CN101921751A - Microsatellite marker for screening duck neck length traits and test kit and application thereof - Google Patents
Microsatellite marker for screening duck neck length traits and test kit and application thereof Download PDFInfo
- Publication number
- CN101921751A CN101921751A CN 201010234973 CN201010234973A CN101921751A CN 101921751 A CN101921751 A CN 101921751A CN 201010234973 CN201010234973 CN 201010234973 CN 201010234973 A CN201010234973 A CN 201010234973A CN 101921751 A CN101921751 A CN 101921751A
- Authority
- CN
- China
- Prior art keywords
- microsatellite
- microsatellite marker
- marker
- neck length
- screening
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a microsatellite marker for screening duck neck length traits and a test kit and application thereof. The microsatellite marker is a product obtained by amplifying SEQ ID No.2&3 by primers and the master genotype of the microsatellite marker is shown in SEQ ID No.1. The microsatellite marker and the kit can be used for assisted breeding of ducks and realize quick and accurate assisted screening and have the advantages of early screening, time saving, low cost and high accuracy.
Description
Technical field
The present invention relates to technical field of molecular biology, be specifically related to microsatellite marker, its detection kit and the application of screening duck neck length traits.
Background technology
The generalized molecule marker is meant heritable and detectable dna sequence dna or protein.Molecule marker is the genetic marker based on genetic material inner nucleotide sequence variations between individuality, is the direct reflection of dna level genetic polymorphism.With other several genetic markers--morphology mark, biochemical biomarker, cytological marker are compared, the superiority that dna molecular marker has has: most of molecule markers are codominance, and are very convenient to the selection of recessive character; Genome mutation is extremely abundant, and the quantity of molecule marker almost is unlimited; In the different steps of biological development, the DNA of different tissues can be used for labeled analysis; Molecule marker discloses the variation from DNA; Show as neutrality, do not influence the expression of objective trait, do not have chain with bad proterties; Detection means is simple, rapid.
Microsatellite DNA (Microsatellite DNA) is a kind of new molecule marker that grew up in recent years.Little satellite is called the simple sequence repetition again, and (Simple Sequence Repeats, SSR), generally the flanking sequence by 1-6 the core sequence that trinucleotide repeat sequence constituted and its both sides constitutes.The segmental repeat number of the microsatellite DNA of each microsatellite marker is about several times to tens times.
The microsatellite DNA sequence is present in nearly all Eukaryotic genome, and the transcribed spacer of gene and intron and exon and control region all have the distribution (Huanghai Sea root, 1995) of little satellite.Bibliographical information is arranged, and except that kinetochore and telomere zone, other zone all extensively is dispersed in and is distributed with microsatellite locus (Winter et al., 1992) in karyomit(e).In the different plant species, the content of microsatellite sequence has nothing in common with each other, just there is a microsatellite locus (Tautz et al. in the average every 50-150kb of eukaryote, 1989), there is a microsatellite locus in every interval 6kb in the human genome, there is a microsatellite locus (Primer etal., 1997) in then every interval 20-39kb in the birds genome.And the abundance of various microsatellite sequences also has nothing in common with each other in different plant species.For example, in the mankind and mammal genome, the abundantest microsatellite sequence is (AC) n; In Plant Genome then with (AT) n at most (Wang et al., 1994).In the eukaryotic gene group, the dinucleotides microsatellite sequence is the abundantest, about low 10 times than dinucleotides microsatellite sequence of the sequence content of the little satellite of trinucleotide, the microsatellite sequence of the little satellite of tetranucleotide then less relatively (Ma et al., 1996).
The core sequence of little satellite is not generally transcribed, and transcribes necessary promotor because lack on these extremely simple nucleotide sequences.Flanking sequence makes that a certain little satellite is special to be positioned at chromosomal certain position, the difference of core sequence repeat number is the basis that forms microsatellite polymorphism, because the sequence of not expressing is not subjected to selective pressure, thereby their evolution is more faster than the sequence of expressing, to such an extent as to can accumulate out the sequence polymorphism of significant number in a kind.
Compare with other molecule marker, microsatellite marker has following characteristics: (1) extensively is randomly distributed in the eukaryotic gene group, and exon and intron all have distribution; (2) can detect its polymorphism by pcr amplification according to the conservative property flanking sequence design primer of little satellite both sides; (3) highly polymorphic, the information content height; (4) little satellite flanking sequence conservative property is higher between the species that disengaging time is lacked in the evolution, and as the specificity micro-satellite primers amplification turkey genome of usefulness chickens such as Reed, 54% primer has pcr amplification product (Reed et al., 2000); (5) codominant inheritance; (6) sequence of little satellite is generally shorter, even the DNA of part degraded also has and enough is used for the microsatellite sequence that increases, this point more is better than the VNTR of RAPD and longer target gene sequences, thereby has important use be worth in the research of ancient DNA and medical jurisprudence are identified; (7) along with capillary electrophoresis technique and development of technologies, full-automatic extensive gene type assay has become possibility.Thereby, (Skinner et al. since Skinner in 1974 etc. at first find little satellite, 1974), this mark is widely used in research (Zhang Tianzhen etc., 2001 such as location of organic evolution, genetics evaluation, germ plasm resource analysis and construction of genetic atlas, functional gene and quantitative character; Fan Bin, 1999; Condition is few blue or green, and 1997; Heyen et al., 1997, Schnabel et al., 2000, Rosenberg et al., 2001).
The build appearance of domestic animal is not only the direct sign of certain productivity, and is the appearance reflection of developmental state, healthy state and compactedness, and extremely important meaning is arranged in breeding work.By body measurement, can the identification of species feature and individuality between difference, judge productivity and the economic worth of domestic animal, estimate the biology efficient of domestic animal.And neck length traits is one of economic characters important during livestock industry is produced as important one in the body chi proterties, also is the important indicator in the duck varieties seed selection.
Utilize the linkage relationship between microsatellite marker and some functional gene or QTL, some functional genes or QTL can be positioned in karyomit(e) or the linkage group.Special on the location of quantitative character gene locus therefor, microsatellite marker is expected to the minor-polygene of a certain quantitative character of control poultry is split into different QTL, and navigate to them on the karyomit(e) one by one, by effect and the interaction of analyzing each QTL, may will find more new texture gene and functional gene, perhaps the research to quantitative character also has breakthrough.
Summary of the invention
The purpose of this invention is to provide a kind of microsatellite marker, its detection kit and application that is used for screening duck neck length traits.
Duck enriched microsatellite library and genetic map that utilization of the present invention has made up carry out the location of neck length traits mark-QTL.On the genetic map basis that makes up, use 85 polymorphic label informations that are included in 16 linkage groups, utilize Haley to return interval localization method the F2 resource population is carried out the mark-QTL interval analysis of neck length traits, carry out QTL and detect and Effect Estimation.All analyses are undertaken by online in http://latte.cap.ed.ac.uk website.Analyze and adopt fixed model, consider family, sex, batch three fixed effects, neck length traits is a concomitant variable with the oblique length of body.Model is seen formula:
y＝μ+P(Q|M)[C
aiA+C
diD]+e
Wherein: μ is a population mean;
When P (Q|M) is the known mark genotype, the probability of QTL marker gene type;
C
AiRegression coefficient for i individual additivity component at given seat in the colony;
A is the additive effect of QTL;
C
DiRegression coefficient for i individual dominance component at given seat in the colony;
D is the dominant effect of QTL;
E is the residual error effect.
Found that, by primer SEQ ID No.2﹠amp; The QTL of 3 signs significantly acts on the neck length in 7 ages in week.And then, the invention provides the microsatellite marker that is used for screening duck neck length traits, its nucleotide sequence is shown in SEQ ID No.1.
The present invention further provides the primer of the described microsatellite marker of claim 1 that is used to increase.At primer sequence described in the preferred embodiment of the invention be:
Pf：GAAAGAATGAGTTAAAAAGGCA，
Pr：TGAGGCTTAATTGGTGGACA。
Further, the present invention also provides the test kit that contains above-mentioned primer.This test kit also further comprises one or more in the following reagent: PCR damping fluid, Mg
2+, archaeal dna polymerase, dNTPs.
Microsatellite marker of the present invention and test kit can be used for the assistant breeding of duck, and assisting sifting fast and accurately has early screening, saves time, with low cost, advantage of high accuracy.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is ordinary method.Used test materials among the following embodiment if no special instructions, is to buy from routine biochemistry reagent shop and obtains.% among the following embodiment if no special instructions, is the quality percentage composition.
CAU resource family: the Position Research that is used for of being set up by the Li Ning of China Agricultural University professor seminar influences duck important economical trait QTL, seeks the F2 hybrid experiment colony of cloning major gene, and the parent is a Beijing duck.
The QTL location of embodiment 1, duck neck length traits
It is tiltedly long for the neck length and the body in individual 7 ages in week to measure F2 in CAU resource family, is that concomitant variable is carried out QTL and returned interval positioning analysis with the oblique length of body, and significance is the conspicuous level of Chromosome wide.
Model is seen formula:
y＝μ+P(Q|M)[C
aiA+C
diD]+e
Wherein: μ is a population mean;
When P (Q|M) is the known mark genotype, the probability of QTL marker gene type;
C
AiRegression coefficient for i individual additivity component at given seat in the colony;
A is the additive effect of QTL;
C
DiRegression coefficient for i individual dominance component at given seat in the colony;
D is the dominant effect of QTL;
E is the residual error effect.
QTL returns interval positioning result and shows, 7 age in week neck length be subjected to the influence of No. 12 linkage group QTL.
The distribution in table 1.7 neck length QTL site in all ages
Remarks: " * " expression significantly.
Embodiment 2 microsatellite locus DNA genotype detections
One, fowl blood taking and handling
Collect 15 familys purebred Beijing duck blood sample of about 650 individualities altogether in Changping Nan Kou kind duck factory, the wing venous blood collection, each individuality is taked the 0.5ml blood sample, adds the 0.2ml antithrombotics, fully mixing.After normal temperature is taken back the laboratory, add fowl blood lysate liquid with 1: 9 ratio, normal temperature cracking anticoagulation after 48 hours-20 ℃ of preservations standby.
Two, the extraction of duck genomic dna
(1) gets 0.4ml cracking blood (1ml blood adds 9ml fowl blood lysate liquid) and put into the 1.5ml centrifuge tube, add the TE dilution according to circumstances;
(2) add proteolytic enzyme k to final concentration 200 μ g/ml, mixing, 55 ℃ of water-baths digested 24-36 hour, added Proteinase K according to circumstances, continued digestion;
(3) add the saturated phenol of equal-volume Tris, jog 10mim, the centrifugal 10min of 12000rpm;
(4) supernatant is transferred in the new centrifuge tube;
(5) use isopyknic phenol: chloroform (1: 1) and each extracting of chloroform are once;
(6) upper water is added to 1/10 volumes of acetic acid sodium (pH5.2) and 2 times of volume dehydrated alcohol deposit D NA, and the cotton-shaped DNA to densification about precipitation at room temperature 1min occurs;
(7) choose with the clean first DNA of Tip rifle and put into new centrifuge tube, with 70% washing with alcohol DNA precipitation twice, vacuum is drained the back and is added 100-200 μ l TE (PH8.0) dissolving DNA;
(8) 0.7% agarose electrophoresis Preliminary detection concentration and purity, with each sample DNA concentration dilution to 20ng/ μ l.
Three, utilize test kit to detect the microsatellite locus genotype
This test kit comprises: a pair of primer of pcr amplification, and sequence sees Table sequence in 2; Other pcr amplification reagent; Pcr amplification Taq archaeal dna polymerase and damping fluid thereof.
According to the OTL positioning result, design 5 ' end is marked with the primer of HEX or FAM phosphorous acid acid amides fluorophor, and primer information is as shown in table 2:
Table 2. and the chain microsatellite marker information of neck length traits
PCR reaction system (15 μ l):
Upstream primer (10mM) 0.5 μ l
Downstream primer (10mM) 0.5 μ l
dNTP(10mM) 1.2μl
10×PCR?Buffer 1.5μl
Taq enzyme 0.3 μ l
Template (20ng/ μ l) 2.0 μ l
dd?H
2O 9.0μl
Reaction conditions:
Beginning, 94 ℃ of pre-sex change 5min; The centre, 94 ℃, 30S; 58 ℃, 30S; 72 ℃, 35S; Totally 35 circulations; At last, 72 ℃ are extended 7min, 4 ℃ of preservations.React in 96 orifice plates and carry out, should do negative control.
Four, gene type assay
Deionized water with sterilization dilutes PCR product 3-10 doubly, gets 1 μ l cut back, adds 10 μ l deionized formamides, 0.15 μ l Genescan-350ROX
TMOr Genescan-500ROX
TM, behind the mixing that fully vibrates under 3100 sequenator GS-RUN-36-POP4defaultModule (d system) electrophoresis 36-44 minute.Use Genescan 3.7 and Genemapper1.1 software analysis pcr amplified fragment size.
As a result, the allelotrope number in neck length traits QTL site is 4, and its genotype (repeats (CTTT) shown in SEQID No.1
11Be its core sequence, for isoallele not, the number difference of its CTTT base).
The foundation of embodiment 3, duck microsatellite marker assistant breeding model
From 9 of Beijing Golden Star Duck Center is that 5 batches of the priorities of Beijing duck are selected and remain filial generation and father and mother thereof in advance for colony, and each batch filial generation of selecting and remain in advance all has nearly 100 individualities, and drake accounts for 1/5, and duck accounts for 4/5, ultimate demand respectively half individuality of selecting and remain down.
Utilize existing duck molecule genetics research achievement, the contriver has created the potential aggregate breeding value that a kind of marker-assisted breeding pattern is calculated filial generation, is formulated as follows:
Wherein, the latent gene type effect value in the microsatellite marker site that the offspring that H ' has represented father and mother's generations and different growth traitss are linked, i.e. aggregate breeding value; The economic characters sum of m for considering; N is the sum with the linked mark of a certain proterties j, as with 7 age in week neck length linked be marked with 1; Wj represents the shared weight of a certain economic characters index j, and as being n-1 for neck length w value for emphasis in n the different growth indexes then with reference to neck length traits, other 5 proterties weights are 1, thereby have guaranteed the decisive role of neck length traits; Kji refers to that the microsatellite locus i relevant with certain proterties explains the effect value size to the phenotype of this proterties j, perhaps claims contribution margin; Em1ji, Em2ji, Ef1ji, Ef2ji are respectively for proterties j, respectively from the allelotrope effect value of male parent with i site of female parent, this effect value is to utilize yellow honeysuckle flower (2007a, 2007b) wait a large amount of phenotypes and the genotype data that when QTL locatees, 9 marker sites is write down, by the GLM multiple linear regression analysis among the SAS (considering sex and batch effect), obtain the estimates of parameters (Estimate) of each allelotrope, account for the per-cent of overall estimated value as each allelotrope effect value with each estimated value again phenotype.If there are father and mother to lack in certain loci gene type data, adopt the mean value of each allelotrope effect value to replace when then calculating breeding value for individuality.Potential H ' value is pressed series arrangement from small to large again in the formula calculating gained offspring individuality thus, and the preliminary like this individuality of selecting and remain has obtained a breeding value ordering S2 again.Last two-stage process only need be finished one time, just can be used as the important references standard that each batch children to father and mother generation reserve seed for planting.
Simultaneously, also need each batch neck length data in age in filial generation detail record 7 week of selecting and remain in advance, in order to save feeding cost, carry out preliminary screening earlier according to these determination datas, stay and surpass plan the reserve seed for planting body weight and the bigger individuality of build of number 50% to 100%, and obtain each individual phenotype sequence number S1 that tentatively selects and remain by series arrangement from small to large according to each individual body weight size (emphasis index), so that carry out ensuing marker-assisted breeding screening.Each tentatively select and remain individual phenotype ordering S1 and breeding value ordering S2 have finally been obtained through in the top method.Because the microsatellite marker that is adopted mostly is the balanced mark of the linkage of characters greatly, may separate with QTL in the back of repeatedly going down to posterity, so still assisted correction in conjunction with phenotypic data.Here give S1, weight that the S2 value is identical, it adds and is worth S=S1+S2 and just can be used as the standard of finally reserving seed for planting and selecting.Target is the number of selecting and remain according to schedule, selects the big and S1 of S value, the S2 value approaching individuality of trying one's best, and to fall far short may be to cause with reasons such as QTL separate owing to experimental error or mark for the very big but S1 of S values and S2 individually, do not advise keeping such individuality.Reduce the relationship degree of the colony of reserving seed for planting in addition, avoid inbreeding as far as possible, only keep each one of the sub-duck of male and female for the family full-sibs individuality as far as possible, only keep each two of the sub-ducks of male and female as far as possible, finally finished the whole process of marker-assisted breeding thus for family half sibs is individual.
Whether be improved in genomic level for the Beijing duck progeny population after screening like this, the gene frequency of colony changes before and after can relatively screening.Here lifting 9 is that the 5th batch of progeny selection of Beijing duck result that reserves seed for planting is an example, the frequency shift of each marker site advantage allelotrope (accounting for the allelotrope of maximum specific weight) of progeny population before and after the observation molecular mark and the change of inner allelotrope number are shown in data in the table 3.As seen after the auxiliary seed selection of molecule marker only once, the advantage gene frequency is improved.
9 is the comparison of the 5th crowd of offspring of Beijing duck advantage gene frequency and allelotrope number on marker site before and after table 3. screening
Claims (7)
1. the microsatellite marker that is used for screening duck neck length traits, it is the amplified production of following primer:
Pf：GAAAGAATGAGTTAAAAAGGCA，
Pr：TGAGGCTTAATTGGTGGACA。
2. microsatellite marker as claimed in claim 1, its nucleotide sequence is shown in SEQ IDNo.1.
3. the primer of the described microsatellite marker of claim 1 is used to increase.
4. primer as claimed in claim 2, it is:
Pf：GAAAGAATGAGTTAAAAAGGCA，
Pr：TGAGGCTTAATTGGTGGACA。
5. the test kit that contains claim 3 or 4 described primers.
6. test kit as claimed in claim 5, it also comprises in the following reagent one or more: PCR damping fluid, Mg
2+, archaeal dna polymerase, dNTPs.
7. claim 1 or 2 described microsatellite markers, claim 3 or 4 described primers or claim 5 or 6 application of described test kit in the duck seed selection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010234973 CN101921751A (en) | 2010-07-23 | 2010-07-23 | Microsatellite marker for screening duck neck length traits and test kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010234973 CN101921751A (en) | 2010-07-23 | 2010-07-23 | Microsatellite marker for screening duck neck length traits and test kit and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101921751A true CN101921751A (en) | 2010-12-22 |
Family
ID=43336968
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010234973 Pending CN101921751A (en) | 2010-07-23 | 2010-07-23 | Microsatellite marker for screening duck neck length traits and test kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101921751A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1237328A (en) * | 1999-04-10 | 1999-12-08 | 安徽省农业科学院 | Application of molecular marking technique in quick determination of true or false and purity of hybrid rice seed |
| CN1350590A (en) * | 1999-02-01 | 2002-05-22 | 加拿大纸浆和纸张研究所 | Method for predicting fiber length using QTL's and molecular markers |
-
2010
- 2010-07-23 CN CN 201010234973 patent/CN101921751A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1350590A (en) * | 1999-02-01 | 2002-05-22 | 加拿大纸浆和纸张研究所 | Method for predicting fiber length using QTL's and molecular markers |
| CN1237328A (en) * | 1999-04-10 | 1999-12-08 | 安徽省农业科学院 | Application of molecular marking technique in quick determination of true or false and purity of hybrid rice seed |
Non-Patent Citations (1)
| Title |
|---|
| 《中国农业大学学报》 20091231 马莹等 鸭分子标记辅助育种模型的建立 1-5 1-7 第14卷, 第6期 2 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103667429B (en) | Method of screening silky character of chicken by SNP (Single Nucleotide Polymorphism) detection | |
| CN108103208A (en) | A kind of SNP marker for influencing sheep Fecundity Trait and its application | |
| CN106906303A (en) | One SNP marker for influenceing quality character of pork and its application | |
| CN104878099A (en) | Method for detecting single-nucleotide polymorphism of goat ATBF1 gene and application of goat ATBF1 gene | |
| CN104672315B (en) | Control gene and to Cucumber Roll palpus character related SNP marker of the cucumber without tendril character | |
| CN101705290B (en) | Single nucleotide polymorphism of SCD genes in dairy goat and detection method thereof | |
| CN108411024B (en) | Molecular marker SNP6 coseparating with powdery mildew resistance gene of cucumber-sour cucumber introgression line | |
| WO2006076419A1 (en) | Dna markers for cattle growth | |
| CN104131097B (en) | A kind of method detecting beef cattle UCP3 gene mononucleotide polymorphism and application thereof | |
| CN108866202A (en) | The detection method and its application of Chinese Cattle PLAG1 gene 19-bp repetition deletion polymorphism | |
| CN117106967A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
| CN101921749A (en) | Microsatellite marker linked with duck neck length traits and test kit and application thereof | |
| CN102994643A (en) | Primer and probe for detecting FMO3 gene A1034T mutation of chicken | |
| CN110564867A (en) | SNP molecular marker of Qinchuan cattle CFL1 gene and detection method thereof | |
| CN103695416B (en) | A kind of method and its application for the SNP for detecting Qinchuan Cattle CFL2 genes | |
| CN113278723B (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application | |
| CN101921751A (en) | Microsatellite marker for screening duck neck length traits and test kit and application thereof | |
| CN107287301A (en) | Utilize the molecule labelling method of Nucleophosmin gene selects goat growth trait | |
| CN103031376A (en) | Genetic diagnosis method for detecting different cattle groups at home and abroad | |
| CN114686595B (en) | SNP molecular marker for sex identification of silver dragon fish and application thereof | |
| CN111996276B (en) | SNP molecular marker for identifying cold resistance of Hanfu apple hybrid progeny and application thereof | |
| CN109609674B (en) | Molecular marker for identifying rice chalkiness related gene PPDKB, identification method and application | |
| CN109628609B (en) | Method for detecting 4 repeated deletion polymorphic sites of Chinese cattle PPP2R2B gene and application | |
| CN101921750A (en) | Microsatellite marker linked with body weight traits of 6-week-old ducks and kit and application thereof | |
| CN106609297B (en) | Molecular marker for powdery mildew of pumpkin and primer pair for identifying powdery mildew resistance traits of pumpkin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20101222 |