CN101899532A - Canine parvovirus LAMP detection kit and detection method thereof - Google Patents
Canine parvovirus LAMP detection kit and detection method thereof Download PDFInfo
- Publication number
- CN101899532A CN101899532A CN2009103116812A CN200910311681A CN101899532A CN 101899532 A CN101899532 A CN 101899532A CN 2009103116812 A CN2009103116812 A CN 2009103116812A CN 200910311681 A CN200910311681 A CN 200910311681A CN 101899532 A CN101899532 A CN 101899532A
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- canine parvovirus
- lamp
- base sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a canine parvovirus LAMP detection kit and a detection method thereof in the technical field of health inspection. The kit comprises six primers the base sequences of which are respectively shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6. The detection method by adopting the kit has the following steps: step one, extracting nucleic acid of a sample to be detected by a conventional method; and step two, adopting the LAMP detection kit to detect the nucleic acid in the sample, and judging whether canine parvovirus exists in the sample. The kit in the invention has simple use, intuitive result and high specificity and sensitivity.
Description
Technical field
The present invention relates to a kind of test kit and detection method thereof of biochemistry detection technical field, specifically is a kind of LAMP (ring mediated isothermal amplification) detection kit and detection method thereof of canine parvovirus.
Background technology
(Canine parvovirus CPV) belongs to Parvoviridae to canine parvovirus, and parvovirus belongs to, feline panleucopenia virus subgroup (Parvovirinae).CPV is an important cause of disease for dog and Canis animals, and it can cause acute enteritis, oligoleukocythemia, violent vomiting, and the illnesss such as myocarditis of pup.This disease all can take place throughout the year, and with the urgency of falling ill, the course of disease is short, and infectivity is strong, and the mortality ratio height often is explosive popular.The dog of different ages, sex, kind all can infect, and its non-surviving rate＜5% through treatment is one of the most serious transmissible disease of harm China dog industry.Present detection method generally is first spot sampling, and then send laboratory inspection, has long flow path, and drawback such as many, cost height consuming time had both influenced detection speed, more be unfavorable for the timely control and the monitoring of eqpidemic disease.T.Notomi equals to develop in 2000 a kind of constant temperature nucleic acid amplification method of novelty, be ring mediated isothermal amplification method (loop mediated isothermal amplification LAMP), be characterized in 6 kinds of special primers of 8 zone design at target gene, utilize a kind of strand displacement archaeal dna polymerase (BstDNA polymerase) in isothermal condition (65 ℃) insulation dozens of minutes, can finish nucleic acid amplification reaction and do not need processes such as the thermally denature of template, long-time temperature cycle, loaded down with trivial details electrophoresis, ultraviolet visualization.LAMP is a kind of brand-new DNA cloning method, has characteristics simple, quick, high specificity.
Find through literature search prior art, Desario, C etc. were " Journal of Virological Methods " (viral methodology) 2005, the 126th phase, delivered for 179～185 pages and be entitled as " Canine parvovirusinfection:which diagnostic test for virus? " (which method that detects canine parvovirus has) literary composition, comment in the literary composition, the detection method of canine parvovirus mainly contains polymerase chain reaction (PCR), virus is separated (VI), enzyme linked immunosorbent assay (ELISA) etc.; But the instrument that these Technology Needs are special, and have easy crossed contamination and the loaded down with trivial details shortcoming of operating process, therefore be unsuitable for on-the-spot quick test, owing to detect the cost height, also strengthened and applied difficulty simultaneously.
Summary of the invention
The objective of the invention is to overcome the deficiencies in the prior art, a kind of LAMP detection kit and detection method thereof of canine parvovirus is provided.Test kit of the present invention uses simple, and the result identifies convenient directly perceived, the detection specificity height, and the susceptibility height, and be easy to apply on a large scale.
The present invention realizes by following technical scheme,
The present invention relates to a kind of LAMP detection kit of canine parvovirus, this test kit comprises following 6 primers, and the base sequence of described primer is respectively shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6.
Described test kit comprises reaction solution A and SYBR Green I, and described reaction solution A is specially: component and the content of every 22uL reaction solution A are: 10 * Thermopol buffer 2.5uL, 2.5mM dNTP mix 8uL, 5M betaine 5uL, 1MMgSO
40.2uL, 8U/uL BstDNA enzyme 1uL, ultrapure water 2.7uL, and following primer:
The primer 0.1uL of 50uM base sequence shown in SEQ ID NO:1;
The primer 0.1uL of 50uM base sequence shown in SEQ ID NO:2;
The primer 0.8uL of 50uM base sequence shown in SEQ ID NO:3;
The primer 0.8uL of 50uM base sequence shown in SEQ ID NO:4;
The primer 0.4uL of 50uM base sequence shown in SEQ ID NO:5;
The primer 0.4uL of 50uM base sequence shown in SEQ ID NO:6.
Described SYBR Green I is 1000 * SYBR Green I.
The invention still further relates to a kind of detection method of utilizing the LAMP detection kit of described canine parvovirus, comprise the steps:
Step 1 is according to the nucleic acid of ordinary method extraction testing sample;
In the step 2, described judgement is specially: observing the color of the reaction solution that obtains at last, is green as color, then contains canine parvovirus in the sample, if the color of reaction solution is an orange, does not then contain canine parvovirus in the sample.
In the step 2, shown in the testing process, the reaction conditions of LAMP amplification is: 63 ℃ of constant temperature 60min.
Compared with prior art, the present invention has following beneficial effect: test kit of the present invention uses simple,
The result identifies convenient directly perceived; The detection specificity height, the susceptibility height minimumly detects 10 copies, is 100 times of regular-PCR sensitivity; Test kit of the present invention makes detection not need advanced instrument, can finish experimental implementation once going on foot, reduced the chance of polluting, can satisfy at present needs preferably to the check at canine parvovirus scene, be used for importing and exporting quarantine, the spot inspection of livestock rearing field etc., and be easy to apply on a large scale.
Description of drawings
The as a result figure of Fig. 1 for utilizing test kit to detect among the embodiment 1;
Fig. 2 verifies the specific gel electrophoresis of test kit system figure as a result among the embodiment 3;
Fig. 3 is for carrying out gel electrophoresis that specific amplification confirms figure as a result to the end product that increases in the test kit system among the embodiment 3; Among the figure, end product, obtains after the digestion expecting the fragment of big or small 117bp and 124bp having proved the special of amplification to confirm the specificity of test kit system through restriction enzyme Sau3A I digestion;
Fig. 4 is that test kit detects and the comparison diagram of the susceptibility of regular-PCR detection among the embodiment 2;
Fig. 5 is a different Mg among the embodiment 1
2+The gel electrophoresis result of test kit amplification efficiency under the concentration.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, for example the Sambrook equimolecular is cloned: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The LAMP of canine parvovirus detects
Step 1, the LAMP primer design
(1) genome sequence that retrieval obtains canine parvovirus from gene database carries out sequence alignment by DNAstar software, obtains the genomic specific and conserved sequence SEQ ID of canine parvovirus NO:7;
(2) by LAMP primer-design software (Primer Explorer software, version 4.0) this conserved sequence is carried out the LAMP design of primers, obtains 6 primers:
The sequence of primer F3 is shown in SEQ ID NO:1;
The sequence of primer B3 is shown in SEQ ID NO:2;
The sequence of primer FIP is shown in SEQ ID NO:3;
The sequence of primer BIP is shown in SEQ ID NO:4;
The sequence of primer LF is shown in SEQ ID NO:5;
The sequence of primer LB is shown in SEQ ID NO:6;
Mg is passed through in the optimization of LAMP reaction system
2+The peak optimization reaction system is determined in the variation of concentration, temperature of reaction and reaction times three parameters; At first temperature of reaction is made as 62 ℃, and the reaction times was made as 60 minutes, and the Mg of different concns is set
2+(0,2,4,6,8,10,12,14mM), reaction are finished to carry out gel electrophoresis and are observed, and the results are shown in Figure 5, can determine that by Fig. 5 best Mg2+ concentration is 8mM, so analogize and can determine that optimal reaction temperature and optimum reacting time are respectively 63 ℃ and 60min; The final optimum response system of determining is as follows: inner primer FIP and BIP 1.6uM, outer primer F3 and B3 0.2uM, ring primer LF and LF 0.8uM, 0.8mM dNTP mix, 1M betaine, 8mM MgSO4,8U BstDNA enzyme, 1 * Thermopol buffer ultrapure water 2.7uL, template DNA 3uL.Optimum reaction condition: 63 ℃ of constant temperature 60min.
(1) component and the content of configuration 22uL reaction solution A:22uL reaction solution A are:
10 * Thermopol buffer (U.S. NEB company) 2.5uL,
50uM?primer?FIP?0.8uL，50uM?primer?BIP?0.8uL，
50uM?primer?F3?0.1uL，
50uM?primer?B3?0.1uL，
50uM?primer?LF?0.4uL，
50uM?primer?LF?0.4uL，
2.5mM?dNTP?mix?8uL，
5M betaine (U.S. Sigma company) 5uL,
1M?MgSO4?0.2uL，
8U/uL BstDNA enzyme (U.S. NEB company) 1uL,
Ultrapure water 2.7uL.
(2) (American I nvitrogen company Cat.No.15596-026) extracts nucleic acid in the sample to be checked (the excrement sample of doubtful Canine parvovirus infection dog) to extract test kit with Trizol commercialization RNA; The nucleic acid of getting the 3uL extraction adds among the 22uL reaction solution A, and making the end reaction volume is 25uL, and the mixing reaction solution is of short duration centrifugal;
(3) reaction solution with step (2) configuration places 63 ℃ of constant temperature 60min to carry out the LAMP amplification;
(4) take out above-mentioned amplified reaction pipe, add 1uL 1000 * fluorescence dye SYBR Green I (American I nvitrogen company) therein, become green as liquid color in the reaction tubes, then contain canine parvovirus in the interpret sample, if color is an orange, then do not contain canine parvovirus in the interpret sample.As shown in Figure 1, colour-change behind the adding reaction solution B in the LAMP detection architecture end reaction liquid of Fig. 1 canine parvovirus, the positive reaction color becomes green (pipe 1～7); The negative reaction color becomes orange (pipe 8).
The sensitivity analysis of LAMP detection architecture
Survey the OD260nm value of the parvovirus nucleic acid from dog ight soil, extract with spectrophotometer, bring numerical value into formula and calculate its concentration.Then it is done 10 times of gradient dilutions, each concentration after the dilution is 5.7 * 10
7Copies/ μ L, 5.7 * 10
6Copies/ μ L ... 5.7 * 10
0Copies/ μ L carries out it as template
LAMP method and regular-PCR method detect, relatively the sensitivity of two kinds of methods.The reaction system of LAMP method is optimum response system and optimum reacting time and the temperature among the embodiment 1.
Regular-PCR method reaction system is:
2 * PCR TaqMix (TIANGEN Biotech (Beijing) Co., Ltd.), 25 μ L,
Primer 1 (50 μ mol/L) 0.5 μ L
Described primer 1 is: 5 ' TCTGCTACTCAGCCACCAA 3 ' (SEQ ID NO:8)
Primer 2 (50 μ mol/L) 0.5 μ L
Described primer 2 is: 5 ' ACCTCCTTCAGCTTGAGGCAA 3 ' (SEQ ID NO:9)
Aseptic double-distilled water 20 μ L,
Cumulative volume is 50 μ L;
Reaction conditions is: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 40s, 53 ℃ of annealing 40s, 72 ℃ are extended 2min, 34 circulations, 72 ℃ are extended 10min.
PCR carries out 1% agarose gel electrophoresis analysis with the PCR product after finishing.
The result shows that the sensitivity of LAMP detection method can reach the canine parvovirus nucleic acid that detects 57 copies, highly sensitive 100 times of this methods than regular-PCR method, see Fig. 4, the LAMP check reaction system of Fig. 4 canine parvovirus and the susceptibility of regular-PCR, M is DNA Marker; Wherein 1～8 be respectively 5.7 * 10
7Copies/ μ L, 5.7 * 10
6Copies/ μ L ... 5.7 * 10
0Copies/ μ L.
LAMP detection architecture specificity analyses
For verifying the specificity of this LAMP detection architecture, extract the nucleic acid that test kit extracts the virus that has potential cross reaction with Trizol commercialization RNA, nucleic acid with canine parvovirus, canine distemper virus, pig parvoviral and human parvovirus B19 is that template is carried out the LAMP specific detection respectively
Reaction system contains 10 * Thermopol buffer (U.S. NEB company) 2.5uL for the 25uL system, 50uMprimer FIP 0.8uL, 50uM primer BIP 0.8uL, 50uM primer F30.1uL, 50uM primer B30.1uL, 50uM primer LF 0.4uL, 50uM primer LF 0.4uL, 2.5mM dNTP mix 8uL, 5Mbetaine (U.S. Sigma company) 5uL, 1M MgSO40.2uL, 8U/uL BstDNA enzyme (U.S. NEB company) 1uL, ultrapure water 2.7uL; Template DNA 3uL; Reaction conditions: 63 ℃ of constant temperature 60min.
The result shows that this LAMP detection architecture specificity is good, can not detect other non-target viral nucleic acid.As shown in Figure 2, the LAMP specificity of Fig. 2 canine parvovirus, 1～4 is respectively canine parvovirus DNA, canine distemper virus CDNA, pig parvoviral DNA, human parvovirus B19 DNA; M is DNA Marker DL2000.
In addition, end product to the LAMP detection architecture carries out the specific amplification affirmation, cut the end product of LAMP detection architecture with restriction enzyme Sau3A I enzyme, obtain expecting the fragment of big or small 117bp and 124bp, amplifying specific is described, sees Fig. 3, Fig. 3 end product is confirmed the specificity of reaction through restriction enzyme Sau3A I digestion, obtain after the digestion expecting and the fragment of big or small 117bp and 124bp amplifying specific is described.M is DNA Marker DL2000; 1 is typical ladder diagram for the LAMP amplified production; 2 is that amplified production is after restriction endonuclease Sau3A I digestion.
Sequence table
＜110〉Shanghai Communications University
＜120〉the LAMP detection kit and the detection method thereof of canine parvovirus
<160>9
<170>PatentIn?version?3.3
<210>1
<211>20
<212>DNA
＜213〉artificial sequence
<400>1
gctgaggttg?gttatagtgc 20
<210>2
<211>21
<212>DNA
＜213〉artificial sequence
<400>2
tcctgtatct?tgatgtgcta?t 21
<210>3
<211>43
<212>DNA
＜213〉artificial sequence
<400>3
ctgcttgatt?ttcatctgtt?tgcgcttttg?aggcgtctac?aca 43
<210>4
<211>43
<212>DNA
＜213〉artificial sequence
<400>4
tggtgatcca?agatatgcat?ttggatctct?caggtgtttc?tcc 43
<210>5
<211>24
<212>DNA
＜213〉artificial sequence
<400>5
ctgcaatagg?tgttttaaat?ggcc 24
<210>6
<211>25
<212>DNA
＜213〉artificial sequence
<400>6
tagacaacat?ggtcagaaaa?ctacc 25
<210>7
<211>222
<212>DNA
＜213〉canine parvovirus
<400>7
gctgaggttg?gttatagtgc?accatattat?tcttttgagg?cgtctacaca?agggccattt 60
aaaacaccta?ttgcagcagg?acggggggga?gcgcaaacag?atgaaaatca?agcagcagat 120
ggtgatccaa?gatatgcatt?tggtagacaa?catggtcaga?aaactaccac?aacaggagaa 180
acacctgaga?gatttacata?tatagcacat?caagatacag?ga 222
<210>8
<211>19
<212>DNA
＜213〉artificial sequence
<400>8
tctgctactc?agccaccaa 19
<210>9
<211>21
<212>DNA
＜213〉artificial sequence
<400>9
acctccttca?gcttgaggca?a 21
Claims (6)
1. the LAMP detection kit of a canine parvovirus, it is characterized in that, this test kit comprises following 6 primers, and the base sequence of described primer is respectively shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQID NO:4, SEQ ID NO:5, SEQ ID NO:6.
2. the LAMP detection kit of canine parvovirus according to claim 1, it is characterized in that, test kit comprises reaction solution A and SYBR Green I, described reaction solution A is specially: component and the content of every 22uL reaction solution A are: 10 * Thermopol buffer 2.5uL, 2.5mM dNTP mix 8uL, 5M betaine 5uL, 1M MgSO40.2uL, 8U/uL BstDNA enzyme 1uL, ultrapure water 2.7uL, and following primer:
The primer 0.1uL of 50uM base sequence shown in SEQ ID NO:1;
The primer 0.1uL of 50uM base sequence shown in SEQ ID NO:2;
The primer 0.8uL of 50uM base sequence shown in SEQ ID NO:3;
The primer 0.8uL of 50uM base sequence shown in SEQ ID NO:4;
The primer 0.4uL of 50uM base sequence shown in SEQ ID NO:5;
The primer 0.4uL of 50uM base sequence shown in SEQ ID NO:6.
3. the LAMP detection kit of canine parvovirus according to claim 2 is characterized in that, described SYBR Green I is 1000 * SYBR Green I.
4. a detection method of utilizing the LAMP detection kit of canine parvovirus according to claim 1 is characterized in that, comprises the steps:
Step 1 is according to the nucleic acid of ordinary method extraction testing sample;
Step 2 is utilized described LAMP detection kit test sample nucleic acid, whether contains canine parvovirus in the judgement sample.
5. detection method according to claim 4 is characterized in that, in the step 2, described judgement is specially: observing the color of the reaction solution that obtains at last, is green as color, then contains canine parvovirus in the sample, if color is an orange, then do not contain canine parvovirus in the sample.
6. detection method according to claim 4 is characterized in that, in the step 2, shown in the testing process, the reaction conditions of LAMP amplification is: 63 ℃ of constant temperature 60min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009103116812A CN101899532B (en) | 2009-12-17 | 2009-12-17 | Canine parvovirus LAMP detection kit and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009103116812A CN101899532B (en) | 2009-12-17 | 2009-12-17 | Canine parvovirus LAMP detection kit and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101899532A true CN101899532A (en) | 2010-12-01 |
| CN101899532B CN101899532B (en) | 2012-08-22 |
Family
ID=43225449
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009103116812A Expired - Fee Related CN101899532B (en) | 2009-12-17 | 2009-12-17 | Canine parvovirus LAMP detection kit and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101899532B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110819736A (en) * | 2019-09-02 | 2020-02-21 | 深圳芭卡生物科技有限公司 | Primer and kit for detecting infection of three common pathogens of dog and application of primer and kit |
| CN110819735A (en) * | 2018-08-13 | 2020-02-21 | 北京美莱博医学科技有限公司 | Complete set of reagent and kit for identifying canine parvovirus |
| CN110819737A (en) * | 2019-09-02 | 2020-02-21 | 深圳芭卡生物科技有限公司 | Primer and kit for detecting cat intestinal infection pathogens and application of primer and kit |
| CN111394512A (en) * | 2020-03-12 | 2020-07-10 | 中国农业科学院北京畜牧兽医研究所 | Primer group for detecting canine parvovirus and application thereof |
-
2009
- 2009-12-17 CN CN2009103116812A patent/CN101899532B/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110819735A (en) * | 2018-08-13 | 2020-02-21 | 北京美莱博医学科技有限公司 | Complete set of reagent and kit for identifying canine parvovirus |
| CN110819736A (en) * | 2019-09-02 | 2020-02-21 | 深圳芭卡生物科技有限公司 | Primer and kit for detecting infection of three common pathogens of dog and application of primer and kit |
| CN110819737A (en) * | 2019-09-02 | 2020-02-21 | 深圳芭卡生物科技有限公司 | Primer and kit for detecting cat intestinal infection pathogens and application of primer and kit |
| CN111394512A (en) * | 2020-03-12 | 2020-07-10 | 中国农业科学院北京畜牧兽医研究所 | Primer group for detecting canine parvovirus and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101899532B (en) | 2012-08-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Rapid detection of peste des petits ruminants virus by a reverse transcription loop-mediated isothermal amplification assay | |
| Fischer et al. | Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| Wang et al. | A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus | |
| Kang et al. | Detection of canine parvovirus in fecal samples using loop-mediated isothermal amplification | |
| CN102140543B (en) | Multiple real-time quantitative PCR primer, probe and detection method for identifying viral pathogens relevant to fever with eruption syndrome as infection diseases | |
| CN110643745A (en) | Composition and kit for detecting feline calicivirus and feline parvovirus and application thereof | |
| CN103397105B (en) | Kit for detecting GII type norovirus and applications thereof | |
| CN113930547B (en) | RT-RAA fluorescence detection primer pair, kit and detection method for porcine epidemic diarrhea virus N gene | |
| CN110714098A (en) | Composition and kit for detecting feline calicivirus and feline infectious peritonitis virus and application of composition and kit | |
| CN101899521A (en) | Loop-mediated isothermal amplification (LAMP) detection method of Angiostrongylus cantonensis | |
| CN101899532B (en) | Canine parvovirus LAMP detection kit and detection method thereof | |
| CN103509880A (en) | LAMP detection kit of highly-pathogenic porcine reproductive and respiratory syndrome viruses | |
| Zeng et al. | A one‐step molecular biology method for simple and rapid detection of grass carp Ctenopharyngodon idella reovirus (GCRV) HZ08 strain | |
| CN101748197A (en) | Target sequence for detection of yersinia enterocolitica and kit | |
| CN112176109A (en) | Influenza A and B virus nucleic acid detection kit and use method thereof | |
| CN103397108A (en) | HCLV (hog cholera lapinized virus) fluorescent quantitation RT-PCR (reverse transcription-polymerase chain reaction) detection kit | |
| CN108950080B (en) | Primer probe set and kit for jointly detecting Sindbis virus and Getavirus based on dual-fluorescence PCR method | |
| CN110724768A (en) | Composition, kit and method for detecting feline infectious peritonitis virus | |
| CN102140556A (en) | Loop mediated isothermal amplification (LAMP) assay kit for porcine boca-like virus and detection method thereof | |
| CN106676199A (en) | Primers and method for detecting DogCV (dog circovirus) and efficient CL (completion and ligation)-RCA (rolling-circle-amplification)-RCR (rolling circle replication) detection kit | |
| WO2012104360A1 (en) | Rt-pcr test for the detection of avian hepatitis e virus | |
| Li et al. | Rapid detection of porcine kobuvirus in feces by reverse transcription loop-mediated isothermal amplification | |
| CN105296668B (en) | Primer, probe and kit for specifically detecting type 3 ungulate bocavirus parvovirus | |
| Luo et al. | Development of a loop-mediated isothermal amplification assay for rapid detection of bovine parvovirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120822 Termination date: 20141217 |
|
| EXPY | Termination of patent right or utility model |