying cells RNA; Operation is undertaken by the test kit specification sheets; Do not have RNase water/hole dissolving RNA with 80 μ l, getting 4 μ l RNA is that template is carried out the real-time quantitative PCR reaction.
Detect Survivin mRNA expression level in the sample with gene-specific primer, the house-keeping gene GAPDH that increases simultaneously contrasts as confidential reference items.Each reaction do 3 parallel.Set up following 25 μ l reaction systems: 4 μ l template ribonucleic acids, 12.5 μ l2 * SensiMixOne-Step, 1 μ l5 ' forward primer (6 μ M), 1 μ l3 ' reverse primer (6 μ M), 0.5 μ l50 * SYBR Green I supplies system to 25 μ l with no RNase water.Reaction conditions: 40 ℃ of reverse transcription 30min, 95 ℃ of preparatory sex change 7min, 95 ℃ of sex change 20sec, 60 ℃ of annealing 30sec, 72 ℃ are extended 30sec, circulate 45 times.
3.4 interpretation of result: with real-time quantitative PCR 2
-Δ Δ ctMethod is analyzed experimental result, and makes histogram, and is as shown in Figure 6, and the result shows that the reticent effect of the siRNA3 of target to survivin gene reaches 82%.
Sequence table
< 110>Biomics Bioisystech Co., Ltd
< 120>a kind of siRNA molecule and application thereof that suppresses the Survivin expression
<130>PCNBB0901067S
<141>2009-07-03
<160>5
<170>PatentIn?version?3.3
<210>1
<211>429
<212>DNA
<213>GenBank?Accession?number:NM_001168
<220>
< 221>Survivin gene ORFs
<222>(1)..(429)
<400>1
atgggtgccc?cgacgttgcc?ccctgcctgg?cagccctttc?tcaaggacca?ccgcatctct 60
acattcaaga?actggccctt?cttggagggc?tgcgcctgca?ccccggagcg?gatggccgag 120
gctggcttca?tccactgccc?cactgagaac?gagccagact?tggcccagtg?tttcttctgc 180
ttcaaggagc?tggaaggctg?ggagccagat?gacgacccca?tagaggaaca?taaaaagcat 240
tcgtccggtt?gcgctttcct?ttctgtcaag?aagcagtttg?aagaattaac?ccttggtgaa 300
tttttgaaac?tggacagaga?aagagccaag?aacaaaattg?caaaggaaac?caacaataag 360
aagaaagaat?ttgaggaaac?tgcggagaaa?gtgcgccgtg?ccatcgagca?gctggctgcc 420
atggattga 429
<210>2
<211>24
<212>RNA
< 213>artificial sequence
<220>
< 221>positive-sense strand
<222>(1)..(24)
<223>Nn
<220>
<221>misc_feature
<222>(24)..(24)
< 223>N is C, G, A, T, dC, dG, dA or dT; N is 0~2 integer.
<400>2
gagcuggaag?gcugggagcc?agaNn 24
<210>3
<211>24
<212>RNA
< 213>artificial sequence
<220>
< 221>antisense strand
<222>(1)..(24)
<223>Nn
<220>
<221>misc_feature
<222>(24)..(24)
< 223>N is C, G, A, T, dC, dG, dA or dT; N is 0~2 integer.
<400>3
ucuggcuccc?agccuuccag?cucNn 24
<210>4
<211>23
<212>RNA
< 213>artificial sequence
<220>
< 221>positive-sense strand
<222>(1)..(23)
<400>4
gagcuggaag?gcugggagcc?aga 23
<210>5
<211>23
<212>RNA
< 213>artificial sequence
<220>
< 221>antisense strand
<222>(1)..(23)
<400>5
ucuggcuccc?agccuuccag?cuc 23
Claims (4)
1. double-stranded siRNA molecule, its sequence is:
Positive-sense strand: 5 '-GAGCUGGAAGGCUGGGAGCCAGANn-3 ' (SEQ ID NO:2)
Antisense strand: 5 '-UCUGGCUCCCAGCCUUCCAGCUCNn-3 ' (SEQ ID NO:3),
Wherein, N is cytosine(Cyt) C, guanine G, VITAMIN B4 A, thymus pyrimidine T, deoxidation cytosine(Cyt) dC, deoxy-guanine dG, deoxyadenine dA or deoxythymidine dT; N is 0~2 integer.
2. siRNA molecule as claimed in claim 1 is characterized in that, said N is dT, and n is 2.
3. siRNA molecule as claimed in claim 1 is characterized in that, said n is 0.
4. like the application of each described siRNA molecule in the claim 1~3 in preparation treatment liver-cancer medicine.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100543740A CN101935649B (en) | 2009-07-03 | 2009-07-03 | SiRNA (Small Interfering RNA) molecule capable of suppressing Survivin expression and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100543740A CN101935649B (en) | 2009-07-03 | 2009-07-03 | SiRNA (Small Interfering RNA) molecule capable of suppressing Survivin expression and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101935649A CN101935649A (en) | 2011-01-05 |
CN101935649B true CN101935649B (en) | 2012-08-08 |
Family
ID=43389220
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009100543740A Active CN101935649B (en) | 2009-07-03 | 2009-07-03 | SiRNA (Small Interfering RNA) molecule capable of suppressing Survivin expression and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101935649B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104164434A (en) * | 2013-05-16 | 2014-11-26 | 首都儿科研究所 | siRNA molecule interfering with Survivin gene expression and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101126176A (en) * | 2007-07-23 | 2008-02-20 | 百奥生物技术(南通)有限公司 | Preparation method for PCR high flux construction siRNA whole site molecule library |
-
2009
- 2009-07-03 CN CN2009100543740A patent/CN101935649B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101126176A (en) * | 2007-07-23 | 2008-02-20 | 百奥生物技术(南通)有限公司 | Preparation method for PCR high flux construction siRNA whole site molecule library |
Non-Patent Citations (2)
Title |
---|
李艳等.非小细胞肺癌中Survivin和Sp1的表达及意义.《中华全科医学》.2009,第7卷(第1期),3-4. * |
杜虎等.shRNA沉默survivin基因对人膀胱移行细胞癌T24细胞生物学行为的影响.《第三军医大学学报》.2009,第31卷(第2期),124-127. * |
Also Published As
Publication number | Publication date |
---|---|
CN101935649A (en) | 2011-01-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP3236976B1 (en) | Rna interference agents for p21 gene modulation | |
Holdt et al. | Circular RNAs as therapeutic agents and targets | |
CN107454843B (en) | Pharmaceutical composition for treating cancer comprising microribonucleic acid as active ingredient | |
Akao et al. | Role of anti-oncomirs miR-143 and-145 in human colorectal tumors | |
CN102575254B (en) | Methods and compositions for the specific inhibition of KRAS by asymmetric double-stranded RNA | |
CN102341498B (en) | Natural antisense transcripton by suppressing VEGF (VEGF) treats the related diseases of VEGF | |
Xu et al. | Chromatin‐modifying drugs induce miRNA‐153 expression to suppress Irs‐2 in glioblastoma cell lines | |
Fan et al. | miR-19b promotes tumor growth and metastasis via targeting TP53 | |
Russo et al. | Aptamer-miR-34c conjugate affects cell proliferation of non-small-cell lung cancer cells | |
JPWO2009044899A1 (en) | Nucleic acids that control cell growth | |
Wang et al. | Technologies for targeting DNA methylation modifications: basic mechanism and potential application in cancer | |
EP2774989B1 (en) | Double-stranded nucleic acid molecule for gene expression control | |
Wang et al. | LncRNA CRNDE promotes the progression of B-cell precursor acute lymphoblastic leukemia by targeting the miR-345-5p/CREB Axis | |
He et al. | A Circular RNAs: Emerging roles and new insights in human cancers | |
Mackedenski et al. | Characterizing the interaction between insulin-like growth factor 2 mRNA-binding protein 1 (IMP1) and KRAS expression | |
CN101935651B (en) | siRNA module of targeted Survivin gene and application thereof | |
CN101935649B (en) | SiRNA (Small Interfering RNA) molecule capable of suppressing Survivin expression and application thereof | |
WO2011111715A1 (en) | Nucleic acid capable of regulating cell cycle | |
CN101935650B (en) | siRNA (Small interfering Ribonucleic Acid) molecule for interfering Survivin expression and application thereof | |
JP2022541212A (en) | SiRNA sequences targeting the expression of the human genes JAK1 or JAK3 for therapeutic use | |
CN104164434A (en) | siRNA molecule interfering with Survivin gene expression and application thereof | |
WO2007126150A1 (en) | Novel composition for treating cancer | |
CN102199603B (en) | Multi-target interfering RNA (Ribonucleic Acid) molecule and application thereof | |
Sun et al. | Potential therapeutic strategy for cancer: Multi-dimensional cross-talk between circRNAs and parental genes | |
CN105002183A (en) | siRNA molecule for inhibiting survivin gene expression and application of siRNA molecule |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |