CN101920010A

CN101920010A - Recombinant attenuation salmonella typhimurium vector vaccine expressing PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) immunogen gene and preparation method thereof

Info

Publication number: CN101920010A
Application number: CN 201010211115
Authority: CN
Inventors: 童德文; 许信刚; 张琪
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2010-06-29
Filing date: 2010-06-29
Publication date: 2010-12-22

Abstract

The invention discloses a recombinant attenuation salmonella typhimurium vector vaccine expressing a PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) immunogen gene and a preparation method and application thereof, and in particular relates to an oral attenuation salmonella typhimurium. The recombinant attenuation salmonella typhimurium has a sequence shown in SEQ ID NO.1, and can express PRRSV cyst membrane protein GP5. The attenuation salmonella typhimurium is inoculated in an LB (Lysogeny Broth) culture medium and cultured for 18h, and the bacterium concentration is regulated to be 1010CFU/ml, therefore, the safe and effective oral attenuation salmonella typhimurium live vector vaccine is prepared and used for preventing PRRS.

Description

Express recombination attenuated salmonella typhimurium carrier vaccine of PRRSV immunogen gene and preparation method thereof

Technical field

The present invention relates to technical field of bioengineering, relate in particular to recombination attenuated salmonella typhimurium carrier vaccine of a kind of PRRSV of expression immunogen gene and preparation method thereof.

Background technology

PRRS (pig breeding and breathing syndrome) is one of deadly infectious disease of the pig that caused by PRRSV (pig breeding and breathing syndrome virus).Classified as category-B zoonosis by World Organization for Animal Health, mainly cause sow breeding difficulty (as miscarriage, premature labor, stillborn fetus, mummy tire) and piglet respiratory symptom.

The PRRS that takes place in the world has two serotypes at present: Europe class and american type.Up to the present China is popular has only american type.Because PRRS mainly is the breeding difficulty that causes sow, thereby caused enormous economic loss for China's pig industry.PRRSV belongs to Arteriviridae, Arterivirus, is the sub-thread positive chain RNA virus of non-segmented negative.Genome is about 15Kb, has infectivity, contains 8 open reading frame (ORF), and wherein GP5 is the main structural protein of PRRSV, also is the main target protein of neutralizing antibody identification, both can induce humoral immunization, but inducing cell immunity again.

Immunity inoculation is the major measure of prevention and control PRRS, and the PRRS commercialized vaccine mainly is inactivated vaccine and two kinds of traditional conventional vaccines of weak malicious Seedling at present.The weak malicious Seedling of PRRSV has advantages such as immune effect is better, immunity is stronger, duration of immunity is long; but weak malicious Seedling is very limited to the protection that attack produced of the bigger allos strain of variation; can not stop strong poison to infect, and exist diffusing poison and potential virulence to return strong probability.Many countries have banned use of weak malicious Seedling, then use inactivated vaccine.But more research report result shows though the protection that inactivated vaccine safety produces is not strong, part protection or unprotect effect are fully only arranged.Inactivated vaccine needs the immunity inoculation of repeated multiple times simultaneously, and immunizing dose is big, and cost is higher, and the very strong variability of many incompatibilities of protection PRRSV of inactivated vaccine generation, and is undesirable to allos strain immune effect.Therefore, safer, efficient, the cheap new generation vaccine of development has become the focus and the important directions of current PRRS research field.

In the prior art, the existing report of PRRSV GP5 gene vaccine that makes up is (referring to 1. " Jilin Agriculture University's journals ", 2007,29 (1): the 91-94 page or leaf; 2. " oral immunity by the porcine reproductive and respiratory syndrome virus _ PRRSV_DNA vaccine of attenuation salmonella mediation is replied ", " the academic nd Annual Meeting collection of 2005 Chinese animal and veterinary association ", 2005), above-mentioned vaccine all belongs to nucleic acid vaccine, needs earlier the GP5 gene clone to carrier for expression of eukaryon for example in the Pires-neo.Yet there are defectives such as the complicated and expression of operation is lower in the carrier for expression of eukaryon system, is difficult to large-scale application.In fact, the problem that the said gene vaccine is bigger is that the antibody horizontal that initial immunity produces is lower, need carry out 2 immunity, even still carry out 2 immunity, Zong antibody horizontal still will be lower than common inactivated vaccine immune level.In addition, according to the report of above-mentioned document " oral immunity by the porcine reproductive and respiratory syndrome virus _ PRRSV_DNA vaccine of attenuation salmonella mediation is replied ", whether oral PRRSV dna vaccination can induce that mucosa-immune is still difficult to be determined.

Therefore, a kind of safer, effective, cheap new high-efficiency PRRSV vaccine of exploitation and be easy to express, preparation method easy and simple to handle has urgent needs in the PRRS research field.

Attenuated salmonella typhimurium can be by adhering to, attack, settle down in gut-associated lymphoid tissue, stimulate body to produce mucosa, cell and humoral immunoresponse(HI) effectively, be to carry antigenic good carrier and natural mucosal adjuvant, be applied to vaccination more and more widely.According to common mucosal immunity theory, with the attenuation salmonella typhi be the oral vaccine made of carrier can be in the oral cavity, mucosal sites such as mammary gland, reproductive tract, lachrymal gland brings out stronger mucosal immunity, and the mode safety of oral vaccination.Particularly recently utilize not with antibiotic and demonstrated good prospects for application as the attenuated salmonella typhimurium carrier vaccine that carrier-host's balanced lethal system of selection pressure makes up.

Summary of the invention

The invention provides a kind of is the oral attenuated salmonella typhimurium live vector vaccine of PRRSV of carrier with the attenuated salmonella typhimurium, can be used as the oral live vector subunit vaccine that prevention PRRS infects.

The recombination attenuated salmonella typhimurium carrier vaccine that provides of the present invention, it comprises PRRSV structural protein GP5, and wherein, above-mentioned antigens subunit GP5 derives from PRRSV Shaanxi separated strain.

The present invention also provides a kind of preparation method of above-mentioned recombination attenuated salmonella typhimurium carrier vaccine, and step comprises:

1) preparation ORF5 gene.Preparation method is: with the PCR method PRRSV Shaanxi strain ORF5 gene that increased, and it is cloned into pGEM-T easy carrier, has made up the pGEM-T-ORF5 plasmid;

2) with above-mentioned ORF5 gene, be inserted into the Ptrc promoter downstream of prokaryotic expression carrier pYA3341, make up the recombinant expression plasmid pYA3341-ORF5 of the ORF5 gene that contains PRRSV;

3) above-mentioned recombinant expression plasmid pYA3341-ORF5 is changed in the first intermediate host bacterium to advance to increase, described first intermediate host's bacterial strain is preferably escherichia coli X6212;

4) change above-mentioned recombinant expression plasmid pYA3341-ORF5 over to the modification that methylates in the seocnd intermediate host bacterium, obtain the recombinant plasmid dna of modifying through methylating.As preferably, described seocnd intermediate host's bacterial strain is preferably attenuated salmonella typhimurium X3730;

5) identify in the step 4) that the correct recombinant plasmid dna of modifying that methylates transforms the final host bacterial strain.The recombinant plasmid dna of modifying that methylates that step 4 is obtained transforms in the final host bacterial strain by electric method for transformation, and abduction delivering obtains recombination attenuated salmonella typhimurium carrier vaccine.The final host bacterial strain is preferably attenuated salmonella typhimurium X4550, and wherein said attenuated salmonella typhimurium X4550 is preferably asd gene defection type bacterial strain.

In addition, above-mentioned preparation method also comprises following authentication step:

6) authentication step 5) in the expression of GP5 in the recombination attenuated salmonella typhimurium carrier vaccine that obtains;

7) detect by the Western immunoblotting, detect the immunogenicity of GP5 in the recombination attenuated salmonella typhimurium carrier vaccine that obtains in the step 5);

8) recombination attenuated salmonella typhimurium carrier vaccine counteracting toxic substances protection experiment;

9) having, carrying out subculture in vitro separately under the situation of no selection pressure and cultivate, identify recombination attenuated salmonella typhimurium carrier vaccine stability.

Specifically, the invention provides a kind of method for preparing pig breeding and breathing syndrome virus live recombinant vectors vaccine: recombinant expression plasmid is cultivated 18h, centrifugal collection thalline after transforming final host bacterium X4550, measure the CFU of reorganization bacterium, the concentration of adjusting the reorganization bacterium makes it reach 10 ¹⁰CFU/ml.Can pass through oral immunity or booster immunization, oral immunity specifically can be: about 1 * 10 ¹⁰CFU//time, each 1～2 week at interval; Booster immunization specifically can be: behind the oral immunity 2～4 times at interval the oral booster immunization of certain hour once, described here one regularly asks on the situation of organism and decide, can be one all or one month etc.Above-mentioned attenuated salmonella typhimurium X4550 is preferably asd gene defection type bacterial strain.

In sum; the proteic recombination attenuated salmonella typhimurium carrier vaccine strain of expression PRRSV GP5 that the present invention has adopted balance-deadly system constructing; and no matter the vaccine strain that makes up has or not selection pressure all can stably cultivate at subculture in vitro separately, has good immunogenicity and immune protective effect by this vaccine of proof behind oral vaccine strains immunization protocol immune mouse and the pig.

Advantage of the present invention and good effect are:

1) successfully makes up recombination attenuated salmonella typhimurium carrier pYA3341-ORF5, can in the host bacterium, express the primary structure Protein G P5 that PRRSV contains viral neutralizing epitope.Recombination attenuated salmonella typhimurium live vector vaccine of the present invention has following advantage: can be oral, and the immune is easy to accept; Can produce antibody fast, and the antibody horizontal that produces is higher; Expressed target antigen does not need purification, can be directly used in the immunoprotection test, the complicated procedures of forming of having removed the protein post processing from; Cheap; Be easy to produce, store and transportation; Can avoid in the prior art expressing the complicated processes and the defective of the separation and purification of system expression destination protein: for example waste time and energy, cost dearly, can not large-scale application in the large-scale production of destination protein etc.

2) to utilize Salmonella typhimurium be that the recombination attenuated salmonella typhimurium that intestinal obtains can stimulate mice to produce effective humoral immunization and cellular immunization in the present invention, excites mucosal immune response especially effectively;

3) this carrier-host's balanced lethal system GP5 albumen of expressing can with PRRSV antibody generation specific reaction.

4) recombination attenuated salmonella typhimurium that obtains of the present invention is safe to laboratory animal, does not have any pathological phenomena.

5) recombination attenuated salmonella typhimurium that obtains of the present invention has the good in vitro hereditary stability, and exogenous gene is not lost after repeatedly going down to posterity.

6) genes of interest used in the present invention is the domestic separated strain of PRRSV (the America strain separates from Shaanxi), thereby the recombination attenuated salmonella typhimurium that makes up can be used as the oral live vector vaccine of China prevention PRRS.

7) prokaryotic expression carrier rather than carrier for expression of eukaryon are gone in the GP5 gene clone, reduced operation easier, improved expression, preparation method is easy to large-scale production.

Description of drawings

Fig. 1 is that recombinant expression plasmid pYA3341-ORF5 makes up flow chart;

Fig. 2 is the clone of PRRSV ORF5 gene; Label declaration among Fig. 2: M is a dna molecular amount standard (Marker), and swimming lane 1 is PRRSV ORF5 gene PCR result (approximately 507bp).

Fig. 3 is that recombinant expression plasmid pYA3341-ORF5 obtains genes of interest through double digestion, shows the construction of recombinant expression plasmid success; Label declaration among Fig. 3: M is a dna molecular amount standard (Marker), swimming lane 1 is PRRSV ORF5 gene PCR result, swimming lane 2 obtains genes of interest-ORF5 through the double digestion qualification result for reorganization recombinant expression plasmid pYA3341-ORF5 through double digestion, and swimming lane 3 is that expression plasmid pYA3341 is through the double digestion qualification result;

Fig. 4 is that recombinant expression plasmid pYA3341-ORF5PCR identifies; Label declaration among Fig. 4: M is that dna molecular amount standard (Marker) swimming lane 1 is recombiant plasmid pYA3341-ORF5PCR qualification result;

Fig. 5 is that the SDS-PAGE of the expression of recombiant protein GP5 analyzes; Label declaration among Fig. 5: M is the molecular weight of albumen standard; Swimming lane 1 is reorganization Salmonella typhimurium pYA3341 analysis of protein, the GP5 protein expression of no 21ku; Swimming lane 2 is reorganization Salmonella typhimurium pYA3341-ORF5 analysis of protein, has expressed the GP5 albumen of 21ku;

Fig. 6 is that the proteic Western blot of reorganization GP5 analyzes; Label declaration among Fig. 6: swimming lane 1 is the GP5 albumen with the reorganization Salmonella typhimurium pYA3341-ORF5 expression of PRRSV positive serum reaction, and 2 is that reorganization Salmonella typhimurium pYA3341 expressed proteins and PRRSV positive serum do not react (negative contrast);

Fig. 7 is mouse spleen, mesenteric lymph node, terminal ileum immunofluorescence testing result, wherein 7A is mouse spleen negative control (* 200), 7B is that immunity back mouse spleen immunofluorescence detects (* 200), 7C is a mice mesenteric lymph node negative control (* 200), 7D is that immunity back mice mesenteric lymph node immunofluorescence detects (* 200), 7E is a mice terminal ileum negative control (* 200), and 7F is that immunity back mice terminal ileum immunofluorescence detects (* 200);

Fig. 8 is the growth curve of reorganization bacterium;

Fig. 9 is the measurement result of anti-PRRSV IgG antibody horizontal in the immune serum;

Figure 10 respectively organizes antibody horizontal statistical analysis figure as a result for behind the pig oral immunity.

The specific embodiment

The present invention utilizes carrier-host's balanced lethal system of pYA3341 to express PRRSV GP5 protective antigen; structure is the PRRSV vaccine of carrier with the attenuated salmonella typhimurium; and immunogenicity and immune protective by animal experimental observation recombinant vector vaccine, provide experimental basis for developing novel PRRSV vaccine.

The present invention is with the PCR method PRRSV Shaanxi strain ORF5 gene (concrete sequence see SEQID NO.1) that increased, and it is cloned into pGEM-T easy carrier, made up the pGEM-T-ORF5 plasmid.Enzyme action pGEM-T-ORF5 plasmid reclaims the ORF5 gene.The ORF5 that reclaims is inserted into the Ptrc promoter downstream of expression vector pYA3341, makes up the recombinant expression plasmid pYA3341-ORF5 of the ORF5 that contains PRRSV; The recombinant expression plasmid that makes up is changed in the host-vector balanced lethal expression system competence escherichia coli X6212, it is cloned in a large number, and carry out the nutrition screening with nalidixic acid.The intermediate host bacterium Salmonella X3730 that recombiant plasmid after the screening changes host-vector balanced lethal expression system once more over to the modification that methylates is carried out the nutrition screening with nalidixic acid equally.The recombiant plasmid of modifying through methylating of screening changes the final host bacterium Salmonella X4550 of host-vector balanced lethal expression system at last over to, and nalidixic acid carries out the nutrition screening.(PCR), enzyme action evaluation, the immune protein marking (western blot) test detect recombinant expression plasmid through the polymerase chain reaction respectively, and screening obtains positive recombinant expression plasmid bacterial strain; With the screening immune respectively BALB/c mouse of positive recombinant expression plasmid bacterial strain and pig and carried out the detection of amynologic index.

The used attenuated salmonella typhimurium X4550 of the present invention has following feature: it is an asd gene defection type antibacterial, because the asd gene is a DAP (meso diaminopimelic acid, the main component of gram-negative bacteria cell wall) essential enzyme in the biosynthesis pathway, the disappearance of this gene can cause the bacteriolyze death under the condition that no exogenous DAP exists of this mutant, thus efficient attenuation.Attenuated salmonella typhimurium can be expressed exogenous antigen, and mucosal route immunity such as per os, nose, rectum can be induced powerful and special immunoreation in mammal.Can settle down at host's small intestinal and gut associated lymphoid tissue not pathogenic and energy stable expression of exogenous gene.Expressed target antigen does not need purification, can be directly used in the immunoprotection test, the complicated procedures of forming of having removed the protein post processing from.

Further set forth the present invention below in conjunction with specific embodiment; these embodiment only provide by way of example; be used for the present invention's preparation method is described in detail; so that more easily understand the present invention; it should be understood that these embodiment only are used to illustrate the present invention, rather than limitation of the present invention; under design prerequisite of the present invention,, all belong to the scope of protection of present invention to the simple modifications of preparation method of the present invention.

Narrate specific implementation method of the present invention below:

The clone of embodiment 1, PRRSV Shaanxi strain ORF5 gene

1.1 primer design

According to the genome sequence of the PRRSV CH-1a strain of delivering (GenBank:AY032626), design 1 pair of Auele Specific Primer (P1/P2).Forward primer P1:5 '-CCG GAATTCGC AGCAAC AAC AGC AGC TCTCA-3 ' 5 ' end adds EcoR I restriction enzyme site, downstream primer P2:5 '-ACG GTCGACCTA GAG ACG ACC CCA TTGTT-3 ', 5 ' end adds the SalI restriction enzyme site.Expection amplification segment is 507bp, contains the complete ORF5 gene that removes signal peptide gene.

1.2 virus genomic extraction

Take out PRRSV SX strain (Shaanxi separated strain) cell toxicant of-80 ℃ of preservations, extract test kit according to Trizol and extract viral RNA.Get RNA and make template 3 μ L, add ORF5 downstream primer P2 1 μ L, dNTP 4 μ L, RNase-Inhibitor 0.5 μ L, AMV 0.5 μ L, 5 * AMV Buffer, 4 μ L, add DEPC H2O to 20 μ L, 42 ℃ of 1h promptly get the cDNA template;

The PCR reaction system is as follows: 10 * PCR Buffer, 5 μ L, dNTPs 4 μ L, P1/P2 each 1 μ L, TaqDNA polymerase 1 μ L, cDNA 6 μ L, add water to 50 μ L.Response procedures: 95 ℃ of degeneration 5min; 94 ℃ of 1min, 56 ℃ of 1min, 72 ℃ of 1min, totally 30 circulations; Last 72 ℃ are extended 10min.Get 10 μ L PCR products after reaction finishes and add 1 μ L, 6 * Loading Buffer in 0.8% agarose gel electrophoresis, analysing amplified product.

1.3 the purification of PCR product and recovery

Give birth to worker UNIQ-10 glue with reference to Shanghai and reclaim test kit description recovery genes of interest.

2. the preparation of bacillus coli DH 5 alpha competent cell (Calcium Chloride Method)

Scrape with the aseptic inoculation ring and to get frozen bacillus coli DH 5 alpha strain in-80 ℃ of refrigerators, streak inoculation is cultivated about 16h for 37 ℃ in the LB agar plate that does not contain ampicillin (Amp).The single bacterium colony of picking, be inoculated in the 100ml LB culture medium, 37 ℃, 250r/min jolting are cultivated OD600=0.4～0.6, under aseptic condition, inoculum transferred in two aseptic and polypropylene centrifuge tubes (following operation all needs aseptic) with the ice pre-cooling, ice bath 10min makes culture be cooled to 0 ℃; 4 ℃, the centrifugal 10min of 2000r/min, abandon supernatant, with the ice-cold 75mmol/L CaCl2 of 10ml, the resuspended precipitation of 10mmol/L (pH6.5) solution, ice bath 10min, 4 ℃, the centrifugal 10min of 2000r/min, abandon supernatant, ice-cold with 2ml, contain 15%v/v) the resuspended every pipe precipitation of 75mmol/L CaCl2,10mmol/L TrisCl (pH6.5) solution of glycerol, competent cell is sub-packed in the aseptic microcentrifugal tube every pipe 200 μ l with aseptic suction nozzle; Indicate bacterial strain, volume and date, it is frozen standby to put-80 ℃ of refrigerators.

3.ORF5 the coupled reaction of genetic fragment and pGEM-T easy carrier

Get 0.5 μ g pGEM-T carrier, the ORF5DNA fragment that adds 3～5 times of moles, 2 μ l 5 * connection buffer adds water and is settled to 10 μ l, add the T4DNA of 1Weiss unit ligase at last, mixing is also centrifugal, 16 ℃ connect 1～4h, get 7 μ l coupled reaction liquid and transform above-mentioned E.coli DH5 α competent cell.

4. transform

(volume: plasmid＜1 μ l connects product＜10 μ l, DNA＜50ng) add in the above-mentioned competent cell of 200 μ l, mixing gently, ice bath 30min will to connect product D NA in right amount; 42 ℃ of water-bath thermal shock 90s, ice bath cooling 2min; The LB culture medium that adds 37 ℃ of preheatings of 200 μ l, 50min is cultivated in 37 ℃ of 150r/min joltings; Get culture fluid and coat the LB agar plate that contains Amp (50 μ g/ml), behind 37 ℃ of cultivation 14～16h, obtain transforming bacterium colony.

5. the extraction of plasmid (alkaline lysis)

The single above-mentioned conversion bacterium colony of picking is inoculated into 2ml and contains in the LB culture fluid (down together) of 50 μ g/ml Amp, and 12～16h are cultivated in 37 ℃ of 250r/min joltings; 1.5ml is changed in the microcentrifugal tube, and the centrifugal 30s of 12000r/min abandons supernatant.Solution I (50mmol/L glucose with the pre-cooling of 200 μ l ice; 25mmol/L TrisCl, pH8.0; 10mmol/L EDTA, pH8.0) resuspended precipitation, add the new preparation of 200 μ l solution II (0.2mol/L NaOH, 1%SDS), put upside down mixing for several times, add the ice-cold solution III of 200 μ l (3molKAc, 5mol/L glacial acetic acid), put upside down mixing, 4 ℃ of centrifugal 10min of 12000r/min, get supernatant, use the saturated phenol/chloroform of equivalent/isoamyl alcohol (25: 24: 1) respectively, each extracting of chloroform/isoamyl alcohol (24: 1) once; Add 2 times of cold dehydrated alcohol of volume, mix homogeneously is put-20 ℃ of 30min, and 4 ℃ of centrifugal 10min of 12000r/min abandon supernatant, and precipitation is drained with 70% cold washing with alcohol.With 20 μ l contain final concentration 20 μ g/ml RNA enzymes (no DNA enzyme) TE (10mmol/L Tri sHCl, pH8.0,1mmol/L EDTA, pH8.0, down with) dissolution precipitation, and in 37 ℃ of water-baths, act on 30min, agarose gel electrophoresis inspection or-20 ℃ of preservations.

6. the enzyme action of recombiant plasmid pGEMT-ORF5 is identified

With 1.0 μ g plasmid DNA and suitable quantity of water mixing, making its cumulative volume is 18 μ l, add 2～3 EcoRI of unit and Sal I restricted enzyme and the corresponding 10 * restriction enzyme reaction buffer of 1 μ l respectively, flick tube wall mixing and centrifugal, put optimal reactive temperature water-bath 2～3h, the agarose gel electrophoresis inspection.The enzyme action result all with estimate identical person, be the purpose recombiant plasmid.Behind the complete degestion ,-20 ℃ of preservations are in order to further identifying or reclaim the usefulness of fragment.

7. carry the structure of PRRSV ORF5 dna recombinant expression vector plasmid

With EcoRI and Sal I double digestion pGEMT-ORF5 plasmid, reclaim the ORF5 gene, be inserted into same expression vector pYA3341 through EcoRI and Sal I double digestion, carry out coupled reaction, make up and contain ORF5 expression carrier pYA3341-ORF5.Concrete building process is as follows:

7.1 preparation " NA " LB flat board

LB fluid medium behind the high pressure steam sterilization (containing 1.5% agar powder) is put in the super-clean bench, and treating to add when its temperature is cooled to 50 ℃ of left and right sides nalidixic acid (NA) to final concentration is that the shop system is dull and stereotyped immediately behind the 20 μ g/mL mixings.

7.2 the preparation (Calcium Chloride Method) of escherichia coli X6212 competent cell

Preparation method with the bacillus coli DH 5 alpha competent cell.

7.3 the coupled reaction of ORF5 genetic fragment and pYA3341 carrier

Get 0.5 μ g pYA3341 carrier, the ORF5DNA fragment that adds 3～5 times of moles, 2 μ l 5 * connection buffer adds water and is settled to 10 μ l, add the T4DNA of 1Weiss unit ligase at last, mixing is also centrifugal, 16 ℃ connect 1～4h, get 7 μ l coupled reaction liquid and transform above-mentioned escherichia coli X6212 competent cell.

7.4 transform

Process is identical with step 4.Get culture fluid and coat the LB agar plate that contains NA (20 μ g/ml), behind 37 ℃ of cultivation 14～16h, obtain transforming bacterium colony.

7.5 the extraction of plasmid (alkaline lysis)

With step 5 method

7.6 the enzyme action of recombiant plasmid pYA3341-ORF5 is identified

With 1.0 μ g plasmid DNA and suitable quantity of water mixing, making its cumulative volume is 18 μ l, add 2～3 EcoRI of unit and SalI restricted enzyme and the corresponding 10 * restriction enzyme reaction buffer of 1 μ l respectively, flick tube wall mixing and centrifugal, put optimal reactive temperature water-bath 2～3h, the agarose gel electrophoresis inspection.The enzyme action result all with estimate identical person, be the purpose recombiant plasmid.Behind the complete degestion ,-20 ℃ of preservations, standby.

8. modification methylates

8.1 the competent preparation of intermediate host bacterium X3730

Adopt electrotransformation to prepare attenuated salmonella typhimurium X3730 competent cell, the whole range request of crossing is finished under aseptic condition.Concrete experimental procedure is as follows:

(1) take out attenuated salmonella typhimurium X3730 from-80 ℃ of refrigerators, hold and thaw, directly dip in aseptic platinum filament and get the X3730 strain in the surperficial streak inoculation of LB flat board (containing 50 μ g/ml DAP), 37 ℃ of constant temperature are inverted and are cultivated 16～18h;

(2) 1 diameter of picking be about 2～3mm single colony inoculation to 4ml LB culture fluid (containing 50 μ g/ml DAP), 37 ℃, the 230r/min constant-temperature shaking culture is spent the night;

(3) culture is seeded in the 50ml LB culture fluid (containing 50 μ g/ml DAP) 37 ℃, 230r/min constant-temperature shaking culture 2～3h in 1: 100 ratio;

(4) take out 100～200 μ l cultures and detect OD600, when OD600 is between 0.8～1.0, culture is placed ice bath 10min, make culture be cooled to 0 ℃;

(5) 4 ℃, the centrifugal 10min of 5000r/min collects thalline, discards culture fluid;

(6) centrifugal with the sterile glycerol washing back of 2～5ml 10%, to repeat 3 times, the sterile glycerol suspension antibacterial with 10% makes about 2 * 1010/ml of bacterial population, and 100～150 μ l/ manage packing, indicate bacterial strain, volume and date, and it is frozen standby to put-80 ℃ of refrigerators.

8.2pYA3341-ORF5 transform the X3730 competence

(1) gets 2～3 μ l pYA3341-ORF5 and join in the X3730 competence antibacterial mixing;

(2) mixed liquor is transferred to immediately in the 0.2cm electricity conversion cup of pre-cooling, blotted electric revolving cup outside water mark, put into the electroporation sample cell then;

(3) conversion condition: Cuvette Gap 0.2cm, Voltage 2.5kV, Field Strengh 12.5kV/cm, Capacitor 25Uf, Resistor 200 Ω, Time Constant 4.5～5.0msec;

(4) after the electric shock, at once take out electric revolving cup, add rapidly in the SOC culture medium of 37 ℃ of preheatings (containing 50 μ g/ml DAP), and bacterium liquid is transferred in the aseptic eppendorf pipe;

(5) 37 ℃, 120r/min jolting are cultivated 45～60min, get 100～150 μ l bacterium liquid and coat LB solid medium (containing 20 μ g/ml NA) surface, and flat board just is being put in 37 ℃ of incubators, treat that culture fluid is absorbed fully after, be inverted and cultivate 16～18h;

(6) from the positive bacteria X3730 that contains recombiant plasmid pYA3341-ORF5 that filters out, extract plasmid.

8.3 obtain the evaluation of the positive reorganization of methylated recombiant plasmid pYA3341-ORF5 bacterium

Because of plasmid copy number in the reorganization salmonella is lower, utilize the PCR method to identify, PCR is identified that correct recon electricity changes among the final host bacterium x4550, method is the same, and identifies that through PCR method and double digestion concrete grammar is with aforementioned method.

9. make up oral live vector vaccine bacterial strain

9.1 the preparation (electrotransformation) of final host bacterium X4550 competent cell

With 8.1 method intermediate host bacterium X3730 preparation methoies

Recombiant plasmid pYA3341-ORF5 transforms X4550 9.2 methylate

The method for transformation of intermediate host bacterium X3730 is with 8.2 methods.Make up empty plasmid bacterium X4550 (pYA3341) as negative control with method.

9.3 the evaluation of positive reorganization bacterium

10. recombination engineering induces

Recombination engineering is inoculated in the 3ml LB culture fluid 37 ℃ of shaking table overnight incubation.Next day with the recombination engineering of incubated overnight in 1% ratio transferred species in 20ml LB culture fluid, 37 ℃ of shaking tables are cultivated (200r/ minute) and are treated OD ₆₀₀=0.8 o'clock, adding IPTG was that 1mmol/L begins to induce to final concentration, in inducing sampling in back 4 hours and measuring its OD600 value, did the empty carrier bacterium simultaneously and induced contrast.

Embodiment 2, SDS-PAGE detect the proteic expression of PRRSV GP5

After reorganization bacterium X4550 (pYA3341-ORF5) and empty plasmid bacterium X4550 (pYA3341) are inoculated in the LB fluid medium that contains 20 μ g/ml NA 37 ℃ of jolting 18h respectively, the centrifugal supernatant of abandoning, collect thalline, after adding the resuspended thalline of 0.01M (pH7.2) PBS solution, add sample Buffer on 5 * albumen, boil 15min, centrifugal collection supernatant carries out the SDS-PAGE electrophoresis in 12% gel.Preparation SDS-PAGE polyacrylamide gel, treat the complete polymerization of gel after, extract sample and comb, blot moisture in the hole with sample hole on the cathode buffer solution for cleaning and with filter paper.Sample to be tested and molecular weight of albumen standard go up sample simultaneously, stop electrophoresis when Coomassie brilliant blue arrives the gel bottom.Gel is fixed 30～60 minutes in fixative, Coomassie brilliant blue is heated to 60 ℃ of dyeing 20 minutes, and destaining solution decolours colourless to background.

UVP scanning analysis electrophoresis result.

Experimental result is found, SDS-PAGE electrophoresis showed ORF5 gene has the expression of higher level in recombinant salmonella X4550, the destination protein band that has molecular mass to be about 21ku occurs, with expection to remove signal peptide GP5 molecular weight of albumen consistent, and this protein band (Fig. 5) does not appear in the matched group bacterium.This experimental result has proved among the recombinant salmonella X4550 (pYA3341-ORF5) can express GP5 albumen.

Embodiment 3, Western immunoblotting detect the proteic immunoreactivity of GP5

Carry out the SDS-PAGE electrophoresis according to the method described above earlier, behind the SDS-PAGE protein isolate, with its electrotransfer to pvdf membrane.5% defatted milk powder or 3% bovine serum albumin buffer (10mmol/L Tri s Cl, pH7.5,150mmol/LNaCl, 0.05%Tween20) 37 ℃ of sealing 2h, lavation buffer solution (10mmol/L TrisCl pH7.5,150mmol/L NaCl, 0.05%Tween20) washing is 3 times, and each 10～15min dilutes the anti-PRRSV positive serum of pig on (1: 300) coverlay with the sealing buffer, 2h is made in the room temperature sense, wash 3～5 times, 2h is made in goat-anti pig IgG (1: 2000) the room temperature sense of horseradish peroxidase-labeled, wash 3～5 times after, each 10～15min, clean once with distilled water at last, press from both sides out pvdf membrane and dry slightly, preparation ECL (enhanced chemiluminescence) working solution, incubated at room film number minute under visible light is stuck blotting membrane and is fixed in X-ray sheet exposure magazine with the preservative film bag.Change the darkroom then over to X-ray film was pressed in the several seconds of exposing on the film by several minutes, protein band can clearly be presented on the X-ray film behind the developing fixing.

Western blot result shows that corresponding proteins band (Fig. 6) is arranged on position, 21ku place, proved that the GP5 albumen of expressing among the recombinant salmonella X4550 (pYA3341-ORF5) can combine with PRRSV positive serum specificity well.

Embodiment 4, the test of reorganization thalline external stability

The thalline that 37 ℃ of shaken cultivation are spent the night is inoculated in the LB culture medium that contains 50 μ g/ml DAP by 10%, continue to cultivate 12h, above-mentioned culture is inoculated in the LB liquid that contains 50 μ g/ml DAP and cultivates 12h by 10% amount again, and so in four generations of continuous culture, are equivalent to thalline and went down to posterity for 100 generations to 50h.With culture dilution 10 ⁶Doubly, get the 100l diluent and be coated with the LB agar plate that contains 50 μ g/ml DAP, after the incubated overnight, 100 single bacterium colonies of random choose, transferred species is on the LB of DAP-agar plate, if plasmid loss, antibacterial can not grow on the LB of DAP-agar plate, measures the stability of recombiant plasmid with this.20 bacterium colonies of picking are heavily cultivated at random, and carry out PCR and enzyme action evaluation, to determine the stability of exogenous gene at the Salmonella typhimurium host expresses.

The stability analysis result shows, each 100 bacterial strain of selection pressure group are arranged in two kinds of reorganization bacterium, and the clump count of growing on the plate that does not contain DAP all is 100.Each is 20 bacterium colonies extractions of picking plasmid at random, shows that 100% contains recombiant plasmid.In no selection pressure group, 100 bacterium colonies of institute's picking after reorganization X4550 (pYA3341-ORF5) and X4550 (pYA3341) bacterium are gone down to posterity, 88 and 85 bacterium colonies of only growing respectively on the plate that does not contain DAP show that DAP dependent/non-dependent antibacterial accounts for 88% and 85%.Therefrom 20 bacterium colonies of picking extract plasmid at random, and showing has 16 and 15 to contain recombiant plasmid respectively, and the positive rate of DAP dependent/non-dependent antibacterial recombiant plasmid is respectively 80% and 75%.

Above-mentioned experimental result explanation relies on the recombinant attenuated Salmonella plasmid of the host range plasmid balanced lethal system protection of asd gene and does not lose external, stablizes at external energy and goes down to posterity.

The mensuration of embodiment 5, reorganization bacteria growing curve

Picking monoclonal X4550 (pYA3341-ORF5) and X4550 (pYA3341) are inoculated in respectively in the LB fluid medium that contains 20 μ g/ml NA, behind 37 ℃ of shaken cultivation 10h, getting 50 μ l is inoculated in 5ml and contains in the 20 μ g/ml LB fluid mediums, 37 ℃ of shaken cultivation, measure the OD600 value every 1h, draw the growth curve of two kinds of bacterium.

Measurement result such as Fig. 8 of reorganization bacteria growing curve, two kinds of reorganization bacterium antibacterials behind inoculation 3h are logarithmic growth as can be seen from Figure 8, and the OD600nm value begins to stablize after 12h.

The measurement result of reorganization bacteria growing curve shows that the growth conditions basically identical of two kinds of bacterium promptly is illustrated in and changes recombiant plasmid in the attenuated salmonella typhimurium over to, does not influence the growth of this bacterium.

The safety testing of embodiment 6, reorganization bacterium

The safety of reorganization bacterium is determined by the oral various dose of BALB/c mouse.Get each 27 of BALB/c mouse, be divided into 3 groups, wherein 2 groups of oral respectively two kinds of reorganization bacterium 1 * 10 ¹²Cfu/, the oral equal-volume PBS of negative control group solution, reaction and survival rate behind the oral bacterial strain of observation mice.

Result of the test, the oral reorganization of BALB/c mouse bacterium X4550 (pYA3341-ORF5) and X4550 (pYA3341) 1.0 * 10 ¹²Behind the cfu 30d, survival rate still is 100%.Compare with the PBS matched group, body weight change does not have significant difference, and does not have untoward reaction such as movable unusual.This shows that recombinant bacterial strain is safe to mice.

Behind embodiment 7, the recombinant vaccine strain oral immunity in the detection of mice spleen, mesenteric lymph node, terminal ileum field planting

The reorganization bacterium with sterile saline washing 1 time, is resuspended in the sterile saline, with every 5 * 10 after the LB culture fluid is cultivated ⁹CFU living bacterial liquid oral immunity BALB/c female mice.Be divided into 6 groups after the immunity at random, 5 every group, after immunity, respectively got 1 group on the 2nd, 7,14,21,28 and 35, aseptic small intestinal, mesenteric lymph node and the spleen got is applied to respectively after the grinding on the LB flat board that contains 20 μ g/ml nalidixic acids, cultivates 18h for 37 ℃, colony counting, statistical analysis.Getting mice spleen, mesenteric lymph node and terminal ileum behind the vaccine immunity carries out the Salmonella immunofluorescence and detects.

Experimental result shows, behind the oral immunity the 2nd day, the reorganization bacterium that mesenteric lymph node and spleen are settled down is still less, and was cumulative subsequently many, do not detect the recombiant vaccine bacterium of settling down to mesenteric lymph node on the 28th, spleen did not detect recombiant vaccine bacterium (referring to table 1) yet on 35th.This shows that this recombiant vaccine can continue to survive in vivo about 28 days, this helps stimulating lastingly the immunne response of body.Immunofluorescence dyeing is the result show, reorganization bacterium X4550 (pYA3341-ORF5) immune group mouse spleen, mesenteric lymph node and small intestinal can be seen stronger fluorescence, reorganization bacterium X4550 (pYA3341) immune group mouse spleen, mesenteric lymph node and small intestinal section do not have fluorescence (Fig. 7), this phenomenon proof reorganization bacterium is settled down in mouse spleen, mesenteric lymph node and small intestinal, and gives expression to GP5 albumen.

Settling down in different tissues behind table 1 reorganization bacterium X4550 (pYA3341-GP5) oral immunity

Embodiment 8, recombination attenuated salmonella typhimurium X4550 (pYA3341-ORF5) mouse immuning test

1, immune mouse

15 of BALB/c female mices, body weight 18～20g divides 3 groups at random, takes the oral immunity mode.Before the mice oral vaccination, overnight fasting is prohibited water 4～6h.Earlier with 10% NaHCO3 solution 100 μ l irritate stomach with in and gastric acid, irritate respectively 100 μ l (1 * 10 of stomach immunity X4550 (pYA3341-ORF5) bacterium liquid, X4550 (pYA3341) bacterium liquid and PBS behind the 30min respectively ⁹Cfu/100 μ l bacterium liquid), above-mentioned 3 groups of equal immune secondaries, 14 days at interval.

2, T lymphocyte increment test

(1) preparation of splenocyte: mice is put to death in the cervical vertebra dislocation, and aseptic condition takes out spleen down, places the plate that fills the RPMI1640 culture medium, grinds with slide, and 200 order nylon net filters are made single cell suspension, 1500r/min, and centrifugal 5min abandons supernatant.Use the centrifugal cell twice of washing of Hank ' s liquid, be resuspended in the RPMI RPMI-1640 that contains 10%NBS, counting transfers to 2 * 10 ⁶Individual/ml is standby.

(2) every hole adds lymphocyte suspension 100 μ l in 96 orifice plates, adding the former ConA of differential stimulus (10 μ g/ml) 100 μ l in the corresponding aperture respectively is that test group and 1640 culture medium, 100 μ l are non-stimulator antigen hole as positive controls, the former 100 μ l of 20 μ g/ml recombinant baculovirus differential stimuluses, 3 holes of the former repetition of different stimulated; One adds 200 μ l1640 culture medium and does not have lymphocytic hole as background.

(3) behind the 68h, every hole adds MTT (5mg/ml) 20 μ l, and lucifuge is cultivated 4h; Every hole is inhaled and is abandoned 100 μ l culture fluid, adds DMSO 100 μ l again, measures a hole OD value with enzyme-linked immunosorbent assay instrument 630nm in the 10min.

(4) result calculates: SI=(average OD value-background values that special stimulation is former)/(average OD value-background values that non-stimulation is former)

Experimental result, stimulation index (SI with each group of the stimulating group A value representation of stimulating group A value/not, table 3), meansigma methods is charged to table 2, SPSS software analysis result shows that the SI value of X4550 (pYA3341-GP5) immune group and PBS group and X4550 (pYA3341) immune group all have significant difference (P＜0.05).

This result proves that X4550 (pYA3341-ORF5) vaccine strain can produce cellullar immunologic response by the induced animal body, has the good cell immune effect.

Table 2T lymphproliferation response stimulation index

3, ELISA measures anti-PRRSV IgG antibody in the immune serum

Envelope antigen in the ELISA test kit is the PRRSV totivirus of deactivation, and two anti-are the sheep anti-mouse igg antibody of horseradish peroxidase-labeled.Measure each hole OD value at enzyme linked immunological instrument 492nm/630nm, be judged to the positive with P/N＞2.1.

Respectively organize behind the mice oral immunity antibody horizontal as a result statistical analysis see Fig. 9.The result shows, oral immunity X4550 (pYA3341-Tsol18) mice produces anti-GP5 specific antibody after immunity, and antibody horizontal progressively rises, and exempts from back 4 all antibody horizontals two and reaches the highest, antibody titer can reach about 1: 1250, and two exempt from back 6 all antibody water descends to some extent.The antibody horizontal of immune matched group of X4550 (pYA3341) and the non-immune matched group of PBS does not have obvious variation (referring to accompanying drawing 9).

The above results proof X4550 (pYA3341-ORF5) vaccine strain can produce corresponding antibody by the induced animal body, has extraordinary immune effect.

4, serum neutralization test

Adopt the method for fixed virus dilute serum, PRRSV is with 200 TCID ₅₀/ 50 μ L, serum make continuous 2 times of doubling dilutions.Set feminine gender, positive serum and normal cell contrast simultaneously.The result of neutralization test is not to produce the NAT of the high dilution of cytopathic serum as this part serum.

Result of the test shows, in the serum of reorganization bacterium X4550 (pYA3341-GP5) immune mouse and titre be 1: 16, the blank group of reorganization bacterium X4550 (pYA3341) immune group and the PBS mice serum activity that do not neutralize, in each serum and activity the results are shown in Table 3.

The active testing result of the neutralization of table 3 serum antibody

A large amount of preparations of embodiment 9, recombination attenuated salmonella typhimurium X4550 (pYA3341-ORF5) immune swine test 1 reorganization bacterium X4550 (pYA3341-ORF5) and X4550 (pYA3341)

Single colony inoculation that picking is 1 is to 4ml LB fluid medium (containing 20 μ g/ml NA), and 37 ℃, 230r/min constant-temperature shaking culture spend the night; Respectively culture is seeded in the 50mlLB fluid medium (containing 20 μ g/ml NA) 37 ℃, 230r/min constant-temperature shaking culture 3～4h in 1: 100 ratio; Respectively culture is seeded in the 1000ml LB fluid medium (containing 20 μ g/ml NA) 37 ℃, 230r/min constant-temperature shaking culture 15～16h in 1: 100 ratio; 4 ℃, the centrifugal 10min of 5000r/min collects thalline, discards culture fluid; With the resuspended precipitation of 100ml sterilization PBS, make bacterial population about 10 ¹⁰Cfu/ml.

The grouping of 2 laboratory animals and oral vaccination

Test pig is divided into three groups at random, every group 5, each organizes the experiment pig oral immunity, immunization method is as follows: before the pig oral vaccination, overnight fasting, prohibit water 4～6h, before the immunity earlier with 10% NaHCO3 solution 100ml irritate stomach with in and gastric acid, irritate X4550 (pYA3341-GP5) bacterium liquid, X4550 (pYA3341) bacterium liquid and each 50ml (1～2 * 10 of PBS that the stomach immunity prepares in a large number behind the 30min respectively ¹¹Cfu/50ml bacterium liquid), 2 immune intervals are 14 days.

18.3 the detection of anti-PRRSV GP5 antibody horizontal in the experiment pig serum

Indirect elisa method is measured the OD of serum antibody ₄₉₀Value.Envelope antigen in the ELISA test kit is the PRRSV totivirus of deactivation, and two anti-are the anti-pig IgG antibody of rabbit of horseradish peroxidase-labeled (diluting at 1: 3000).Respectively at taking a blood sample and separation of serum in each immunity 2 weeks of back from vena cava anterior.With the anti-GP5 antibody titer of indirect ELISA method test experience porcine blood serum, with porcine blood serum OD to be checked ₄₉₀/ negative serum OD ₄₉₀Meansigma methods 〉=2.1 (P/N＞2.1) are judged to be the positive, get geometric mean on average tiring for this group experiment pig antibody on the same group between the Different Individual.

Respectively organize behind the pig oral immunity antibody horizontal as a result statistical analysis see Figure 10.The result shows, oral immunity X4550 (pYA3341-ORF5) pig produces anti-GP5 specific antibody after immunity, and antibody horizontal progressively rises, and exempts from back 4 all antibody horizontals two and reaches the highest, antibody titer can reach about 1: 250, and two exempt from back 6 all antibody water descends to some extent.The antibody horizontal of immune matched group of X4550 (pYA3341) and the non-immune matched group of PBS does not have obvious variation.

This experimental result proof X4550 (pYA3341-ORF5) vaccine strain can induce the pig body to produce corresponding antibody by effective stimulus, has good immune effect.

Body temperature changes behind 3 test pig counteracting toxic substances approach and dosage and the counteracting toxic substances

In two exempt from 6 weeks of back to hog snout in inoculation PRRSV SX strain (1 * 10 ^5.5TCID ₅₀/ 0.1mL), dosage is every pig 5mL.Observe the clinical manifestations such as appetite, spirit, digestion, breathing of pig behind the counteracting toxic substances every day, measured rectal temperature in per two days, observe the variation of animal heat behind the counteracting toxic substances.

Counteracting toxic substances is the result show, behind the counteracting toxic substances 7 days, PBS immunity matched group has the body temperature of 4 contrast pigs to be raised to more than 41 ℃, reach 41.5 ℃, 41.4 ℃, 41.2 ℃ and 41.7 ℃ respectively, X4550 (pYA3341) group has 3 temperature of pig body to reach 41.4 ℃, 41.7 ℃, 41.6 ℃ and 41.5 ℃, and the body temperature of two groups of pigs all disappears to below 40 ℃ after 14 days.The body temperature amplitude of variation is little in the whole process of pig of X4550 (pYA3341-ORF5) immune group.Cough, sneezer are arranged in the experimental animal once in a while, but significantly respiratory symptom such as dyspnea does not all take place, also do not have the symptom that ear turns blue in the experimental animal.

Conclusion: X4550 (pYA3341-ORF5) immune group pig can be resisted the attack of the wild poison of PRRSV, and body temperature is acted normally.

The detection of immune swine viremia behind 4 counteracting toxic substances

1,2,3,4,5,6 weeks behind preceding 0 day of counteracting toxic substances and counteracting toxic substances, gather the vena cava anterior blood of respectively organizing pig, separation of serum extracts viral RNA according to 1.2 described methods, with 1.2 described methods at the primer of PRRSV SX strain ORF5 to carrying out RT-PCR, detect the PRRSV nucleic acid in the serum.

Result of the test sees Table 4, RT-PCR detects the viremia in the serum, 1 week all can be examined PRRSV nucleic acid behind the counteracting toxic substances in the serum of each immune group and matched group, X4550 (pYA3341-ORF5) immune group PRRSV recall rate is 30%, X4550 (pYA3341) immune group and PBS immune group PRRSV recall rate are respectively 80% and 80%, and the PRRSV recall rate of X4550 (pYA3341-ORF5) immune group is starkly lower than this two matched groups.

The viremia positive rate drips in matched group behind conclusion: X4550 (pYA3341) the immune group counteracting toxic substances, illustrates that virus survival quantity in these immune animal bodies is few, shows that X4550 (pYA3341-ORF5) Salmonella has good immunoprotective effect.

Table 4 dyes the toxemic PCR testing result of swine diseases

Sum up

The reorganization bacterium X4550 (pYA3341-ORF5) that obtains extracts the laggard performing PCR amplification of genome, must expect the purpose fragment of size.Enzyme action is identified and order-checking is proved conclusively and Western blot detection is positive findings, illustrates that the recombinant expression carrier pYA3341-ORF5 that makes up can express PRRSV glycoprotein GP5 envelope protein.Recombinant expression carrier pYA3341-ORF5 can express in the final host bacterium X4550 of attenuated salmonella typhimurium, and confirms that through the vitro characteristics test recombinant expression plasmid pYA3341-ORF5 has good external hereditary stability; Reorganization bacterium X4550 (pYA3341-ORF5) has good growth characteristics and safety.Carry out the mouse immune experiment after a large amount of amplifications of the bacterium X4550 (pYA3341-ORF5) that will recombinate, can in immune serum, detect the antibody of anti-PRRSV, show that reorganization bacterium X4550 (pYA3341-ORF5) stimulates the mice body to produce specific humoral immunity.Immune mouse lymphocyte proliferation assay result shows that all mice has produced specific cellular immunity.The various amynologic index that detect in this genus animal pig body are similar with mice detection index.Result of study shows that the constructed recombination attenuated salmonella typhimurium of the present invention is a kind of safe and effective oral live vector vaccine, has the good prospect that exploitation becomes the vaccine that is used to prevent PRRS.

The above embodiment is the preferred embodiment that proves absolutely that the present invention lifts, and protection scope of the present invention is not limited thereto.Being equal to that those skilled in the art are done on basis of the present invention substitutes or conversion, all within protection scope of the present invention.

Sequence table

SEQUENCE?LISTING

＜110〉Xibei Univ. of Agricultural ﹠ Forest Science ﹠ Technology

＜120〉recombination attenuated salmonella typhimurium carrier vaccine of expression PRRSV immunogen gene and preparation method thereof

<130>1

<160>2

<170>PatentIn?version?3.5

<210>1

<211>507

<212>DNA

＜213〉porcine reproductive and respiratory syndrome virus removes to stride film district ORF5 gene (Porcine reproductiveand respiratory syndrome

virus?deleting?transmembrane?region?ORF5?gene)

<400>1

agcaacaaca?acagctctca?tattcagttg?atttataact?taacgctatg?tgagctgaat 60

ggcacagatt?ggctggcaca?aagatttgac?tgggcagtgg?agacttttgt?catcttcccc 120

gtgttgactc?acattgtttc?ctatggggca?ctcaccacca?gccatttcct?tgacacagtt 180

ggtctggcca?ctgtgtccac?cgccggatat?tatcacaggc?ggtatgtctt?gagtagcatt 240

tacgcagtct?gtgctctggc?tgcgctgatt?tgctgtgtca?ttaggcttgc?gaagaactgc 300

atgtcctggc?gctactcttg?taccagatat?accaacttcc?ttctggacac?taagggcaga 360

ctctatcgtt?ggcggtcgcc?cgtcattgtg?gagaaagggg?gtaaggttga?ggtcgaaggt 420

cacctgatcg?acctcaagag?agttgtgctt?gatggttccg?tggcaacccc?tttaaccaga 480

gtttcagcgg?aacaatgggg?tcgtctct 507

<210>2

<211>31

<212>DNA

＜213〉the amplification PRRSV of synthetic removes to stride forward primer sequence (the The synthetic upstream primer of film district ORF5 gene

amplifying?porcine?reproduct?ive?and?respiratory?syndrome?virus?deleting?transmembrane?region?ORF5

gene)

<400>1

ccggaattcgcagcaacaacagcagctctca

<210>3

<211>29

<212>DNA

＜213〉the amplification PRRSV of synthetic removes to stride downstream primer sequence (the The synthetic downstream of film district ORF5 gene

primer?amplifying?porcine?reproduct?ive?and?respiratory?syndrome?virus?deleting?transmembrane?region

ORF5?gene)

<400>1

acggtcgacctagagacgaccccattgtt

Claims

1. a recombination attenuated salmonella typhimurium carrier vaccine is characterized in that comprising PRRSVGP5 antigen subunit, and described recombination attenuated salmonella typhimurium has the sequence shown in SEQ ID NO.1.

2. recombination attenuated salmonella typhimurium carrier vaccine according to claim 1 is characterized in that described antigen subunit derives from separation America strain PRRSV.

3. method that produces the PRRS immunne response in animal body, described method comprise and give animal with each described recombination attenuated salmonella typhimurium carrier vaccine among the claim 1-2 in the mode of oral vaccination.

4. the method that produces the PRRS immunne response in animal body according to claim 3 is characterized in that described animal is artificial cultivation pig or wild boar.

5. the method that produces the PRRS immunne response in animal body according to claim 4 is characterized in that described artificial cultivation pig or wild boar are sow or piglet.

6. the application of the described recombination attenuated salmonella typhimurium carrier vaccine of claim 1 in the medicine of preparation prevention or breeding of treatment pig and breathing syndrome (PRRS) disease.

7. the preparation method of the described recombination attenuated salmonella typhimurium carrier vaccine of claim 1 is characterized in that may further comprise the steps:

1) obtains PRRSV GP5 gene by PCR method;

2) the GP5 gene is connected with prokaryotic expression carrier pYA3341, obtains recombinant expression plasmid pYA3341-ORF5.

3) recombinant expression plasmid transforms first intermediate host's bacterial strain, obtains recon;

4) recon transforms seocnd intermediate host's bacterial strain, identifies positive recombinant;

5) identify in the step 4) that correct positive recombinant transforms the final host bacterial strain;

6) abduction delivering obtains recombination attenuated salmonella typhimurium carrier vaccine.

8. preparation method according to claim 7 is characterized in that the final host bacterial strain described in the step 5) is asd gene defection type attenuated salmonella typhimurium X4550.