CN101906158B - Pegylation hypoglycemic polypeptide and preparation method and application thereof - Google Patents

Abstract

The invention discloses pegylation hypoglycemic polypeptide. The pegylation hypoglycemic polypeptide has an amino acid sequence as shown by the sequence 1 (SQDID NO:1): His-Gly-Glu-Gly-Xaa1-Phe-Thr-Ser-Asp-Leu-Ser-Xaa2-Xaa3-Xaa4-Glu-Glu-Glu-Ala-Va1-Xaa5-Leu-Phe-I le-Glu-Trp-Leu-Xaa6-Xaa7-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Xaa8; and a side-chain hydrosulfide group of C-terminal amino acidXaa8 of the hypoglycemic polypeptide is in covalent linkage with polyethylene glycol. The GLP-1 receptor stimulating agent activity of the pegylation hypoglycemic polypeptide is higher than that of aGLP-1 prototype molecule. A peptide sequence of the molecule does not contain recognition sites of dipeptidyl peptidase and neutral peptidase and has high stability. Besides, due to the masking action of the polyethylene glycol, the immunogenicity of a modified peptide molecule is basically eliminated, and when the polyethylene glycol of which the molecular weight is over 20 kDa is adopted to perform modification, the pharmacokinetic half-life of the pegylation hypoglycemic polypeptide can be over 48 hours.

Description

A kind of Pegylation hypoglycemic polypeptide and method for making thereof and purposes

Technical field

The present invention relates to a kind of purposes of Polypeptide-k and conduct treatment diabetes medicament thereof of Pegylation.

Background technology

Diabetes are metabolic troubles of a kind of multi-pathogenesis, and characteristics are chronic hyperglycemias, follow because of insulin secretion and/or effect the defective sugar, fat and the protein metabolism disorder that cause.Can simply diabetes be divided into two kinds on a type and two types.Wherein type diabetes are insulin-dependents; Type-II diabetes is the Regular Insulin independent form.In numerous onset diabetes persons, the ratio of type-II diabetes accounts for 90%-95%.

The sickness rate of diabetes has the trend that raises year by year.The sickness rate that WHO statistics draws present diabetes is 2.8%, and expects the year two thousand thirty this numerical value and will increase to 4.8%.U.S. CDC P reports that present diabetic subject accounts for 6.8% of the whole America population, and wherein 90-95% is the type-II diabetes patient.Along with increasing the weight of of growth in the living standard and aging, China diabetic subject's quantity is in continuous increase.Have statistic data to show, China has nearly 10% grownup to suffer from diabetes at present, although wherein the people more than 60% not yet proves conclusively (New England Journal of Medicine, the 362nd volume, the 12nd phase, the 1090th page).The data prediction that carries weight again will occupy first in the whole world to the year two thousand thirty diabetes mellitus in China patient's quantity.

Diabetes all are that harm is huge to patient individual or entire society.For patients, just need lifelong medication with control blood sugar in case fall ill, quality of life is subject to very big impact.This disease is gradual, often has the generation of complication.The harm of diabetic complication is larger, and Nephropathy wherein, cardiovascular disorder and cerebrovascular disease etc. all are fatefulue.For entire society, diabetes consumption is very big.There is prediction to show, will reaches 43,200,000,000 dollars to the year two thousand thirty consumption of China's every year on diabetes and complication thereof.

To the treatment of type-II diabetes, existing multiple ofhypoglycemic medicine exists clinically at present.But, many diabetics can not by use existing ofhypoglycemic medicine with glycemic control within safety range.So researching and developing novel more safe and effective treating diabetes medicine is that the utmost point is necessary.

Incretin is the general designation that can be played the polypeptide of hypoglycemic activity after the human body feed by a class of intestinal secretion, mainly comprises insulinotropic peptide (GIP) and glucagon-like-peptide-1 (GLP-1) the two large classes of dependence on the glucose.Wherein, GLP-1 is the dependent endogenous Polypeptide-k of a kind of blood sugar of intestinal epithelial cell secretion.When glucose level was higher in the body, GLP-1 was by activating G albumen with the acceptor coupling with its receptors bind, then activated adenyl cyclase, and the signal transduction pathway that relies on by cyclic monophosphate promotes insulin secretion to bring into play hypoglycemic activity.Because the hypoglycemic activity of GLP-1 has the blood sugar dependency, this molecule brings out hypoglycemic risk when being used for the type-II diabetes treatment extremely low.GLP-1 can also glucagon suppression generation, can be used for the assisting therapy of type diabetes.In addition, this molecule can also promote beta Cell of islet propagation and differentiation, suppress islet beta-cell apoptosis, plays an important role in the long-term treatment of diabetes.These effects are so that GLP-1 becomes the ideal medicament candidate molecules for the treatment of diabetes, but the GLP-1 prototype molecule fails to be applied to clinical always for many years, this mainly be because GLP-1 in vivo action time extremely short, plasma half-life not enough 2min, cut away 2 amino acid and inactivation by endogenic dipeptidyl peptidase (DPP4) from N-terminal rapidly behind the intravenously administrable, and the fragment GLP-1 that produces behind the enzymolysis (9-36) is the antagonist of natural GLP-1, has further suppressed the effect of GLP-1.Therefore, GLP-1 is carried out deep structure activity relationship analysis, by molecular designing with change structure, seek more stable, the GLP-1 analogue becomes focus and the difficulties in diabetes medicament research and development field efficiently.

To the exploration of GLP-1 efficient stable analogue, existing a large amount of bibliographical information and patent applications.Publication number is that CN1703424A's the patent document of " GLP-1 derivative and through the preparation of mucosal absorption " discloses at C-terminal and inserts Methionin or the structure of arginic GLP-1 derivative, and its purpose is so that GLP-1 has oral validity.Publication number is preparation method and the application thereof that CN1281369A's the patent document of " Glucagon-like peptide-1 crystals " discloses a kind of GLP-1 crystal, and its purpose is so that crystal formulations prolongs action time in vivo.Publication number be CN1311687A's the patent document of " glucagon-like peptide 1 improves the glucose intolerance person's body in β cell replying glucose " composition that contains GLP-1 and analogue thereof disclosed be used in the person's body that improves the glucose intolerance β cell to the effect of replying of glucose.Publication number is that CN1363654A's the patent document of " producing the genetic engineering bacterium of insulinotropic peptide GLP-1-1 (7-36) and the method for producing GLP-1 (7-36) " discloses a kind of recombination and preparation of GLP-1 (7-36), and the method improves its restructuring and prepares yield by GLP-1 (7-36) being carried out many tandem expression.The described GLP-1 of this document (7-36) is GLP-1 prototype molecule structure.Publication number is the purposes that is used for ischemia injury and reperfusion injury thereof that CN1376072A's the patent document of " function of utilizing glucagon-like-peptide-1 or its bioactive analogue metabolism to get involved to improve ischemia and pour into brain again " discloses GLP-1 and analogue thereof.Publication number is that CN1468258A's the patent document of " glucagon-like peptide-1 analogs " discloses molecular structure of serial GLP-1 analogue and preparation method thereof.Its purpose is to improve the stability of GLP-1 in the aqueous solution by Amino Acid-Induced Site-Directed Mutation, changes the characteristic that it is easy to assemble.Publication number is the molecular structure that CN1483041A's the patent document of " GLP-1/mTf " discloses serial GLP-1/mTf, be included in the C-terminal fusion human serum albumin of GLP-1 or the FC of immunoglobulin (Ig) etc., its purpose is to improve the stability of GLP-1 in human body.Publication number is that CN1495198A's the patent document of " analogue of glucagon-like-peptide-1 " discloses serial analogs of GLP-1 and uses thereof, this serial analogs mainly is the approach acquisition by Amino Acid-Induced Site-Directed Mutation, and its purpose is to strengthen the stability of GLP-1 in human body.Publication number be CN1832959A's " polyoxyethylene glycol connect GLP-1 compound " the polyoxyethylene glycol chemoattractant molecule of serial GLP-1 and analogue thereof is disclosed, its main purpose is to modify by the polyoxyethylene glycol chemistry to prolong GLP-1 action time in vivo.Publication number be CN1951965A's " GLP-1 derivative " molecular structure of the GLP-1 analogue of lipophilic substituent derivatize is disclosed, its purpose is to prolong GLP-1 action time in vivo by this derivatize.Publication number be CN1982336A's " a kind of glucagon-like peptide-1 derivatives and preparation thereof and application " structure of serial GLP-1 analogue is disclosed, mainly be to add specific amino acids by the C-terminal at GLP-1 to reach with it and prolong the GLP-1 purpose of action time.Publication number be CN1524516A's " Glucagon-Like Peptide-1 Slow-Release Formulations and Use of Microspheres " the sustained-release micro-spheres formulation of GLP-1 is disclosed, its purpose is to prolong its transformation period by GLP-1 being made sustained-release micro-spheres.Publication number be CN1927888A's " recombinant protein of GLP-1 and analogue thereof and human lysozyme fusion and uses thereof " molecular structure of the fusion rotein of a kind of GLP-1 and N,O-Diacetylmuramidase is disclosed, its purpose is so that this fusion rotein has certain anti-microbial effect when having hypoglycemic activity.Publication number be CN1910201A's " glucagon-like peptide-1 analogs with long duration of action " molecular structure of serial GLP-1 analogue is disclosed, mainly be that the molecular structure that method by Amino Acid-Induced Site-Directed Mutation changes GLP-1 reaches the purpose that prolongs its action time with it.Except the above file, also has other in a large number about bibliographical information and the patent application of GLP-1 and analogue structure of modification thereof.Mostly its purpose is to improve by structure of modification the pharmacodynamic properties of GLP-1.

Above file is carried out analysis-by-synthesis as can be known, and mainly there are following 4 approach in the structure of modification with regard to GLP-1 and analogue thereof at present.The first, the method for modifying by Amino Acid-Induced Site-Directed Mutation or side chain has the effect of resisting enzymolysis so that change the GLP-1 of structure.The second, so that the stability of GLP-1 improves, prolong action time by chemically modified.The 3rd, the fusion rotein that the technique means by protein engineering makes up through engineering approaches is to prolong GLP-1 and analogue action time in vivo thereof.The 4th, prolong GLP-1 and the transformation period of analogue in human body thereof by dosage form design.

By above-mentioned approaches and methods, a lot of researchs have obtained the GLP-1 analogue that prolong action time in plurality of stable raising, the body.This seminar has also obtained to resist the GLP-1 analogue (World Journal of Microbiology and Biotechnology, DOI:10.1007/s11274-010-0345-3) of enzymolysis by the technology of Amino Acid-Induced Site-Directed Mutation in former studies.Theoretically, the GLP-1 analogue that obtains to prolong action time by structure of modification has just solved the problem of this a part of GLP-1, but in fact is far from so.Also there is other variety of problems in the modifier polypeptide when the resistance to enzymolysis ability improves.

Also there is following problem in this type of structure of modification when improving GLP-1 resistance to enzymolysis ability.The first, structure of modification has significantly reduced the vigor of polypeptide as the GLP-1 receptor stimulant when improving polypeptide resistance to enzymolysis ability.For example, publication number is that the agonist activity of the V8I22E33C40-40kDa PEG (CEX-51) described in the patent document of CN1832959A only is about 9.4% of V8GLP-1.In fact, V8GLP-1 just descends to some extent as the vigor of agonist itself, the agonist activity that bibliographical information V8GLP-1 arranged only for the GLP-1 prototype molecule about 26.7% (European Journal of Medicinal Chemistry, 2004,39:473).So calculate, CEX-51 only is about 2.6% of GLP-1 prototype molecule as the vigor of GLP-1 agonist.The second, there is certain immunogenicity in the polypeptide that changes behind the structure, adds that this polypeptide needs prolonged and repeated multiple dosing in treating diabetes, and it is especially serious that immunogenic problem becomes.The 3rd, there are problems (for example adopting fatty acid modifying can cause water-soluble reduction) in modifier or Isoforms peptide molecule that a lot of structure of modification obtain in physico-chemical property.The 4th, the time length of blood sugar reducing function still fall short of (Half-life in vivo of the Exendin-4 that has for example gone on the market also only is about 2.4 hours) in a lot of modifier polypeptide bodies.

This seminar is being engaged in the extremely molecule allosteric work of analogue of GLP-1 always.In nearest research work, this seminar has carried out Simulation and analysis by the technique means of computer-aided analysis to the space structure of GLP-1 and analogue thereof and with the mode of action of GLP-1 acceptor, find that there are two interactional phenomenons of structure fragment in GLP-1 and analogue thereof with receptor acting the time, wherein the αhelix of N-terminal has played critical effect, and the α spiral of C-terminal has also played certain effect in molecular recognition.This point also in previous literature report, had relevant report (British Journal of Pharmacology, 2003,140:339).The α spiral is the chief component of GLP-1 secondary structure, this structure is from the N-terminal of GLP-1, derive the 35th amino acids to its C-terminal, this has directly caused, and the 7th, 8,9,10,12,13,19,21,28,29 amino acids all are that the active institute of performance is essential in its sequence always.When being transformed or be modified at the raising polypeptide stability, above-mentioned amino acid inevitably can produce certain reducing effect to its vigor.Publication number is that the CEX-51 described in the patent document of CN1832959A carries out chemically modified at this modifier peptide molecule of V8I22E33C40, the polypeptide itself that changes behind the structure just has very big reduction as the activity of GLP-1 receptor stimulant, and PEG modifies has then further increased the sterically hindered of modifier polypeptide.Finally, the structure that changes of two aspects directly causes the GLP-1 receptor stimulant vigor of gained CEX-51 only to be about 2.6% of GLP-1 prototype molecule.The agonist activity degradation can cause this molecule dosage clinically to increase, and this point all can have problems on drug safety and economy.

How could obtain that the GLP-1 receptor agonist activity is higher, physico-chemical property is more stable, action time is longer in the body, immunogenicity is lower and the more significant GLP-1 analogue for the treatment of diabetes effect is this area institute problems of concern always, also is the research that this seminar is engaged in for a long time.For this problem, existing a large amount of correlative study reports.But the final resulting molecule of former studies or existence and stability improve but the problem of activity decreased, perhaps have active the raising but the stable problem that reduces.Up to the present, there is not yet that agonist activity is high, immunogenicity is low and body in the desirable molecular structure of long action time be seen in bibliographical information or patent application.

This seminar has compared GLP-1 and Exendin-4 structure and different from the acceptor interaction mode in early-stage Study, designed the molecular structure of a plurality of Polypeptide-k modifiers and finish reconstruct and close, adopt again MOE and Insight II software that the modifier polypeptide has been carried out acceptor docking experiment, obtained the data of receptor affinity; Carried out again simultaneously Analysis of Immunogenicity.Finally, consider receptor affinity and immunogenicity, screening has obtained a kind of novel Polypeptide-k.This polypeptide is compared with GLP-1 has high homology, only compares with Exendin-4 and has more a halfcystine at the C end.This Polypeptide-k and GLP-1 receptor affinity are high, peptide sequence itself does not contain dipeptidyl peptidase-4 and neutral peptide enzyme recognition site, the halfcystine of C end kept behind this type of peptide C end α spiral original tryptophane basket structure and by the side chain effect so that this structure is more firm.For further strengthening the stability of gained polypeptide, prolong the time length of blood sugar reducing function in its body, and reducing its immunogenicity, this seminar adopts again the site-PEGylation technology to carry out modifying and having obtained the Polypeptide-k molecule of Pegylation for the C-terminal of gained Polypeptide-k.The advantages such as measurement result shows, this Pegylation hypoglycemic polypeptide has that the GLP-1 receptor agonist activity is high, blood sugar reducing function longer duration in the body, and the low and treating diabetes effect of immunogenicity is remarkable.

Summary of the invention

One of purpose of the present invention is to provide a kind of Pegylation hypoglycemic polypeptide, and two of purpose of the present invention provides Pegylation hypoglycemic polypeptide preparation method of the present invention.

Technical scheme of the present invention is as follows:

A kind of Pegylation hypoglycemic polypeptide is characterized in that: the aminoacid sequence of described Polypeptide-k is shown in the sequence 1 (SQDID NO:1),

Sequence 1:

His-Gly-Glu-Gly-Xaa1-Phe-Thr-Ser-Asp-Leu-Ser-Xaa2-Xaa3-Xaa4-Glu-Glu-Glu-Ala-Val-Xaa5-Leu-Phe-Ile-Glu-Trp-Leu-Xaa6-Xaa7-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Xaa8，

Wherein:

Xaa1 is: Serine, Threonine, or glycine;

Xaa2 is: arginine, Methionin, or glycine;

Xaa3 is: glutamine, Serine, L-glutamic acid, or glycine;

Xaa4 is: leucine, Isoleucine, α-amino-isovaleric acid, methionine(Met), or L-Ala;

Xaa5 is: arginine, Methionin, glycine, or Histidine;

Xaa6 is: Methionin, arginine, glycine, or Histidine;

Xaa7 is: l-asparagine, Serine, Threonine, aspartic acid, or glycine;

Xaa8 is: halfcystine, or the halfcystine of Carboxylamide;

And covalently bound on the side chain sulfydryl of described Polypeptide-k C-terminal amino acid Xaa8 have a polyoxyethylene glycol.

Above-mentioned Pegylation hypoglycemic polypeptide, covalently bound polyoxyethylene glycol number-average molecular weight is 5000-40000 on the side chain sulfydryl of described C-terminal amino acid Xaa8.

The preparation method of Pegylation hypoglycemic polypeptide of the present invention has following two kinds.

A kind of method for preparing above-mentioned Pegylation hypoglycemic polypeptide, it may further comprise the steps:

Step 1. is according to aminoacid sequence in the above-mentioned polyoxyethylene glycol Polypeptide-k, and according to the e. coli codon table, the sub-preferences of combining cipher designs corresponding nucleotide sequence and synthetic;

Step 2. is added Kpn1 recognition sequence and the corresponding dna sequence dna of Asp-Asp-Asp-Asp-Lys sequence with the method for add-on PCR at 5 ' end of sequence, add TAA terminator codon and Hind3 recognition sequence at its 3 ' end, by the Kpn1/Hind3 restriction enzyme site this fragment is inserted in the pET32a expression vector;

Step 3. enters expressive host bacterium BL21 (DE3) with the gained recombinant plasmid transformed, carry out fermentation culture behind the picking positive colony, cultivate and finish rear centrifugal results bacterial sediment and ultrasonication, anionic ion displacement chromatography purifying obtains to contain the fusion rotein of target Polypeptide-k, the enteropeptidase cutting discharges the target Polypeptide-k, and anion-exchange chromatography obtains the target Polypeptide-k in conjunction with the Reversed-phase liquid chromatography purifying;

Step 4. is carried out chemically modified with the methoxy poly (ethylene glycol) of maleimide activation to the gained Polypeptide-k;

Step 5. is carried out purifying with anion-exchange chromatography and reversed-phase liquid chromatography to modifying rear Polypeptide-k, finally obtains the target Pegylation hypoglycemic polypeptide.

The preparation method of above-mentioned Pegylation hypoglycemic polypeptide, the number-average molecular weight of polyoxyethylene glycol unit is 5000-40000 in the methoxy poly (ethylene glycol) of the described maleimide activation of step 4.

A kind of method for preparing above-mentioned Pegylation hypoglycemic polypeptide, it may further comprise the steps:

Step 1. is according to aminoacid sequence in the above-mentioned ethylene glycol Polypeptide-k, adopts the method for solid phase synthesis to carry out polypeptide with the amino acid of Boc or Fmoc protection synthetic, and synthetic polypeptide carries out purifying with the anti-phase liquid phase of preparation type;

Step 2. is carried out chemically modified with the methoxy poly (ethylene glycol) of maleimide activation to the gained Polypeptide-k;

Step 3. is carried out purifying with anion-exchange chromatography and reversed-phase liquid chromatography to modifying rear Polypeptide-k, finally obtains the target Pegylation hypoglycemic polypeptide.

The preparation method of above-mentioned Pegylation hypoglycemic polypeptide, the number-average molecular weight of polyoxyethylene glycol unit is 5000-40000 in the methoxy poly (ethylene glycol) of the described maleimide activation of step 4.

The GLP-1 receptor agonist activity of Pegylation hypoglycemic polypeptide of the present invention is higher than the GLP-1 prototype molecule.In external vitality test, the short cAMP of this molecule generates activity and is higher than the GLP-1 prototype molecule.Do not contain the recognition site of dipeptidyl peptidase and neutral peptase in this molecular peptide sequence, stability is higher.And peptide molecule is owing to the masking action of polyoxyethylene glycol after modifying, and the immunogenicity basically eliminate immunne response do not occur in the repeated multiple times administration situation.Most critical, when adopting molecular weight when the above polyoxyethylene glycol of 20kDa is modified, the pharmacokinetics transformation period of this Pegylation hypoglycemic polypeptide can reach more than the 48h, and so the long transformation period can be eliminated the misery of repetitively administered, improves the diabetic compliance.

This molecule has shown that at the RINm5f cell model significant short cAMP generates active in active determination in vitro.In healthy ICR mouse peritoneal injection carbohydrate tolerance test, this molecule has shown extremely significant hypoglycemic activity.In the immunogenicity determining test, immunne response does not appear in the repeated multiple times administration of this molecule.Most critical, on diabetic mice, this molecule medication is after 14 days, and the fasting blood sugar of model mice significantly descends, and glycated serum protein content is compared with model group has remarkable decline, and fasting insulin content significantly rises.The HOMA-IS index analysis shows, the pancreas insulin secretion function of diabetic mice has obtained remarkable recovery after the treatment, and pathological section H.E. staining analysis has further proved this conclusion.Immunohistochemical analysis for pancreas also shows, diabetic mice pancreas insulin content increases to some extent after the treatment.Above data all show, Pegylation hypoglycemic polypeptide of the present invention can be used for the treatment of diabetes and complication thereof.

Description of drawings

The SDS-PAGE detected result of Fig. 1: embodiment 3 described PEG20K-GP.Wherein the 1st road is molecular weight polyethylene glycol Marker, and molecular weight is followed successively by 40kDa, 30kDa, 20kDa and 10kDa from top to bottom.The 2nd road is the contrast of PEG20K modifier.The 3rd road is PEG20K-GP.The 4th road is low molecular weight protein Marker, and molecular weight is followed successively by 94kDa, 66.2kDa, 45kDa, 35kDa, 26kDa, 20kDa and 14.4kDa from top to bottom.

The Tricine-SDS-PAGE detected result of Fig. 2: embodiment 3 described PEG20K-GP.Wherein the 1st road is molecular weight polyethylene glycol Marker, and molecular weight is followed successively by 40kDa, 30kDa, 20kDa and 10kDa from top to bottom.The 2nd road is the contrast of PEG20K modifier.The 3rd road is PEG20K-GP.The 4th road is the Polypeptide-k before PEG modifies.The 5th road is polypeptide molecular weight Marker, and molecular weight is followed successively by from top to bottom 66kDa, 45kDa, 35kDa, 27kDa, 20kDa, 14.4kDa, 9.5kDa, 6.5kDa, reaches 4.1kDa.

The ultraviolet absorpting spectrum of Fig. 3: embodiment 3 described PEG20K-GP.

The circular dichroism spectrum of Fig. 4: embodiment 3 described PEG20K-GP.

The fluorescence emission spectrum of Fig. 5: embodiment 3 described PEG20K-GP.

Fig. 6: embodiment 8 pathological section H.E. staining examine results.A, the normal healthy controls group; B, diabetic groups; C, the GLP-1 group; D, the Exendin-4 group; E, the PEG20K-GP group.

Fig. 7: embodiment 8 pancreas section Regular Insulin immunohistochemical methods detected result.A, the normal healthy controls group; B, diabetic groups; C, the GLP-1 group; D, the Exendin-4 group; E, the PEG20K-GP group.

Embodiment

Below in conjunction with embodiment, be described in further detail the present invention.The purpose of following examples is the present invention is further illustrated, in any case but these embodiment and not meaning that limit the invention.The bacterial strain that adopts among specification sheets and the embodiment, plasmid, laboratory animal, detection kit and chemical reagent etc., as specified otherwise not all routinely experiment condition operate, the explanation that perhaps provides by supplier operates.

Embodiment 1

The recombinant expressed preparation of Pegylation hypoglycemic polypeptide

The aminoacid sequence of described Polypeptide-k according to claim 1, its aminoacid sequence is as follows:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys。

According to the e. coli codon table, consider simultaneously its codon bias problem, design and synthesize corresponding dna sequence dna.Final design and to optimize the gained dna sequence dna as follows:

5’-CACGGTGAAGGTACTTTCACCTCTGACCTGTCTAAACAGATGGAAGAAGAAGCTGTTCGTCTGTTCATCGAATGGCTGAAAAACGGTGGTCCGTCTTCTGGTGCTCCACCGCCATCTTGC-3’。

5 ' end in sequence adds aspartic acid-aspartic acid-aspartic acid-aspartic acid-corresponding dna sequence dna of Methionin sequence, adds the TAA terminator codon at its 3 ' end.By the Kpn1/Hind3 restriction enzyme site this fragment is inserted in the pET32a expression vector.Adopt the Amp resistant panel to carry out the recombinant clone screening.Positive recombinant carries out dna sequence analysis, and the recon that Selective sequence is correct and insertion point is correct transforms BL21 (DE3) expressive host bacterium.

Expressive host bacterium incubated overnight is done primary seed solution, and the volume ratio by 1/50 to 1/100 spreads cultivation in the LB nutrient solution, and 37 ℃ of lower cultivation 8h to 16h that continue do secondary seed solution.This secondary seed solution accesses the 5L fermentor cultivation by 1/50 to 1/100 volume ratio.Parameter is set to rotating speed 220rpm, and temperature is controlled at 37 ℃.The IPTG that adds final concentration and be 1.0mM when thalline OD600 arrives 0.6 carries out abduction delivering.Induction time is controlled at 6h between the 12h.

Fermented liquid is pressed the centrifugal 20min results of 8000rpm wet thallus.With 20mM Tris-HCI, ultrasonication behind the resuspended thalline of pH8.0.Broken power is set in 500W, and working conditions is intermittently 3s of work 3s/, and the whole working hour is 10min.Thalline is pressed the centrifugal 20min of 12000rpm after broken.Supernatant carries out preliminary purification with 45% saturation ratio ammonium sulfate precipitation target protein.Suspension obtains precipitation with the centrifugal 20min of 12000rpm.Precipitation adopts 20mM PB, and pH7.2 is resuspended.

Resuspended liquid adopts first 50mM NaCI through Q-Sepharose Fast Flow chromatography purification, 20mM PB, and pH7.2 washs foreign protein, adopts 220mM NaCI again, 20mM PB, pH7.2 wash-out target protein.According to this technique, every 10g thalline can obtain purity and be higher than about 98% target protein 500mg.

This target protein adds enteropeptidase by 0.1mg/IU and cuts, and the optimum temps of cutting is 37 ℃, clipping time 4h.Sample after the cutting adopts RESOURCE 15RPC to carry out polishing purification and obtains the target Polypeptide-k.Tricine-SDS-PAGE and RP-HPLC detect and show that the electrophoresis purity of gained polypeptide and chromatographic purity all are higher than 98%.The Polypeptide-k that obtains adopts cryodesiccated form to preserve.

Adopting respectively molecular weight is that the polyoxyethylene glycol of the maleimide activation of 5kDa, 10kDa, 20kDa, 30kDa and 40kDa carries out polyethyleneglycol modified, specific as follows for the gained Polypeptide-k.Peptide molecule heavily is dissolved in first 20mMPB, and the pH value is controlled between 6 to 8, and the polypeptide final concentration is controlled at 1mg/ml between the 10mg/ml.In molar ratio 10/1 the amount reaction that feeds intake of PEG reagent.Temperature of reaction is controlled between 4 ℃ to 37 ℃, and the reaction times is controlled at 2h between the 24h.

Reaction mixture adopts Q-Sepharose Fast Flow chromatography purification to carry out preliminary purification, and unreacted PEG modifier stream is worn.With 20mM PB, behind the abundant balance chromatography column of pH7.2, directly adopt 50mM NaCI, 20mMPB, the polyethyleneglycol modified Polypeptide-k of pH7.2 wash-out, the polypeptide of unmodified also is combined on the chromatography column this moment.Then polypeptide adopts cryodesiccated mode to store in order to further detecting through reverse-phase chromatography desalination, concentrated and polishing purification after the modification that purifying obtains.

Embodiment 2

The solid phase synthesis preparation of Pegylation hypoglycemic polypeptide

The aminoacid sequence of described Polypeptide-k according to claim 1, its sequence is as follows:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys(CONH ₂)，

Wherein, Cys (CONH ₂) be the halfcystine of Carboxylamide.Adopt the amino acid of Fmoc protection to carry out solid phase synthesis, whole reaction is all finished at the Solid-phase Polypeptide synthesizer.

Synthetic polypeptide adopts preparation type Reversed-phase liquid chromatography purifying, obtains purity and is higher than 98% target Polypeptide-k, and adopt ESI-MS that the physics molecular weight of gained polypeptide is detected.Measurement result shows that the physics molecular weight of gained polypeptide is 4289.7Da.The Tricine-SDS-PAGE detected result shows that its apparent molecular weight is about 4.3kDa, and is consistent with the physics molecular weight.Adopt cryodesiccated method that the gained polypeptide is preserved.

Synthetic polypeptide is adopted 20mM PB dissolving, and the pH value is controlled between 6 to 8, and the polypeptide final concentration is controlled at 1mg/ml between the 10mg/ml.Adopt respectively the polyoxyethylene glycol of the maleimide activation of 5kDa, 10kDa, 20kDa, 30kDa and 40kDa to carry out polyethyleneglycol modified reaction for this polypeptide.The ingredient proportion of reaction is controlled at 10/1 (PEG/ polypeptide), and temperature of reaction is controlled between 4 ℃ to 37 ℃, and the reaction times is controlled at 2h between the 24h.

The purifying of reaction product is with embodiment 1.Polyethyleneglycol modified Polypeptide-k behind the purifying adopts cryodesiccated method freeze-drying to preserve in order to further detecting.

With above-mentioned identical solid phase synthesis and purification process, synthesized the Polypeptide-k of following aminoacid sequence:

(1)：

It is 4272.7 dalton that His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-CysESI-MS measures its physics molecular weight, called after GP1.

(2)：

It is 4300.7 dalton that His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Arg-Gln-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-CysESI-MS measures its physics molecular weight, called after GP2.

(3)：

It is 4231.6 dalton that His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Ser-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-CysESI-MS measures its physics molecular weight, called after GP3.

(4)：

It is 4262.7 dalton that His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Lys-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-CysESI-MS measures its physics molecular weight, called after GP4.

(5)：

It is 4318.7 dalton that His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Arg-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-CysESI-MS measures its physics molecular weight, called after GP5.

(6)：

It is 4291.7 dalton that His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asp-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-CysESI-MS measures its physics molecular weight, called after GP6.

(7)：

It is 4273.7 dalton that His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asp-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-CysESI-MS measures its physics molecular weight, called after GP7.

(8)：

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys (CONH ₂), wherein, Cys (CONH ₂) be the halfcystine of Carboxylamide.It is 4271.7 dalton that ESl-MS measures its physics molecular weight, called after GP8.

(9)：

It is 4258.6 dalton that His-Gly-Glu-Gly-Ser-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-CysESl-MS measures its physics molecular weight, called after GP9.

(10)：

It is 4272.7 dalton that His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Leu-Glu-Glu-Glu-Ala-Val-Lys-Leu-Phe-Ile-Glu-Trp-Leu-Arg-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-CysESI-MS measures its physics molecular weight, called after GP10.

And adopting identical method with the methoxy poly (ethylene glycol) of the maleimide activation of 5kDa, 10kDa, 20kDa, 30kDa and 40kDa aforementioned polypeptides to be modified and separation and purification, the electrophoresis purity of polypeptide and chromatographic purity were all more than 98% after SDS-PAGE and RP-HPLC detection gained were modified.The nomenclature mo of modified outcome is: molecular weight polyethylene glycol adds the Polypeptide-k code name.For example: the GP1 product that the methoxy poly (ethylene glycol) of the maleimide activation of molecular weight 20kDa is modified is named as PEG20K-GP1; The GP5 product that the methoxy poly (ethylene glycol) of the maleimide activation of molecular weight 40kDa is modified is named as PEG40K-GP5; The GP10 product that the methoxy poly (ethylene glycol) of the maleimide activation of molecular weight 5kDa is modified is named as PEG5K-GP10.

Embodiment 3

The analysis of physical and chemical property of Pegylation hypoglycemic polypeptide

The aminoacid sequence structure of described Polypeptide-k is as follows:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Por-Ser-Cys(CONH ₂)，

Wherein, Cys (CONH ₂) be the halfcystine of Carboxylamide.Adopt respectively the polyoxyethylene glycol of the maleimide activation of 5kDa, 10kDa, 20kDa, 30kDa and 40kDa to carry out polyethyleneglycol modified reaction for this polypeptide, the gained Pegylation hypoglycemic polypeptide is called after: PEG5K-GP, PEG10K-GP, PEG20K-GP, PEG30K-GP and PEG40K-GP respectively.

Its physico-chemical property detection method is identical, and the below only sets forth as an example of the polyethyleneglycol modified Polypeptide-k of 20kDa (PEG20kDa modified glucose-lowering peptide, PEG20K-GP) example.

Purity check.The method that adopts respectively RP-HPLC, SDS-PAGE and Tricine-SDS-PAGE detects chromatographic purity and the electrophoresis purity of gained Pegylation hypoglycemic polypeptide.The result shows, the chromatographic purity of PEG20K-GP and electrophoresis purity all are higher than 98%.

Molecular weight determination.Adopt MALDI-TOF that the molecular weight of PEG20K-GP is measured, the result shows that the physics molecular weight of gained PEG20K-GP is about 24350Da.

Isoelectric point determination.Adopt the iso-electric point electrophoresis that the iso-electric point of PEG20K-GP is measured, the result shows that the iso-electric point of this molecule is about 4.9.

Determination of uv absorption.PEG20K-GP is measured to the uv-absorbing between 400nm at 200nm.The measurement result discovery, except end absorption, only there is the characteristic absorbance at 280nm place in PEG20K-GP.

Circular dichroism spectrum and tryptophane fluorescence emission spectrum are measured.Circular dichroism spectrum is measured the secondary structure composition that shows PEG20K-GP and is mainly the α spiral, and the helical content before and after modifying does not change.The tryptophane fluorescence emission spectrum is measured and is shown that the maximum emission wavelength of modifying the front and back Polypeptide-k is 350nm, and this result shows that the polyethyleneglycol modified space structure that does not change Polypeptide-k tryptophane microcell forms.

With method PEG5K-GP, PEG10K-GP, PEG30K-GP and PEG40K-GP are carried out physical and chemical determination, the result is as follows:

Purity check: chromatographic purity and electrophoresis purity all are higher than 98%.

The physics molecular weight of molecular weight determination: PEG5K-GP is about 9350Da; The physics molecular weight of PEG10K-GP is about 14350Da; The physics molecular weight of PEG30K-GP is about 34350Da; The physics molecular weight of PEG40K-GP is about 44350Da.

Isoelectric point determination: adopt the iso-electric point electrophoresis that the iso-electric point of four kinds of Pegylation hypoglycemic polypeptides is measured, the result shows that the iso-electric point of four kinds of molecules is all about 4.9.

Determination of uv absorption: four kinds of Pegylation hypoglycemic polypeptides are measured to the uv-absorbing between 400nm at 200nm.Measurement result is found, except end absorption, is only had the characteristic absorbance at 280nm place.

Circular dichroism spectrum and tryptophane fluorescence emission spectrum are measured.Circular dichroism spectrum is measured the secondary structure composition that shows four kinds of Pegylation hypoglycemic polypeptides and is mainly the α spiral, and the helical content before and after modifying does not change.The tryptophane fluorescence emission spectrum is measured and is shown that the maximum emission wavelength of modifying the front and back Polypeptide-k is 350nm, and this result shows that the polyethyleneglycol modified space structure that does not change Polypeptide-k tryptophane microcell forms.

10 kinds of polyethyleneglycol modified Polypeptide-k aminoacid sequences to synthetic other of embodiment 2 carry out identical analysis of physical and chemical property, obtain similar result.

Embodiment 4

The active determination in vitro of Pegylation hypoglycemic polypeptide

Measuring with cell strain is the strain of RINm5f islet cells.Testing index is cAMP content, adopts the ELISA method to carry out when specifically measuring.

The method for resuscitation of RINm5f is as follows.(1) from liquid nitrogen container, takes out rapidly cryopreservation tube.(2) put into immediately 40 ℃ of water-baths, acutely shake, it is melted fully, then in super clean bench, take out cell under the sterile state, be transferred in the centrifuge tube, slowly drip substratum to 6ml-8ml, the centrifugal 5min of 1000rpm.(3) abandoning supernatant, add the proper amount of fresh nutrient solution, blow evenly, be transferred in the culturing bottle, add fresh medium to 8ml, put 37 ℃ of incubators and leave standstill cultivation, when next day, cell became the monolayer adherence state, change one time nutrient solution, continue to cultivate, observe growing state, if cell density is higher, in time go down to posterity.

Medicine to be determined has following several: (1) GLP-1; (2) Exendin-4; (3) PEG5K-GP; (4) PEG10K-GP; (5) PEG20K-GP; (6) PEG30K-GP; (7) PEG40K-GP.Cell density is controlled at about 300,000 every holes before measuring, to add medicine to be measured after the DMEM washed twice.Add to every hole contain 0.5%BSA and different concns medicine solution to draw dose response curve, can obtain the EC50 value of medicine from curve.Medicine adds and to be placed on 25 ℃ and to place 20min, then smudge cells and measure cAMP content.Take the EC50 of GLP-1 as 100%, the biologos as the GLP-1 receptor stimulant of each medicine following (n=8).

Exendin-4

PEG5K-GP

PEG10K-GP

PEG20K-GP

PEG30K-GP

PEG40K-GP

％

278％

325％

269％

252％

213％

168％

The sequential structure of other Polypeptide-k described in the embodiment 2, when the methoxy poly (ethylene glycol) of the maleimide activation of adopting molecular weight 20kDa is modified, the similar or slightly decline of the agonist activity of modified outcome and PEG20K-GP.

Embodiment 5

The abdominal injection carbohydrate tolerance test of PEG20K-GP

Get 24 of ICR mouse (male), be divided at random 2 groups, 12 every group.Mouse is raised the experimental animal room in Life Science and Technology institute of China Medicine University, and feeding environment is illumination 12h, dark 12h, 25 ℃ of room temperatures.Allow first the mouse 3d that conforms before the experiment.Fasting 18h before the test can't help water.Test by following group.(1) high sugar group: physiological saline+height sugar; (2) PEG20K-GP group: the high sugar of 25nmol/kg PEG20K-GP+.High sugar gives by 18mmol/kg (8mi/kg) abdominal injection, gives medicine at the front 15min that gives high sugar in the mode of abdominal injection, and high sugar is organized the physiological saline that then gives same volume.0min, 15min, 30min, 45min and 60min eye socket posterior vein after the high sugar of injection are got blood.The hematology lab is gentle and quiet puts 2500rpm * 3min centrifuging and taking serum behind the 15min, and blood sugar detection carries out (hexokinase method) with the blood sugar detection test kit.Measurement result following (mmol/L of unit).

	0min	15min	30min	45min	60min
						Saline	3.86±1.14	19.91±1.65	17.78±1.66	15.91±1.75	14.78±2.50
PEG20K-GP	3.89±0.30	10.48±2.21	9.54±1.22	8.47±0.79	7.24±1.85

Embodiment 6

Impact on ICR mouse diet and stomach emptying

(1) on the impact of diet

7 of healthy male ICR mouses, minute 1 in every cage is raised, test preadaptation 3d.Water 12h is prohibited in fasting before carrying out diet test, and 8:00 gives the PEG20K-GP of 25nmol/kg morning next day, employing with the GLP-1 of dosage and Exendin-4 in contrast, the blank group then gives the physiological saline of same volume.Finish to give simultaneously food and the water of weighing in advance in administration, in ensuing 24h, let alone free diet.Again things and water are weighed behind the 24h, weight reduction calculates the food of acquisition consumption and the amount of water.Net result in the form is the ratio of dietary amount and body weight.

(2) on the impact of stomach emptying

5 of healthy male ICR mouses, minute 1 in every cage is raised, test preadaptation 3d.Thorough fasting 18h (can't help water) before carrying out emptying test.Give first the food (M that weighs in advance before the administration ₀), let alone free diet 1h, then remove food and the (M that again weighs ₁), the amount of the food that weight reduction calculating acquisition consumes.Give medicine when removing food, PEG20K-GP gives according to the dosage of the 25nmol/kg form with abdominal injection, gives the Exendin-4 of same dosage in contrast, and the blank group then just gives the physiological saline of same volume.Row gastrectomy and to its content (M that weighs behind 4h again ₂).Stomach emptying index (Gastric emptying rate, GER) calculates as follows: stomach emptying index=[1-M ₂/ (M ₀-M ₁)] * 100%.

Measurement result on the impact of diet and stomach emptying is as follows.

	Saline	GLP-1	Exendin-4	PEG20K-GP
					Food	0.14±0.02	0.10±0.04	0.09±0.04	0.07±0.03
Water	0.25±0.08	0.19±0.09	0.20±0.09	0.17±0.08
					GER(％)	0.84±0.03	0.35±0.05	0.28±0.06	0.15±0.02

Embodiment 7

Preliminary pharmacokinetic

Pharmacokinetics test adopts male SD rat to carry out, and medicine is carried out adopting by the dosage of 0.1mg/kg behind the radio-labeling form administration of intravenous injection (iv).Except 6 male SD rats of GLP-1 group, all the other each groups are every group of 8 male SD rats.Different time points after administration gathers blood plasma and mensuration medicament contg wherein, and it is as follows that the method that adopts model to rely on is calculated pharmacokinetics transformation period t1/2 (h) result.

GLP-1

Exendin-4

PEG5K-GP

PEG10K-GP

PEG20K-GP

PEG30K-GP

PEG40K-GP

t1/2

0.02

2.4±0.8

12.8±2.6

20.5±3.7

49.6±2.2

61.3±4.2

72.3±5.5

Embodiment 8

Therapeutic action to diabetic mice

Experimental animal is ICR mouse (male), available from Yangzhou University's Experimental Animal Center.Animal rearing operates according to following requirement: illumination in 12 hours, 12 hours dark, room temperature 25 degree.After animal is fetched, adapt to 7 days, then begin test.

Diabetes model copies by the following method.Solution preparation: preparation citrate buffer solution and accurate adjustment pH are 4.0 (this solution is now with the current, with front ice bath 30min).Every group of mouse accurately takes by weighing streptozotocin 10mg (available from Sigma company), and adding citric acid damping fluid 4ml is mixed with the solution that concentration is 2.5mg/ml (this solution is now with the current, and room temperature must not place above 15min) on ice.The model preparation: in 10 fasting in morning every day, fasting time is 4 hours, 14 beginning model preparation tests.14 o'clock sharps, every ICR mouse gives the citric acid solution of streptozotocin by the dosage abdominal injection of 50mg/kg.Allow mouse free diet thereafter.This experiment repeats 5 days.Allow mouse free diet and recover 3 day thereafter.Blood sugar detection: after recovering in 3 days, fasting 4 hours, the eye socket posterior vein is got fasting blood, measures blood sugar concentration with Bloodglucose test kit (ShangHai RongSheng Biology Pharmacy Co., Ltd).Being higher than 11.1mmol/L by blood sugar concentration is that model is set up.Animal pattern grouping: give up the unsuccessful mouse of modeling, be higher than 11.1mmol/L and the close mouse of blood glucose value as modeling success mouse take blood sugar.

Pharmacological agent.Being divided into is 5 groups, every group of 10 of diabetic mice (the normal healthy controls group is 10 of male and healthy ICR mouse).5 groups are respectively: (1) diabetic model group; (2) GLP-1 group; (3) Exendin-4 group; (4) PEG20K-GP; (5) normal healthy controls group.Medicine all gives by 25nmol/kg (8mi/kg), and model control group and normal healthy controls group all give the physiological saline of same volume.Every morning 9:00 adopts the abdominal injection form administration during treatment, and therapeutic process continues 14d.

Data gathering in the therapeutic process.0,1,2 and 3 weeks respectively at treatment are measured mouse fasting blood glucose level, result following (mmol/L of unit).

	Diabetes	GLP-1	Exendin-4	PEG20K-G P	Normal
						0week	6.11±1.46	4.85±0.88	5.86±0.99	4.58±0.82	5.56±1.41
1week	15.64±4.69	15.86±4.53	15.64±4.14	15.91±4.05	7.96±0.68
						2week	17.33±4.23	15.40±3.41	15.33±3.86	10.46±2.64	7.05±0.31
3week	20.70±3.03	15.76±5.57	15.07±4.97	8.86±2.91	7.97±0.92

Analysis after treatment finishes is measured.Pluck eyeball after the 14d treatment finishes and get blood, measure oral insulin content.Insulin assay adopts I125 Regular Insulin radioimmunoassay medicine box (Beijing pul great achievement bio tech ltd) to analyze, and sample is delivered to Southeast China University attached middle large hospital chemoluminescence laboratory and measured.Islet function index HOMA-IS calculation formula is HOMA-IS=20 * fasting insulin concentration/(fasting plasma glucose concentration-3.5).Glycated serum protein (GSP) assay adopts glycated serum protein mensuration test kit (biotechnology company limited is built up in Nanjing) to carry out, and final numerical value reads at 752 spectrophotometers.Fasting insulin concentration (Fins, the μ lU/ml of unit), HOMA-IS result and glycated serum protein content (mmol/L of unit) are as follows.

	Diabetes	GLP-1	Exendin-4	PEG20K-GP	Normal
						Fins	20.9±3.7	24.6±3.1	30.2±10.2	31.3±11.1	57.5±15.9
HOMA-IS	25.5±9.5	54.7±39.3	61.7±35.8	164.4±123.5	258.7±55.4
						GSP	3.01±0.11	2.80±0.14	2.79±0.14	2.67±0.08	2.57±0.15

Pathological section H.E. staining analysis and immunoassay.Put to death animal parallel liver, kidney and depancreatize art after the off-test, paraffin embedding after dipped into formalin is fixing.Carry out H.E. staining analysis (the pathology analytical work is carried out in Department of Pathology of attached medical college of the ministry of railways of Southeast China University, and immunohistochemical analysis is operated in Jiangsu Province Pathology Deparment of the hospitals of traditional Chinese and western medicine and carries out) after the section.Detected result shows that obvious pathology does not all appear in the liver of 5 treated animals and kidney.For pancreas, the pancreas pancreas islet quantity of diabetic model group obviously tails off, and has islet cells pathology phenomenon.Through the relative medicine treatment, pancreas pancreas islet disease makes moderate progress, and the islet function recovery extent is followed successively by PEG20K-GP group＞Exendin-4 group＞GLP-1 group (the results are shown in accompanying drawing 6) from high to low.Insulin content is followed successively by PEG20K-GP group＞Exendin-4 group＞GLP-1 group from high to low in the pancreas islet, is consistence (the results are shown in accompanying drawing 7) with the islet function recovery extent.This result has also confirmed the data of the resulting physiological and biochemical index in front from another angle, show that further the treating diabetes effect of PEG20K-GP far is better than Exendin-4 and GLP-1.

Embodiment 9

The 10 kinds of Polypeptide-ks in embodiment 2 described back are at the hypoglycemic activity of diabetic mice

Experimental animal is ICR mouse (male), available from Yangzhou University's Experimental Animal Center.Animal rearing operates according to following requirement: illumination in 12 hours, 12 hours dark, room temperature 25 degree.After animal is fetched, adapt to 7 days, then begin test.

Model copy work is with embodiment 8.The mouse of model copy success is divided into 12 groups, 10 groups for the treatment of groups (being respectively PEG20K-GP 1, PEG20K-GP2, PEG20K-GP3, PEG20K-GP4, PEG20K-GP5, PEG20K-GP6, PEG20K-GP7, PEG20K-GP8, PEG20K-GP9, PEG20K-GP10) wherein, 1 group of diabetic model group (called after Diabetes group), 1 group of normal healthy controls group (called after Normal group).Every treated animal quantity is 10.Medicine all gives by 25nmol/kg (8ml/kg) during treatment, and model control group and normal healthy controls group all give the physiological saline of same volume.Every morning 9:00 adopts the abdominal injection form administration during treatment, and therapeutic process continues 14d.

Measure respectively the fasting plasma glucose of respectively organizing after mouse model is treated front (after the modeling) and treatment with Blood glucose test kit (ShangHai RongSheng Biology Pharmacy Co., Ltd), result following (mmol/L of unit):

Group	Before the treatment (after the modeling)	After the treatment
			Normal	5.98±1.25	6.32±0.87
Diabetes	14.56±1.25	21.71±3.29
			PEG20K-GP1	14.19±1.78	9.29±2.39
PEG20K-GP2	14.96±1.29	9.78±3.52
			PEG20K-GP3	15.29±2.67	10.28±3.59
PEG20K-GP4	15.06±1.65	8.98±2.21
			PEG20K-GP5	14.79±1.53	9.62±3.07
PEG20K-GP6	14.91±1.62	10.38±3.11
			PEG20K-GP7	15.16±1.65	9.34±2.67
PEG20K-GP8	15.59±1.95	8.49±2.12
			PEG20K-GP9	14.06±1.19	9.39±2.91
PEG20K-GP10	14.66±1.2	8.91±3.09

Claims (7)

1. Pegylation hypoglycemic polypeptide, it is characterized in that: the aminoacid sequence of described Polypeptide-k is shown in the following structure,

Sequence 1:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys（CONH ₂）；

Sequence 2:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys；

Sequence 3:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Arg-Gln-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys；

Sequence 4:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Ser-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys；

Sequence 5:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Lys-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys；

Sequence 6:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Arg-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys；

Sequence 7:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asp-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys；

Sequence 8:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asp-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys；

Sequence 9:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys（CONH ₂）；

Sequence 10:

His-Gly-Glu-Gly-Ser-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Leu-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp-Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys；

Sequence 11:

His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Leu-Glu-Glu-Glu-Ala-Val-Lys-Leu-Phe-Ile-Glu-Trp-Leu-Arg-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys；

And covalently bound on the amino acid whose side chain sulfydryl of described Polypeptide-k C-terminal have a polyoxyethylene glycol.

2. Pegylation hypoglycemic polypeptide according to claim 1, it is characterized in that: covalently bound polyoxyethylene glycol number-average molecular weight is 5000-40000 on the amino acid whose side chain sulfydryl of described C-terminal.

3. method for preparing Pegylation hypoglycemic polypeptide claimed in claim 1 is characterized in that it may further comprise the steps:

Aminoacid sequence in the step 1. polyoxyethylene glycol Polypeptide-k according to claim 1, according to the e. coli codon table, the sub-preferences of combining cipher, the nucleotide sequence that design is corresponding is also synthetic;

Step 2. is added Kpn1 recognition sequence and the corresponding dna sequence dna of Asp-Asp-Asp-Asp-Lys sequence with the method for add-on PCR at 5 ' end of sequence, add TAA terminator codon and Hind3 recognition sequence at its 3 ' end, by the Kpn1/Hind3 restriction enzyme site this fragment is inserted in the pET32a expression vector;

Step 3. enters expressive host bacterium BL21(DE3 with the gained recombinant plasmid transformed), carry out fermentation culture behind the picking positive colony, cultivate and finish rear centrifugal results bacterial sediment and ultrasonication, anionic ion displacement chromatography purifying obtains to contain the fusion rotein of target Polypeptide-k, the enteropeptidase cutting discharges the target Polypeptide-k, and anion-exchange chromatography obtains the target Polypeptide-k in conjunction with the Reversed-phase liquid chromatography purifying;

Step 4. is carried out chemically modified with the methoxy poly (ethylene glycol) of maleimide activation to the gained Polypeptide-k;

Step 5. is carried out purifying with anion-exchange chromatography and reversed-phase liquid chromatography to modifying rear Polypeptide-k, finally obtains the target Pegylation hypoglycemic polypeptide.

4. the preparation method of Pegylation hypoglycemic polypeptide according to claim 3 is characterized in that: the number-average molecular weight of polyoxyethylene glycol unit is 5000-40000 in the methoxy poly (ethylene glycol) of the described maleimide activation of step 4.

5. method for preparing Pegylation hypoglycemic polypeptide claimed in claim 1 is characterized in that it may further comprise the steps:

Aminoacid sequence in step 1. Pegylation hypoglycemic polypeptide according to claim 1 adopts the method for solid phase synthesis to carry out polypeptide with the amino acid of Boc or Fmoc protection synthetic, and synthetic polypeptide carries out purifying with the anti-phase liquid phase of preparation type;

Step 2. is carried out chemically modified with the methoxy poly (ethylene glycol) of maleimide activation to the gained Polypeptide-k;

Step 3. is carried out purifying with anion-exchange chromatography and reversed-phase liquid chromatography to modifying rear Polypeptide-k, finally obtains the target Pegylation hypoglycemic polypeptide.

6. the preparation method of Pegylation hypoglycemic polypeptide according to claim 5 is characterized in that: the number-average molecular weight of polyoxyethylene glycol unit is 5000-40000 in the methoxy poly (ethylene glycol) of the described maleimide activation of step 4.

7. the application of Pegylation hypoglycemic polypeptide claimed in claim 1 in preparation treatment diabetes medicament.

Images