CN101935012A - Au-DNA (Deoxyribonucleic Acid)-quantum dot composite structure electrode as well as preparation method and application thereof - Google Patents

Au-DNA (Deoxyribonucleic Acid)-quantum dot composite structure electrode as well as preparation method and application thereof Download PDF

Info

Publication number
CN101935012A
CN101935012A CN2009100880871A CN200910088087A CN101935012A CN 101935012 A CN101935012 A CN 101935012A CN 2009100880871 A CN2009100880871 A CN 2009100880871A CN 200910088087 A CN200910088087 A CN 200910088087A CN 101935012 A CN101935012 A CN 101935012A
Authority
CN
China
Prior art keywords
dna
quantum dot
electrode
gold
chain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN2009100880871A
Other languages
Chinese (zh)
Inventor
孟海凤
唐智勇
刘冬生
江雷
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National Center for Nanosccience and Technology China
Original Assignee
National Center for Nanosccience and Technology China
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Center for Nanosccience and Technology China filed Critical National Center for Nanosccience and Technology China
Priority to CN2009100880871A priority Critical patent/CN101935012A/en
Publication of CN101935012A publication Critical patent/CN101935012A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E10/00—Energy generation through renewable energy sources
    • Y02E10/50—Photovoltaic [PV] energy
    • Y02E10/549—Organic PV cells
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P70/00—Climate change mitigation technologies in the production process for final industrial or consumer products
    • Y02P70/50—Manufacturing or production processes characterised by the final manufactured product

Landscapes

  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

The invention provides an Au-DNA (Deoxyribonucleic Acid)-quantum dot composite structure electrode as well as a preparation method and application thereof. The Au-DNA-quantum dot composite structure electrode comprises a gold-plating substrate (1), a DNA (Deoxyribonucleic Acid) film (2) and a quantum dot (3), wherein the gold-plating substrate (1) is preferably a gold-plating silicon substrate; the DNA film (2) comprises a four-chain oligonucleotide molecular unit containing a section of four-chain part and a section of single-chain part, and the single-chain part is fixed on the gold-plating substrate (1); and the quantum dot (3) is crosslinked at the tail end of the four-chain part of the four-chain oligonucleotide molecular unit in the DNA film and is preferably CdSe/ZnS core-shell structure quantum dot with excellent optical properties. On the basis of the properties of four-chain oligonucleotide and CdSe/ZnS, a dynamic reversible photoelectric converting switch is obtained by regulating the pH value of a system, and the dynamic reversible photoelectric converting switch can be used for detecting the proton concentration change of the system to realize the reversible dynamic regulation and control of photoelectric conversion and be applied to intelligent bionic materials; and the preparation method has simplicity and effectiveness, low requirement on equipment, safety, reliability and environmental protection in a preparation process.

Description

Au-DNA-quantum dot composite construction electrode, Preparation Method And The Use
Technical field
The invention belongs to the photoelectric conversion technique field, specifically relate to the photosynthetic Au-DNA-quantum dot optoelectronic conversion of a kind of simulation green plants composite construction electrode, Preparation Method And The Use.
Background technology
Follow nature, surmount nature is the target that human development is pursued always.In decades, the photosynthesis of green plants and some bacteriums enjoys people's extensive concern in the nature, many researchers all are devoted to simulate the conversion process of energy of its high-efficiency environment friendly, have also obtained many achievements, as relevant opto-electronic conversion systems such as solar cells.Yet general opto-electronic conversion system all is static irreversible process, and the regulation and control opto-electronic conversion of dynamic reversible remains a challenge.
The photosynthesis of green plants, its essence are electronic transfer process, and the electronics transfer can betide among numerous systems, as: the organic compound molecule in solution or in the colloid; At different interfaces, as the electronic transfer process of metal-liquid surface, semiconductor-liquid and liquid-liquid interface.According to the Marcus theory of winning the Nobel Prize in 1992, electron transfer reaction speed depends on the distance between electron donor and acceptor, the variation of free energy of reaction and the size of reactant and the energy of solvent reorganization on every side.Therefore will obtain the optoelectronic multiplex switch of dynamic reversible, the distance between regulation and control electron donor and acceptor will be a kind of desirable method.
According to pertinent literature and patent report, quantum dot (QDs), it is semi-conductor nano particles, has excellent optical property, as wide absorption, narrow emission and size adjustable and high quantum production rate etc., outstanding especially FRET and electronics shift gives body, also is used for the solar cell of Development of New Generation and novel photoelectric intelligent material by people's expectation.
Dna molecular motor (i-motif) is a kind of special DNA secondary structure, is four chain spirals (cytimidine C and the protonated cytimidine C that is formed in the presence of proton by four cytimidine repetitive sequences +In conjunction with forming hydrogen bond).Because the dna molecular motor has special base sequence, it can take place folding under different pH condition and open.A kind of preparation method and purposes of dna molecular nano cabin are disclosed in Chinese patent application CN101096268A, this dna molecular nano cabin is to be assembled in dna molecular film on the gold substrate by mercapto gold key in essence, only utilize the conformation change of dna molecular motor to coat or discharge a certain size ion, as potassium ferricyanide ion etc.
Summary of the invention
The present invention is respectively by classical key reaction of mercapto gold and EDC/NHSS cross-linking reaction, at dna molecular motor end Connect Power respectively sub-acceptor (gold substrate) and electron donor (semiconductor-quantum-point), utilize the dna molecular motor in folding and the process opened, always be accompanied by two end-to-end distances from variation, make and become controlled to the distance between body and the acceptor, and then regulation and control electronic transfer process therebetween, finally obtain the photoelectric current change-over switch that photoelectric current changes with electrolyte ph.
Therefore, the objective of the invention is to, a kind of Au-DNA-quantum dot optoelectronic conversion composite construction electrode is provided.
Another object of the present invention is, the preparation method of above-mentioned Au-DNA-quantum dot optoelectronic conversion composite construction electrode is provided.
Another purpose of the present invention is, the purposes of above-mentioned Au-DNA-quantum dot optoelectronic conversion composite construction electrode is provided.
The objective of the invention is that method by the following technical solutions realizes.On the one hand, the invention provides a kind of Au-DNA-quantum dot composite construction electrode, this composite construction electrode comprises: (1) gold-plated substrate; (2) sulfydryl (SH) and amino (NH 2) the dna molecular rete modified, its dna molecular is made up of the four chain oligonucleotide molecules unit that comprise one section four chain part and one section strand part, and described strand partial fixing is in described (1) gold-plated substrate; And (3) quantum dot, the end of its crosslinked four chain oligonucleotide molecules, four chain parts at described (2) dna molecular rete.
Preferably, described (1) gold-plated substrate is selected from silicon substrate, tin indium oxide (ITO) electro-conductive glass etc.; More preferably, the plated thickness of described gold-plated substrate is considered economic factor greater than 20nm, can independently select the plated thickness greater than 20nm.
Preferably, four chain part base sequences of four chain oligonucleotide molecules of described composition (2) DNA rete are CCCTAACCCTAACCCTAACCC, and strand part base sequence is any 1～10 base that is selected among A, T, C and the G; More preferably, the base sequence of described four chain oligonucleotide molecules is as follows: 5 '-TGTTTTCTTCCCTAACCCTAACCCTAACCC-3 '.
Preferably, the two ends of four chain oligonucleotide molecules of described composition (2) DNA rete are respectively through sulfydryl and/or amido modified; More preferably, the base sequence of described four chain oligonucleotide molecules is as follows: 5 '-SH-TGTTTTCTTCCCTAACCCTAACCCTAACCC-NH 2-3 '.
Preferably, described (3) quantum dot is selected from CdTe, CdSe and CdSe/ZnS, is preferably the CdSe/ZnS core-shell quanta dots.
On the other hand, the invention provides the preparation method of above-mentioned Au-DNA-quantum dot composite construction electrode, this method may further comprise the steps: (1) prepares gold-plated substrate; (2) assembled dna rete: the DNA film layer group is installed to the prepared substrate of step (1), and wherein said DNA rete is made up of the four chain oligonucleotide molecules unit that comprise one section four chain part and one section strand part; (3) assembling quantum dot: quantum dot is assembled into the described oligonucleotide molecules of step (2).
Preferably, the gold-plated substrate in the wherein said step (1) is a silicon substrate, and its preparation utilizes magnetron sputtering method to finish in silicon base or other conductive substrates surface gold-plating; More preferably, described plated thickness is greater than 20nm.
Preferably, the four chain part base sequences that wherein said step (2) is formed four chain oligonucleotide molecules of DNA rete are CCCTAACCCTAACCCTAACCC, and strand part base sequence is any 1～10 base that is selected among A, T, C and the G; More preferably, these base sequence two ends are respectively through sulfydryl and/or amido modified.
Preferably, the assembling condition of DNA rete is as follows in the wherein said described step (2): DNA assembling concentration is 1～100 μ M, and the assembling environment is that pH is that built-up time is 4～24 hours among 4.5～6.0 the phosphate buffer PBS or Tris buffer solution; More preferably, after DNA assembling, soak into, removing the dna molecular of non-specific adsorption, and subdue possible sterically hindered with the 1mM mercaptoethanol.
Preferably, the quantum dot in the wherein said step (3) is selected from CdTe, CdSe and CdSe/ZnS, is preferably the CdSe/ZnS core-shell quanta dots.
Preferably, the assembling condition of quantum dot is as follows in the wherein said step (3): (concrete grammar sees also Hermanson G.T.BioconjugateTechniques to the EDC/NHSS cross-linking method by classics, Academic Press:San Diego, Califomia, 1996.) carry out grafting, the crosslinked concentration of quantum dot is 1～3 μ M, and the time is 2～4 hours; Preferably, described EDC/NHSS concentration is the mM level; More preferably, this process is also gathered the grafting of hexylene glycol with amino, with the stable quantum dot that is grafted to electrode surface.
Another aspect the invention provides the purposes of above-mentioned Au-DNA-quantum dot composite construction electrode in preparation dynamic reversible optoelectronic multiplex switch, photo-translating system and/or biochip.
In addition, the present invention also provides a kind of photo-translating system, and it comprises that above-mentioned Au-DNA-quantum dot composite construction electrode is as working electrode; Preferably, described photo-translating system also comprises electrode, reference electrode and/or electrolyte; More preferably, described is platinum electrode to electrode, and described reference electrode is a saturated calomel electrode, and described electrolyte is phosphate buffer.This photo-translating system can detect the solution system proton concentration and change the i.e. variation of pH value.
This shows that the present invention realizes that by assembling oligonucleotides rete (being the dna molecular motor) and quantum dot (as the CdSe/ZnS quantum dot) on gold-plated silicon substrate the conformation of dna molecular motor changes with the pH value of system.CdSe/ZnS QDs is the stable water-soluble quantum dot of mercaptopropionic acid (MPA).
The present invention also can realize by the following technical solutions.The preparation method of Au-DNA-QDs composite construction of the present invention is the also usefulness of self assembly and EDC/NHSS cross-linking method, and this method may further comprise the steps: (1) is gold-plated with magnetic control sputtering device on silicon substrate; (2) utilize the effect of mercapto gold key, Self-assembled DNA molecule rete on the gold-plated silicon substrate of step (1) gained; (3) by classical EDC/NHSS cross-linking reaction, quantum dot (CdSe/ZnS QDs) is grafted to the end of step (2) gained rete dna molecular, promptly get the Au-DNA-QDs package assembly.(4) with step (3) the Au-DNA-QDs package assembly that obtains as the working electrode of the used electrochemical workstation of the present invention, saturated calomel electrode and platinum electrode are respectively reference and to electrode, phosphate buffer (PBS) is as electrolyte, solar simulator promptly gets a complete photo-translating system as light source.(5) in step (4) gained photo-translating system, by the pH value of adjusting PBS solution and the switch of light source, obtain the switching currents of different sizes, thereby successfully prepare the optoelectronic multiplex switch of dynamic reversible.
In this method of the present invention, used cushioning liquid is phosphate buffered saline (PBS), and its purposes is for providing the assembling environment and serving as electrolyte.Compound method is as follows: take by weighing 8g NaCl, 0.2gKCl, 3.63g Na 2HPO 412H 2O and 0.24g KH 2PO 4Add secondary water to 100mL, dissolving obtains storing solution, before using storing solution is diluted 10 times, and adopts 1M NaOH or 1MHCl to transfer to required pH value solution.Used DNA two ends are modified with sulfydryl and amino respectively, its sequence is for comprising one section i-motif unit (CCCTAACCCTAACCCTAACCC) and the strand of base number between 1～10, and preferred total sequence is 5 '-SH-TGTTTTCTTCCCTAACCCTAACCCTAACCC-NH 2-3 ', assembling concentration is μ M level, 1 μ M preferably, and built-up time is 4～24 hours, is preferably 12 hours.Used quantum dot can be CdTe, CdSe, and CdSe/ZnS etc. are preferably the stable water-soluble CdSe of MPA/ZnS QDs, utilize EDC/NHSS cross-linking method (PBS:pH=7.4) will be grafted to the DNA end, and crosslinking time can be 2～4 hours.
Under the room temperature, utilize classical mercapto gold key to interact, with total sequence be 5 in PBS (pH=4.5) environment '-SH-TGTTTTCTTCCCTAACCCTAACCCTAACCC-NH 2-3 ' dna molecular be assembled on the clean gold-plated silicon substrate, through embathing of 1mM mercaptoethanol, it is inserted the cross-linking reaction of carrying out among the PBS (pH=7.4) 4 hours, used CdSe/ZnS QDs concentration is μ M, EDC/NHSS concentration is the mM level, finally obtains the complex group assembling structure of Au-DNA-QDs.The assembling overall process as shown in Figure 1.
With the gained composite construction as the working electrode in the electrochemical workstation as shown in Figure 2, and be respectively reference and to electrode with saturated calomel electrode and platinum electrode, phosphate buffered saline (PBS) is as electrolyte, solar simulator promptly gets a complete photo-translating system as light source.When electrolyte ph is 5.0, be folded into four chain structures owing to connect the dna molecular of QDs and Au electrode, shortened the distance between them, be convenient to the transfer transition of electronics, therefore detect bigger switching current, the difference (as shown in Figure 3) of the photoelectric current of promptly bigger light source switch attitude.And when transferring to 8.0 on the pH of the electrolyte value, under the situation that is with or without complementary strand (CS) existence, detected switching current all is significantly less than pH 5.0.Regulate the pH value of electrolyte repeatedly, the switching current that can be reversible obtain changes with pH value, thus realized the pH driving optoelectronic multiplex switch of dynamic reversible.And use the dna molecular (not comprising the i-motif structure sequence) of other sequences instead, and then can not reach above effect, its switching current is with the no significant change of pH value.
In sum, the present invention is by assembling the dna molecular that two ends are modified with sulfydryl and amino respectively on the gold-plated silicon substrate, and the stable CdSe/ZnS quantum dot (QDs) of MPA, obtain Au-DNA-quantum dot composite construction, because the pH adjustability of dna molecular conformation, distance becomes adjustable between quantum dot and Au.The assembly with DNA and quantum dot of the invention is assembled on the gold surface, and has preserved their activity or character separately, has realized the combination of DNA and quantum dot is transferred to lip-deep technological break-through from solution system.In addition, the present invention as the working electrode in the electrochemistry work system, by the pH value of regulation and control electrolyte, just can reach the purpose of the optoelectronic multiplex switch of dynamic reversible with this composite construction.
This shows that the present invention relates to a kind of bionical opto-electronic conversion composite construction that inspired by green plants photosynthesis, it comprises gold-plated silicon substrate, is assembled in four chain oligonucleotides (DNA) retes and the crosslinked semiconductor-quantum-point at the nucleotide chain end on its surface.This DNA rete modifies sulfydryl respectively by two ends and four amino chain oligonucleotide molecules unit are formed, each four chain oligonucleotide molecules unit comprises one section four chain part and one section strand part, wherein four chain parts are i-motif or the molecular motor unit that is commonly called as, can stretch under certain pH conditions and open and fold again, strand part base number is 1 to 10.Semiconductor-quantum-point is the CdSe/ZnS nuclear shell structure quantum point with excellent optical, excites down at luminous energy shifted by the electron transition of distance restraint, produces photoelectric current, realizes photoelectric conversion process.The characteristic of combination DNA molecular motor and CdSe/ZnS by the pH value of regulation system, obtains the optoelectronic multiplex switch of dynamic reversible.This switch can be used for detecting the solution system proton concentration to be changed, and can realize the reversible dynamic regulation of opto-electronic conversion, and can further combine with the biochip process technology, forms novel DNA chip.In addition, it is simply effective that the present invention also has preparation technology, low for equipment requirements, safe and reliable, and the advantage of preparation process environmental protection will have very high using value aspect the bionic intelligence material.
Description of drawings
Below, describe embodiments of the invention in conjunction with the accompanying drawings in detail, wherein:
Fig. 1 is the schematic flow sheet of Au-DNA-quantum dot composite construction electrode preparation method of the present invention.
Fig. 2 is for comprising the electrochemical workstation device schematic diagram of Au-DNA-quantum dot composite construction electrode among the present invention, wherein respectively with saturated calomel electrode and platinum electrode as reference with to electrode, phosphate buffered saline (PBS) is an electrolyte, and solar simulator is a light source.
Fig. 3 is the photoelectric current electrochemical Characterization of (i-t) in time of the embodiment of the invention 1 gained optoelectronic multiplex switch, can get by Ben Tu, during pH 5.0 corresponding to bigger switching current; And during pH 8.0,, all can only obtain very little switching current, 1/5th when its size is about pH 5.0 no matter whether complementary strand (CS) exists.
Fig. 4 is the dynamic reversible principle of the embodiment of the invention 1 gained optoelectronic multiplex switch, and the dna molecular conformational energy that promptly connects QDs and Au electrode takes place to fold and open with the variation of pH value.
The specific embodiment
Below by embodiment optoelectronic multiplex switch provided by the present invention (its dynamic reversible principle sees also Fig. 4) and preparation method thereof is elaborated.
Embodiment 1
Present embodiment is the preparation method of Au-DNA-quantum dot composite construction electrode of the present invention and reversible optoelectronic multiplex switch, and the preparation flow schematic diagram sees also Fig. 1, and concrete steps are as follows:
(1) adopt magnetic control sputtering device gold-plated on silicon substrate in advance, utilize the effect of mercapto gold key, this gold-plated silicon substrate was immersed in PBS (pH 4.5) solution of DNA 12 hours, assemble, used assembling liquid concentration is 1 μ M, and selected dna sequence dna is:
5′-SH-TGTTTTCTTCCCTAACCCTAACCCTAACCC-NH 2-3′。
(2) take out step (1) gained sample, embathe (pH 4.5) in 1mM mercaptoethanol PBS solution, embathes in the phosphate buffer with pH 7.4 then, with the dna molecular of removal non-specific adsorption, and eliminates the segment space steric hindrance.
(3) with step (2) gained sample, insert in the classical EDC/NHSS cross-linking reaction, (concrete preparation method sees also Wang with previously prepared CdSe/ZnS QDs under PBS (pH 7.4) environment, Q.B., Y.Xu, et al.A facile one-step in situ functionalization of quantumdots with preserved photoluminescence for bioconjugation.J.Am.Chem.Soc., 2007,129,6380 and Wang, Q.B., Y.Liu, et al.Quantum dot bioconjugationduring core-shell synthesis, Angew.Chem.Int.Ed., 2008,47,316) (concentration is about 2.5 μ M) be grafted to the end of step (1) gained rete dna molecular, crosslinking time is 4 hours, comprising PEG-NH 2Grafting (2.5mM) to stablize QDs, promptly gets Au-DNA-QDs assembling composite construction electrode.
(4) with step (3) the Au-DNA-QDs composite construction electrode that obtains as the working electrode of the used electrochemical workstation of the present invention, saturated calomel electrode and platinum electrode are respectively reference and to electrode, phosphate buffer (PBS) is as electrolyte, solar simulator promptly gets a complete photo-translating system as light source.
(5) in step (4) gained photo-translating system, by the pH value of adjusting PBS solution and the switch of light source, obtain the switching currents of different sizes, thereby successfully prepare the optoelectronic multiplex switch of dynamic reversible.As shown in Figure 3, the switching current that obtains during pH 5.0 is about 10nA, then significantly is decreased to 1/5th of gained switching current when only being about pH 5.0 during pH 8.0.
Embodiment 2
Present embodiment is the preparation method of Au-DNA-quantum dot composite construction electrode of the present invention and reversible optoelectronic multiplex switch, and basic step is with embodiment 1, and is specific as follows:
(1) utilize the effect of mercapto gold key, with assembling in PBS (pH 4.5) solution of previously prepared gold-plated silicon substrate immersion DNA 20 hours, used assembling liquid concentration was 1 μ M, and selected dna sequence dna is: 5 '-SH-TGTTTTCTTCCCTAACCCTAACCCTAACCC-NH 2-3 '.
(2) take out step (1) gained sample, (pH4.5) embathes in 1mM mercaptoethanol PBS solution, embathes in the phosphate buffer with pH 7.4 then, with the dna molecular of removal non-specific adsorption, and eliminates the segment space steric hindrance.
(3) with step (2) gained sample, insert in the classical EDC/NHSS cross-linking reaction, (under pH 7.4 environment previously prepared CdSe/ZnS QDs (concentration is about 2.5 μ M) is grafted to the end of step (1) gained rete dna molecular, crosslinking time is 3 hours, comprises PEG-NH at PBS 2Grafting (2.5mM) to stablize QDs, promptly gets Au-DNA-QDs assembling composite construction electrode.
(4) with step (3) the Au-DNA-QDs package assembly that obtains as the working electrode of the used electrochemical workstation of the present invention, saturated calomel electrode and platinum electrode are respectively reference and to electrode, phosphate buffer (PBS) is as electrolyte, solar simulator promptly gets a complete photo-translating system as light source.
(5) in step (4) gained photo-translating system, by the pH value of adjusting PBS solution and the switch of light source, obtain the switching currents of different sizes, thereby successfully prepare the optoelectronic multiplex switch of dynamic reversible.

Claims (14)

1. Au-DNA-quantum dot composite construction electrode is characterized in that described composite construction electrode comprises:
(1) gold-plated substrate;
(2) DNA rete, it is made up of the four chain oligonucleotide molecules unit that comprise one section four chain part and one section strand part, and described strand partial fixing is in described (1) gold-plated substrate; And
(3) quantum dot, four chain parts of its crosslinked four chain oligonucleotide molecules at described (2) DNA rete.
2. composite construction electrode according to claim 1 is characterized in that, described (1) gold-plated substrate is selected from silicon substrate and indium tin oxide-coated glass; Preferably, the plated thickness of described gold-plated substrate is greater than 20nm.
3. composite construction electrode according to claim 1 and 2, it is characterized in that, four chain part base sequences of four chain oligonucleotide molecules of described composition (2) DNA rete are CCCTAACCCTAACCCTAACCC, and strand part base sequence is any 1～10 base that is selected among A, T, C and the G; Preferably, the base sequence of described four chain oligonucleotide molecules is as follows:
5′-TGTTTTCTTCCCTAACCCTAACCCTAACCC-3′。
4. according to each described composite construction electrode in the claim 1 to 3, it is characterized in that the two ends of four chain oligonucleotide molecules of described composition (2) DNA rete are respectively through sulfydryl and/or amido modified; Preferably, the base sequence of described four chain oligonucleotide molecules is as follows:
5′-SH-TGTTTTCTTCCCTAACCCTAACCCTAACCC-NH 2-3′。
5. according to each described composite construction electrode in the claim 1 to 4, it is characterized in that wherein said (3) quantum dot is selected from CdTe, CdSe and CdSe/ZnS, is preferably the CdSe/ZnS core-shell quanta dots.
6. prepare the method for each described composite construction electrode in the claim 1 to 5, it is characterized in that, this method may further comprise the steps:
(1) prepares gold-plated substrate;
(2) assembled dna rete: the DNA film layer group is installed to the prepared gold-plated substrate of step (1), and wherein said DNA rete is made up of the four chain oligonucleotide molecules unit that comprise one section four chain part and one section strand part;
(3) assembling quantum dot: quantum dot is assembled into the described oligonucleotide molecules end of step (2).
7. method according to claim 6 is characterized in that, the gold-plated substrate in the wherein said step (1) is selected from silicon substrate and indium tin oxide-coated glass, and its preparation is gold-plated at substrate surface by magnetron sputtering method; Preferably, described plated thickness is greater than 20nm.
8. according to claim 6 or 7 described methods, it is characterized in that, the four chain part base sequences that wherein said step (2) is formed four chain oligonucleotide molecules of DNA rete are CCCTAACCCTAACCCTAACCC, and strand part base sequence is any 1～10 base that is selected among A, T, C and the G; Preferably, these base sequence two ends are respectively through sulfydryl and/or amido modified.
9. according to each described method in the claim 6 to 8, it is characterized in that, the assembling condition of DNA rete is as follows in the wherein said described step (2): DNA assembling concentration is 1～100 μ M, the assembling environment is that pH is that built-up time is 4～24 hours in 4.5～6.0 the phosphate or Tris buffer solution; Preferably, after oligonucleotides assembling, soak into, removing the dna molecular of non-specific adsorption, and subdue possible sterically hindered with the 1mM mercaptoethanol.
10. according to each described method in the claim 6 to 9, it is characterized in that the quantum dot in the wherein said step (3) is selected from CdTe, CdSe and CdSe/ZnS, is preferably the CdSe/ZnS core-shell quanta dots.
11. according to each described method in the claim 6 to 10, it is characterized in that, the assembling condition of quantum dot is as follows in the wherein said step (3): the EDC/NHSS cross-linking method by classics carries out grafting, and the crosslinked concentration of quantum dot is 1～3 μ M, and the time is 2～4 hours; Preferably, described EDC/NHSS concentration is the mM level; More preferably, this process is also gathered the grafting of hexylene glycol with amino, to stablize the good quantum dot of grafting.
12. the purposes of each described Au-DNA-quantum dot composite construction electrode in preparation dynamic reversible optoelectronic multiplex switch, photo-translating system and/or biochip in the claim 1 to 5.
13. a photo-translating system is characterized in that, described photo-translating system comprises that each described Au-DNA-quantum dot composite construction electrode is as working electrode in the claim 1 to 5; Preferably, described photo-translating system also comprises electrode, reference electrode and/or electrolyte; More preferably, described is platinum electrode to electrode, and described reference electrode is a saturated calomel electrode, and described electrolyte is phosphate buffer.
14. the purposes of the described photo-translating system of claim 13 in detecting the variation of solution system proton concentration.
CN2009100880871A 2009-07-02 2009-07-02 Au-DNA (Deoxyribonucleic Acid)-quantum dot composite structure electrode as well as preparation method and application thereof Pending CN101935012A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2009100880871A CN101935012A (en) 2009-07-02 2009-07-02 Au-DNA (Deoxyribonucleic Acid)-quantum dot composite structure electrode as well as preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2009100880871A CN101935012A (en) 2009-07-02 2009-07-02 Au-DNA (Deoxyribonucleic Acid)-quantum dot composite structure electrode as well as preparation method and application thereof

Publications (1)

Publication Number Publication Date
CN101935012A true CN101935012A (en) 2011-01-05

Family

ID=43388623

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2009100880871A Pending CN101935012A (en) 2009-07-02 2009-07-02 Au-DNA (Deoxyribonucleic Acid)-quantum dot composite structure electrode as well as preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN101935012A (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102928489A (en) * 2012-11-12 2013-02-13 北京工业大学 Preparation method of quantum dot electrochemical luminescence electrode based on deoxyribonucleic acid (DNA) charge transfer
CN103760201A (en) * 2013-12-10 2014-04-30 天津工业大学 Preparation method of composite quantum dot-based electrochemical DNA sensor
CN104297323A (en) * 2014-11-01 2015-01-21 济南大学 Preparation and application of ZnO@CdTe-carboxylation C3N4 photoelectric DNA sensor
CN105738451A (en) * 2016-02-01 2016-07-06 大连理工大学 Direct electron transfer type glucose biosensor and preparation method and application
JP2017529533A (en) * 2014-09-18 2017-10-05 ノキア テクノロジーズ オサケユイチア Apparatus and method for controllably distributing charge carriers in a channel

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101096268A (en) * 2006-06-30 2008-01-02 国家纳米科学中心 DNA molecule nano cabin and preparation method and usage thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101096268A (en) * 2006-06-30 2008-01-02 国家纳米科学中心 DNA molecule nano cabin and preparation method and usage thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHAD E. IMMOOS ET AL.: "DNA-PEG-DNA Triblock Macromolecules for Reagentless DNA Detection", 《J. AM. CHEM. SOC.》 *
DONGSHENG LIU ET AL.: "A Reversible pH-Driven DNA Nanoswitch Array", 《J. AM. CHEM. SOC.》 *
HAIFENG MENG ET AL.: "Photoelectric conversion switch based on quantum dots with i-motif DNA scaffolds", 《CHEM. COMMUN.》 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102928489A (en) * 2012-11-12 2013-02-13 北京工业大学 Preparation method of quantum dot electrochemical luminescence electrode based on deoxyribonucleic acid (DNA) charge transfer
CN102928489B (en) * 2012-11-12 2014-12-03 北京工业大学 Preparation method of quantum dot electrochemical luminescence electrode based on deoxyribonucleic acid (DNA) charge transfer
CN103760201A (en) * 2013-12-10 2014-04-30 天津工业大学 Preparation method of composite quantum dot-based electrochemical DNA sensor
JP2017529533A (en) * 2014-09-18 2017-10-05 ノキア テクノロジーズ オサケユイチア Apparatus and method for controllably distributing charge carriers in a channel
US10705075B2 (en) 2014-09-18 2020-07-07 Nokia Technologies Oy Apparatus and method for controllably populating a channel with charge carriers
CN104297323A (en) * 2014-11-01 2015-01-21 济南大学 Preparation and application of ZnO@CdTe-carboxylation C3N4 photoelectric DNA sensor
CN104297323B (en) * 2014-11-01 2016-01-20 济南大学 The carboxylated C of a kind of ZnO CdTe- 3n 4the preparation of photoelectricity DNA sensor and application thereof
CN105738451A (en) * 2016-02-01 2016-07-06 大连理工大学 Direct electron transfer type glucose biosensor and preparation method and application

Similar Documents

Publication Publication Date Title
Sakimoto et al. Physical biology of the materials–microorganism interface
den Hollander et al. Enhanced photocurrent generation by photosynthetic bacterial reaction centers through molecular relays, light-harvesting complexes, and direct protein–gold interactions
Mtangi et al. Role of the electron spin polarization in water splitting
Wilker et al. Role of surface-capping ligands in photoexcited electron transfer between CdS nanorods and [FeFe] hydrogenase and the subsequent H2 generation
Ravi et al. Progress and perspectives in exploiting photosynthetic biomolecules for solar energy harnessing
Yehezkeli et al. Generation of photocurrents by bis-aniline-cross-linked Pt nanoparticle/photosystem I composites on electrodes
Benniston et al. Artificial photosynthesis
Operamolla et al. “Garnishing” the photosynthetic bacterial reaction center for bioelectronics
Manocchi et al. Photocurrent generation from surface assembled photosystem I on alkanethiol modified electrodes
Tagliazucchi et al. Ligand-controlled rates of photoinduced electron transfer in hybrid CdSe nanocrystal/poly (viologen) films
Kamran et al. Photosynthetic protein complexes as bio-photovoltaic building blocks retaining a high internal quantum efficiency
Nagy et al. Photosynthetic machineries in nano-systems
CN101935012A (en) Au-DNA (Deoxyribonucleic Acid)-quantum dot composite structure electrode as well as preparation method and application thereof
Han et al. Reversing electron transfer chain for light-driven hydrogen production in biotic–abiotic hybrid systems
Stieger et al. Advanced unidirectional photocurrent generation via cytochrome c as reaction partner for directed assembly of photosystem I
Hu et al. Dual switchable CRET-induced luminescence of CdSe/ZnS quantum dots (QDs) by the hemin/G-quadruplex-bridged aggregation and deaggregation of two-sized QDs
Moroz et al. Competition of charge and energy transfer processes in donor–acceptor fluorescence pairs: calibrating the spectroscopic ruler
Svitkova et al. Functional polymers in photoelectrochemical biosensing
Efrati et al. Electrochemical switching of photoelectrochemical processes at CdS QDs and photosystem I-modified electrodes
Fan et al. Signal-on photoelectrochemical aptasensor for adenosine triphosphate detection based on sensitization effect of CdS: Mn@ Ru (bpy) 2 (dcbpy) nanocomposites
Gao et al. Supersandwich nanowire/quantum dots sensitization structure-based photoelectrochemical “signal-on” platform for ultrasensitive detection of thrombin
Caterino et al. Photocurrent generation in diamond electrodes modified with reaction centers
Riedel et al. Connecting quantum dots with enzymes: Mediator-based approaches for the light-directed read-out of glucose and fructose oxidation
Choi et al. Molecular-scale biophotodiode consisting of a green fluorescent protein/cytochrome c self-assembled heterolayer
Pamu et al. Plasmon-enhanced photocurrent from photosystem I assembled on Ag nanopyramids

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20110105